 |
Previous Article | Next Article 
The Journal of Neuroscience, April 1, 2002, 22(7):2669-2678
Target Interaction Regulates Distribution and Stability of
Specific mRNAs
Jiang-Yuan
Hu,
Xu
Meng, and
Samuel
Schacher
Center for Neurobiology and Behavior, Columbia University College
of Physicians and Surgeons, and New York State Psychiatric Institute,
New York, New York 10032
 |
ABSTRACT |
Several factors regulate export of mRNAs from neuronal cell bodies.
Using in situ hybridization and RT-PCR, we examined how target interaction influences the distribution of mRNAs expressed in
sensory neurons (SNs) of Aplysia maintained in cell
culture. Interaction with a synaptic target has two effects on the
distribution of mRNA encoding an SN-specific peptide, sensorin: the
target affects the accumulation of sensorin mRNA at the axon hillock and the stability of sensorin mRNA exported to distal sites. Synapse formation with motor neuron L7 results in the accumulation of high
levels of sensorin mRNA in the axon hillock of the SN and in SN
neurites contacting L7. SNs cultured alone or in contact with motor
neuron L11, with which no synapses form, show a more uniform
distribution of sensorin mRNA in the cytoplasm of the SN cell body,
with little expression in neurites. Contact with L7 or L11 had little
or no effect on the distribution of two other mRNAs in the cytoplasm of
SN cell bodies. Sensorin mRNA exported to SN neurites after 1 d in
culture is more stable when the SN contacts L7 compared with SN
neurites that contact L11. After removal of the SN cell body, the
amounts of sensorin mRNA already exported to the neurites are greater
when neurites contact L7 compared with neurites in contact with L11.
The results indicate that target interaction and synapse formation
regulate both the accumulations of specific mRNAs destined for export
and their stability at distant sites.
Key words:
synapse formation; synapse specificity; mRNA expression; mRNA export; mRNA stability; cell culture; Aplysia
 |
INTRODUCTION |
During development, the formation of
specific synaptic connections in the CNS is established by a sequence
of cellular and molecular processes including axonal guidance,
recognition of postsynaptic targets, synaptic differentiation, and
activity-dependent synaptic stabilization and elimination (for review,
see Goodman and Shatz, 1993 ). Synapse formation and maintenance depend
on appropriate expression of many genes and trafficking of the encoded proteins to the proper region of the neuron. Expression of
synapse-associated genes may be controlled by an intrinsic
differentiation program as well as by extrinsic signals derived from
the presynaptic and postsynaptic cells. Local extrinsic signals,
diffusible or cell surface molecules, may modulate the expression of
these genes and determine either synapse formation or elimination (for
review, see Cabelli et al., 1997 ; Fitzsimonds and Poo, 1998 ; Sanes et al., 1998 ; Winberg et al., 1998 ). How do these signals mediate the
long-term maintenance of one set of synaptic connections and the
decline in efficacy or elimination of others in the same neuron? One
potential mechanism is that intercellular signals modulate the local
synthesis and targeting of macrocmolecules required for synapse
formation or maintenance.
The export of specific mRNAs into dendrites of vertebrate neurons is
well established (Crino and Eberwine, 1996 ; Knowles et al., 1996 ;
Steward, 1997 ). Some of these mRNAs are targeted to specific dendritic
sites after site-specific activation of synaptic connections (Steward
and Worley, 2001 ). Specific mRNAs, including those encoding
neuropeptides and other proteins, are also exported into axons of
invertebrate neurons (van Minnen, 1994 ; Schacher et al., 1999 ).
Isolated axons of invertebrate neurons have the machinery to synthesize
proteins (van Minnen et al., 1997 ; Spencer et al., 2000 ), including
proteins required for synapse formation and the expression of some
forms of long-term synaptic plasticity (Casadio et al., 1997 ;
Martin et al., 1997 ; Sherff and Carew, 1999 ; Sun et al., 2001 ; Schacher
and Wu, 2002 ). Thus, local translation of exported mRNAs
encoding synapse-specific macromolecules may contribute to the
formation or maintenance of specific synapses.
The large identified neurons of Aplysia form specific
synapses in dissociated cell culture even when a presynaptic neuron is
confronted with several targets (Camardo et al., 1983 ; Schacher and
Montarolo, 1991 ; Hawver and Schacher, 1993 ; Casadio et al., 1997 ;
Schacher et al., 1999 ). Contact with different synaptic targets leads
to expression of branch-specific morphological, physiological, and
biochemical features in sensory neurons (SNs). These include the
formation of varicosities with active zones (Glanzman et al., 1989 ),
expression of electrical excitability and synaptic plasticity (Glanzman
et al., 1990 ; Schacher and Montarolo, 1991 ; Sun and Schacher, 1996 ),
and expression of high levels of the SN-specific neuropeptide sensorin
(Brunet et al., 1991 ; Santarelli et al., 1996 ; Casadio et al., 1997 ).
The levels of sensorin mRNA and protein in the SN branches contacting
L7 correlate with changes in synaptic efficacy associated with new
synapse formation, long-term facilitation with 5-HT, and long-term
depression with Phe-Met-Arg-Phe-amide (Santarelli et al., 1996 ;
Sun et al., 2001 ). Our previous studies also indicated that target
interactions influence the export of sensorin mRNA in a branch-specific
manner (Schacher et al., 1999 ).
How does the target regulate levels of specific mRNAs in the distal
neurites? In the present study, we have addressed the role of
interactions with specific target neurons in regulating the
distribution of specific mRNAs in a presynaptic neuron using in
situ hybridization and RT-PCR techniques. We found that sensorin mRNA accumulates at the axon hillock and neurites of the SN that is
contacting a synaptic partner (L7) compared with SNs contacting a
target that fails to induce synapse formation (L11). Sensorin mRNA at
distal neurites is more stable when the SN neurites contact L7 compared
with SN neurites contacting L11. The results indicate that interaction
with a synaptic target can regulate both the distribution of specific
mRNAs destined for export and their stability at distal sites.
 |
MATERIALS AND METHODS |
Cell culture and electrophysiology. SNs were
isolated from pleural ganglia dissected from adult animals (80-100
gm); motor cells L7 and L11 were isolated from juvenile (1-3 gm)
abdominal ganglia and maintained in coculture for 1-3 d as described
previously (Rayport and Schacher, 1986 ; Schacher et al., 1999 ).
Individual SNs were plated in the same culture dish at very low density
to prevent cells from contacting each other. Cocultures consisted of
one SN with one L7 or one L11 (SN-L7 or SN-L11). In some cases, one
coculture of each type was plated in the same dish. Because each neuron
was isolated from the rest of the nervous system, glial cells typically
did not contaminate the cultures. Occasionally, a few glial cells were
attached to the cell body of L7 or L11. No glial cells were detected on
the distal axons or regenerated neurites.
Standard electrophysiological techniques were used to record the
amplitude of the EPSP evoked in L7 or L11 with stimulation of
each SN (Schacher and Montarolo, 1991 ; Schacher et al., 1999 ). Motor
cells (L7 and L11) were impaled with a microelectrode (resistance of
15-20 M ) containing 2.0 M K-acetate, 0.5 M
KCl, and 10 mM K-HEPES, pH 7.4, and held at 85 mV. Each
SN was stimulated with a brief (0.3-0.5 msec) depolarizing pulse to
evoke an action potential, using an extracellular electrode placed near
the cell body of the SN. The amplitude of the EPSPs evoked in L7 ranged
from 1 mV (day 1) to 45 mV (day 3). Action potentials in SNs never
evoked EPSPs in L11 (data not shown) (Glanzman et al., 1989 ;
Schacher and Montarolo, 1991 ).
In situ hybridization. Antisense oligonucleotide probes
were designed to cover specific coding portions of the target sequences used successfully in RT-PCR analyses of the mRNAs, synthesized (Genset,
La Jolla, CA), lyophilized, and redissolved in sterile distilled
water. The specific antisense oligonucleotide probe sequences were
as follows: (1) SN-specific protein sensorin:
TTAACTCTTCTTGACTCACCAACTGCCTGGAT- AGCA complimentary to nucleotide
(nt) 304-339 of its cDNA; (2) neuron-specific isoform of actin:
CACTTCATGATGGAGTTGAAGGTGGTCTCGTGGACA complimentary to nt 890-925 of
its cDNA; (3) common extracellular region for all isoforms of
Aplysia cell adhesion molecule (apCAM): TGGGGCCCTTGTTCACAATGCCATCAGTGCTGGCAC complimentary to nt 1078-1113 of
its cDNA. Their sense probes were also designed for use as nonspecific
controls. These probes were labeled by 3' end with biotin-deoxyUTP
(dUTP) according to the manufacturer's instructions (Boehringer
Mannheim, Indianapolis, IN).
All subsequent reagents and solutions used in the in situ
hybridization were made with diethyl pyrocarbonate-treated MilliQ water, and care was taken to avoid contamination with RNases. At 1 or
3 d after culture, cells were rinsed briefly in artificial seawater (ASW) and fixed in 0.1 M PBS, pH 7.4, containing 4% paraformaldehyde and 30% sucrose for 1 hr at room
temperature. The cultures were washed in 0.1 M PBS three times for 10 min at room temperature. The cells were digested with 1 µg/ml of proteinase K in TE buffer (0.1 M Tris-HCl with 1 mM
EDTA, pH 8.0) for 20 min at 37°C, then washed with PBS three times
for 10 min at room temperature. The cells were post-fixed with 4%
paraformaldehyde in PBS for 10 min at room temperature, then washed
three times for 10 min at room temperature with PBS. Cells were rinsed
in 0.1 M triethanolamine (pH 8.0, plus 0.25%
acetic anhydride) for 10 min at room temperature, equilibrated in 50%
deionized formamide in 5× SSC (saline sodium citrate, pH 7.2) for 20 min at 42°C, and hybridized overnight at 42°C in hybridization
buffer (50% deionized formamide, 5× SSC, 0.02% SDS, 2% blocking
reagent) containing 1.5 µg/ml of the biotin-labeled oligonucleotide
probes. Unbound probe was washed out with 2× SSC two times for 15 min
at 42°C and with 0.1× SSC two times for 15 min at 45°C. After
cultures were equilibrated in buffer I (0.1 M
Tris-HCl and 0.15 M NaCl) for 2 min and in buffer
II (0.1 M Tris-HCl with 0.15 M NaCl, 0.3% Triton X-100, and 2% normal goat serum) for 30 min at room temperature, cells were incubated in streptavidin-FITC (Invitrogen, Gaithersburg, MD; 1:200, diluted in
buffer II) for 4 hr at 4°C. Unbound antibody was washed out with PBS
three times for 15 min at room temperature. The hybridization signals
were visualized directly with fluorescent microscopy.
The specificity of biotin-labeled antisense oligonucleotide probe was
examined by hybridizing with labeled sense probe or excess unlabeled
probe, or by omitting probe in hybridization solution as well as RNase
pretreatment. All controls were negative. Cells were hybridized under
the same conditions to reduce variability in different experimental groups.
To observe the distribution of specific mRNAs in neurites and
varicosities of live SNs, the oligonucleotide probes (antisense or
sense) were labeled with fluorescent-tagged dUTP (Alexa488, Alexa568,
or Alexa594 from Molecular Probes, Eugene, OR) at the 3' end and
injected by pressure into the cell bodies of SNs. The concentration of
each probe in the injection electrode was 250 ng/µl dissolved in 0.5 M KCl buffered with 10 mM K-HEPES, pH 7.4. In
some cases, two oligonucleotides (two antisense probes or one antisense
and one sense probe) were coinjected into a single SN. The regenerated
neurites and varicosities of SNs were visualized (fluorescent or
Nomarski optics) 2-6 hr after injections with a SIT camera
(Dage 68; Dage-MTI, Michigan City, IN) attached to a Nikon Diaphot
inverted microscope. At earlier time points, staining of regenerated
neurites and varicosities was weak because insufficient time had
elapsed for fluorescent signal to build up at distal sites.
Dissection of cellular compartments and RT-PCR. Cultures
were rinsed with hemolymph-free medium (1:1 by volume of L15 plus Instant Ocean) and allowed to cool to 4°C for ~20 min. Bovine serum
albumin (10 µg/ml) was added to the final rinse to prevent dissected
cell bodies and neurites from sticking to the dish surface or the
transfer pipettes. In some cultures, the cell body of the SN was
removed 1 d before collection. The SN axon survives for several
days and maintains synaptic efficacy in the absence of the cell body
(Schacher and Wu, 2002 ). Each sample collected consisted of the SN axon
and the cell body and processes of the target cell (L7 or L11). Each
sample was transferred to 200 µl of Trizol (Invitrogen), and total
RNA was isolated after chloroform extraction and isopropanol precipitation. cDNA from each sample was synthesized by using random
hexamers as primers and reverse transcriptase (Superscript II).
Duplicate aliquots (2 µl) from each sample were used to amplify the
fragments by PCR (35 cycles), using primer sets for two transcripts: (1) SN-specific neuropeptide sensorin (Brunet et al., 1991 ),
AACAGAAACAGTCTTTCCCC and TCTTGACTCACCAACTGCC (nt 43-331) and (2)
neuron-specific isoform of actin (DesGroseillers et al., 1994 ),
ACCACCACCTTCAACTCCATC and GGGTAAGAGAAGCAAGAAAG (nt 900-1298). The
lengths of the synthesized fragments detected with ethidium bromide
staining on 1.2% agarose gels were identical to those predicted from
the known sequences in the database. For semi-quantitative comparison
of mRNA expression, the number of PCR cycles was adjusted initially to
ensure linearity of the fluorescent signals of the fragments amplified
by PCR [for methods, see Schacher et al. (1999) ]. Each PCR run
included amplifications and the detection of specific fragments from
known cDNAs of known concentrations (positive controls), amplifications
of each fragment from samples of medium collected near cells after
removal of the cells from the culture dish, and other negative controls.
Quantification and data analysis. The NIH Scion software
package was used to quantify average pixel intensities for hybridized signal of sensorin, actin, and apCAM mRNAs in SN cell bodies, axons,
neurites, and varicosities. For examining distribution within the SN
cell body, pixel intensity was averaged for six separate 5 × 5 µm squares within the peripheral cytoplasm of each SN cell body. The
squares were positioned at the following equivalent clock locations:
12, 2, 4, 6, 8, and 10 (sites 1 through 6). The cytoplasm of the cell
body adjacent to the SN axon was positioned at 6 o'clock (position 4),
and the signal intensity at the opposite side away from the axon (12 o'clock or position 1) was normalized as 100%. For each cell, the
intensities at the other five locations were normalized to that
measured at the 12 o'clock location. The overall effect of target
interaction was determined by ANOVA, and specific differences for the
different target interactions were determined by the Scheffe
multiple-comparison tests.
After pressure injection of labeled probes, staining intensity was
measured in the axon stump, regenerated neurites, and varicosities of
the SNs. Because the staining intensity of neurites and varicosities in
SNs contacting L11 declined significantly by 200 µm from the SN axon
stump, only structures that regenerated within that distance were
measured. The intensity of each neurite was measured at 50 µm
intervals. All neurites and their varicosities (sphere-like structures
>1.5 µm in diameter) emerging from the SN axon stump were measured.
Intensities for each compartment for each SN were averaged to provide
an intensity level for that SN.
In the RT-PCR analysis, to quantify differences in the levels of
sensorin mRNA expression, we normalized staining intensity for sensorin
fragments (percentage) by the signals obtained for actin fragments in
the same sample (staining intensity of sensorin/staining intensity of
actin × 100). We normalized sensorin levels with actin levels,
because the average staining intensity for actin fragments within the
compartment (cell body of the target along with the axonal processes
and neurites of the SN and the target) was not affected by cell
interaction. Scion software package was used to quantify average pixel
intensities for PCR fragments in each compartment. On the basis of
signals generated from known concentrations of sensorin cDNA (positive
controls), a twofold increase in staining intensity for sensorin A
fragment equaled approximately a fivefold increase in the starting cDNA levels.
The overall effects of target interaction were determined by ANOVA, and
differences between the means ± SEM for the different target
interactions were determined by the Scheffe multiple-comparison tests.
 |
RESULTS |
The large neurons of Aplysia regenerate and establish
stable synaptic connections after 4 d in culture (Montarolo et
al., 1986 ; Rayport and Schacher, 1986 ; Zhu et al., 1994 ). We reported previously (Schacher et al., 1999 ) that an SN-specific mRNA (sensorin) is exported to neurites, and overall levels are regulated by target interaction and synapse formation. In the present study, we examined whether the distribution of three mRNAs, including sensorin, is regulated by interactions with a specific target. We examined whether
the distribution of an mRNA encoding a family of membrane proteins
(apCAMs) is regulated by target interaction. This family of proteins,
homologous to NCAM and fasciclin II, is the major membrane protein in
Aplysia neurons, accounting for >10% of the total membrane
protein (Keller and Schacher, 1990 ; Mayford et al., 1992 ). Little or no
apCAM mRNA is exported from the cell bodies of Aplysia
neurons (Schacher et al., 1999 ). We also determined whether actin mRNA
in SNs is regulated by target interaction, because it is expressed
abundantly and is exported from the cell bodies of Aplysia neurons.
Target interaction regulates the distribution of sensorin mRNA in
cell bodies of SNs
Interaction with a specific target leads to the accumulation of
sensorin mRNA in the region of the cytoplasm adjacent to the axon
hillock. Using in situ hybridization, we measured the
staining intensity of oligonucleotide probes (experimental and control) that recognize sensorin mRNA in six areas of cytoplasm of the SN cell
body that were cultured alone or in SNs contacting L7 or L11 (Fig.
1). The six areas corresponded to the
following clock positions: 12 (position 1 and opposite the axon
hillock), 2, 4, 6 (axon hillock), 8, and 10. After day 3 in culture,
SNs contacting L7 had intense staining in areas adjacent to the axon
hillock (positions 3, 4, and 5) compared with SNs cultured alone or in contact with L11 (Figs. 1B,
2B). There was more
than a twofold difference in staining intensity near the axon hillock
in SNs contacting L7. SNs in contact with target neuron L11 (no synapse formation) show a uniform distribution in cytoplasm of the SN cell body
(Figs. 1B, 2B). In contrast, we did
not observe obvious differences in staining for sensorin mRNA in the
cell bodies of SNs cultured alone or in SNs contacting L7 versus L11
after 1 d in culture (Figs. 1A,
2A). In each case, there was a small enhancement in
staining near the axon hillock (site 4; p < 0.05). SNs
cultured alone showed the same small enhancement at the axon hillock
observed on day 3. Contact and synapse formation with motor neuron
L7 results in more sensorin mRNA accumulating at the axon
hillock of SN cell bodies.

View larger version (53K):
[in this window]
[in a new window]
|
Figure 1.
Target interaction regulates the distribution of
sensorin mRNA in SN cell bodies. Each micrograph is a pseudocolor
representation of fluorescent signals (red is high
intensity; blue is low intensity) in SNs cultured alone
(SN) and in SNs cocultured with L7
(SN-L7) or with L11 (SN-L11). The
low-intensity staining at the outer perimeter of each cell body is an
artifact of computer enhancement. Axons emerge from SN cell bodies at
approximately the 6 o'clock position. A, After 1 d
in culture, there is little difference in the staining intensity within
the cytoplasm. There is a small increase in staining near the axon
hillock. B, By 3 d there is a significant
difference in staining within the cell bodies. Staining intensity is
highest where the axon emerges from the SN cell body when the SN
contacts L7. Note the uniform staining when SN contacts
L11. C, Staining is very weak in SN cell bodies (day 3 in culture) when incubated with control (sense) probes. Scale bar, 25 µm.
|
|

View larger version (29K):
[in this window]
[in a new window]
|
Figure 2.
Interaction with L7 leads to increased
accumulation of sensorin mRNA in the axon hillock of the SN. Each graph
summarizes relative intensity at five sites in the cytoplasm of SN cell
bodies (sites 2-6) compared with
site 1, which is the portion of the cytoplasm equivalent
to the 12 o'clock position. Sites 2-6
are the 2, 4, 6 (axon), 8, and 10 o'clock positions, respectively. At
each time point, the height of each bar is the mean ± SEM
relative intensity from 10 SNs for each culture condition.
A, Interaction of SN with a target after 1 d in
culture. The distribution of sensorin mRNA in the cytoplasm of SN cell
bodies was not influenced significantly by target interaction
(two-factor ANOVA; df = 10, 135; F = 1.34;
p > 0.10). There was a small effect of site
location on staining intensity (p < 0.01).
B, Distribution of sensorin mRNA in SN cell bodies is
affected significantly by interaction with L7 in 3 d cultures. An
ANOVA (two-factor) indicated an overall significant effect (df = 10,135; F = 11.042; p < 0.001). Interaction with L7 resulted in a significant difference at
sites 3 (4 o'clock) and 4 (6 o'clock)
compared with SN and SN-L11 cultures (p < 0.01 for both; Scheffe test) and at site 5 (8 o'clock)
compared with SN-L11 cultures (p < 0.05).
|
|
The staining for sensorin mRNA in SN neurites contacting the major
processes of L7 is high compared with staining in SN neurites contacting L11 (Fig.
3A-D). The major
processes of L7 are a preferred site of neurite growth and the
formation of varicosities with transmitter release sites (Glanzman et
al., 1989 ). In contrast, SN neurites contacting L11 have few
varicosities, and those varicosities fail to develop transmitter
release sites (Glanzman et al., 1989 ; Schacher and Montarolo,
1991 ). Little staining for sensorin mRNA was detected in SN neurites
contacting the major processes of L11 (n = 5 cultures)
(Fig. 3A,B). Synapse formation with
L7 results in higher levels of sensorin mRNA in SN neurites compared
with SN neurites contacting L11. The intensity of staining also
correlates with the amplitude of the EPSPs (Fig.
3C-F). Low levels of staining are
detected when EPSP amplitudes are <20 mV. These results suggest that
mRNA export from the SN cell bodies and the stability of the mRNA once
it arrives in neurites are regulated by target interaction and synapse
formation.

View larger version (42K):
[in this window]
[in a new window]
|
Figure 3.
SN neurites interacting with L7 on day 3 in
culture contain high levels of sensorin mRNA compared with SN neurites
interacting with L11. Each micrograph is a pseudocolor representation
of fluorescent signals (red is high intensity;
blue is low intensity) in SNs cocultured with L11
(SN-L11) or with L7 (SN-L7) after
3 d. The low-intensity staining at the outer perimeter of each
cell body is an artifact of computer enhancement. A,
B, Staining in the SN cell body
(A) is distributed uniformly (Figs. 1, 2) and
virtually absent in SN neurites regenerating along the major processes
of L11 (center of micrograph from left to
right; see D and
F). This level of staining was detected in all
five SN-L11 cultures. C, D, Stimulation
of the SN evoked a 12 mV EPSP on day 3. Staining of cytoplasm near the
SN axon is high (C), and modest staining is
detected in SN neurites interacting with major processes of L7
(D). This level of staining was observed in all
three cultures in which EPSPs were <20 mV. E,
F, Stimulation of the SN evoked a 43 mV EPSP on day 3. Staining of cytoplasm near SN axon is high (E),
and staining in SN neurites interacting with major processes of L7
(F) is distributed over all of the major
processes of L7. This level of staining was detected in all three
cultures in which EPSPs were >30 mV. Scale bar, 25 µm.
|
|
The distribution of two other mRNAs in
the cell bodies of SNs was not regulated
by target interaction (Figs. 4, 5). Actin mRNA, but not apCAM mRNA, is exported into the axons of
Aplysia neurons (Schacher et al., 1999 ). Actin mRNA was
expressed at high levels and was distributed uniformly throughout the
cell bodies of all SNs (Figs. 4A, 5A).
Target interaction also did not affect the distribution of apCAM mRNA.
As was found for sensorin, there was a small increase in staining
intensity for apCAM mRNA (~50%) in the cytoplasm adjacent to the
axon hillock of the SN (Figs. 4B, 5B).
These results suggest the possibility that mRNAs encoding secretory or
membrane proteins accumulate at or near the axon hillock. The
distribution of some of these mRNAs within the cytoplasm of neuronal
cell bodies is regulated by target interactions.

View larger version (52K):
[in this window]
[in a new window]
|
Figure 4.
Target interaction does not affect distribution of
apCAM and actin mRNAs in SN cell bodies. Each micrograph is a
pseudocolor representation of fluorescent signals (red
is high intensity; blue is low intensity) in SNs
cultured alone (SN) and in SNs cocultured with L7
(SN-L7) or with L11 (SN-L11) after
3 d in culture. Axons emerge from SN cell bodies at approximately
the 6 o'clock position. The low-intensity staining at the outer
perimeter of each cell body is an artifact of computer enhancement.
A, Staining for actin mRNA is relatively high (compared
with sensorin or apCAM mRNAs) and distributed uniformly in SN cell
bodies for each culture condition. B, Staining for apCAM
mRNA is enhanced near the SN axon (6 o'clock position) for each
culture condition. Scale bar, 25 µm.
|
|

View larger version (36K):
[in this window]
[in a new window]
|
Figure 5.
Target interaction has no significant effect
on distribution of actin or apCAM mRNAs in SN cell bodies after 3 d in culture. Each graph summarizes relative intensity at five sites in
the cytoplasm of SN cell bodies (sites
2-6) compared with site
1, which is the portion of the cytoplasm equivalent to
the 12 o'clock position. Sites 2-6 are
the 2, 4, 6 (axon), 8, and 10 o'clock positions, respectively. The
height of each bar is the mean ± SEM from 10 SNs for each culture
condition. A, Distribution of actin mRNA is uniform. An
ANOVA (two-factor) indicated no overall significant effect (df = 10, 135; F = 0.593; p > 0.7),
including no effect of treatment or site on staining intensity.
B, Distribution of apCAM mRNA is not affected by target
interaction. An ANOVA (two-factor) indicated no overall significant
effect (df = 10, 135; F = 0.48;
p > 0.9), but there was a significant effect of
site location on staining intensity (p < 0.001).
|
|
Target interaction regulates the distribution and stability of mRNA
in SN neurites
We next examined whether the mRNAs exported to distal neurites are
affected by target interaction. We used two methods: (1) injection of
labeled probes into the cell body of SNs and monitoring the subsequent
distribution of the labeled probes in live cells or (2) RT-PCR analyses
of mRNA in neurites after removal of the SN cell body.
We first tested the probe injection method for monitoring the
distribution of mRNA. After injecting labeled probes recognizing an
mRNA that is restricted to the cell body (apCAM), fluorescent staining
was detected primarily in the cell body (Fig.
6A). In contrast,
staining was detected in axons and neurites after injecting probes
recognizing mRNAs that are exported (sensorin and actin) (Fig.
6A,B). Another validation of this
method is that labeled antisense probes were detected in the distal
processes, whereas labeled sense probes were barely detectable (Fig.
7). We therefore applied this technique
to evaluate staining intensity for probes recognizing actin or sensorin
mRNA in distal SN neurites contacting either L7 or L11. We used two
types of cultures: SN contacting a single target and SN contacting two
targets.

View larger version (86K):
[in this window]
[in a new window]
|
Figure 6.
The distribution of
specific mRNAs in living cells is comparable with that detected
with previous RT-PCR results. A, Sensorin mRNA, but not
apCAM mRNA, is exported into the SN axon. Antisense oligos for sensorin
and apCAM were coinjected into same SN cell body (left
panel). At 3 hr after injection, antisensorin probe
(labeled with Molecular Probes Alexa-488 dUTP; middle
panel), but not anti-apCAM probe (labeled with Alexa-568
dUTP; right panel), is detected in the
bifurcating axon of the SN (arrow). Staining intensity
in the SN cell body was comparable for the two probes (<5%
difference). B, Both sensorin and actin mRNAs are
exported into axons. Antisense probes (Alexa-488 dUTP for sensorin and
Alexa-594 dUTP for actin) were coinjected into the SN cell body (not in
image). After 3 hr, significant signals for both probes (sensorin
in middle panel and actin in right
panel) were detected in SN neurites
(arrow) contacting L7 axon (extending from
left to right in center of
micrograph) ~200 µm from the SN cell body (left
panel). All oligos contain labeled dUTP at the 3'-end.
Scale bar, 25 µm.
|
|

View larger version (154K):
[in this window]
[in a new window]
|
Figure 7.
Antisense probes are transported to
neurites selectively. A, Micrograph of SN-L7 culture
after 3 d. The major processes of L7 extend toward the
right. Both sense and antisense probes for sensorin mRNA
were coinjected into the cell body of the SN, and fluorescent images
were taken 4 hr after injection. The outlined area,
which includes an axon stump of L7, is viewed at higher magnifications
in B-D. Scale bar, 50 µm.
B, High- magnification micrograph of stump and major
processes of L7. Fluorescent images from this area are viewed in
C and D. Scale bar, 12.5 µm.
C, Antisense probe for sensorin mRNA (labeled with
Alexa-594) labels neurites and varicosities contacting the major
processes of L7. D, Sense probe for sensorin (labeled
with Alexa-488) fails to label the same neurites and varicosities.
Staining intensity for each probe in the SN cell body was comparable
(<5% difference). Scale bars, 12.5 µm.
|
|
Staining for probes recognizing sensorin and actin mRNA is stronger in
SN neurites contacting L7 compared with staining in SN neurites
contacting L11 (Fig. 8). In general,
staining in the SN neurites contacting L11 was below levels of
detection by 200 µm from the stump of the SN axon (Fig. 8, compare
A3 and A4 with B3 and
B4). Within this 200 µm zone, the staining
intensity of the SN varicosities after normalization with the staining
intensity measured in the axon stump (Fig. 8, bottom portions of
A3, A4, B3, and B4)
was ~2.3 fold higher for those contacting L7 versus L11
(n = 6 cultures each; p < 0.01).

View larger version (109K):
[in this window]
[in a new window]
|
Figure 8.
Distribution of both actin and sensorin
mRNAs in live SNs is affected by target interaction. SNs cultured with
either L11 (A) or L7 (B)
after 3 d were coinjected with fluorescent-tagged antisense probes
for sensorin (Alexa-488 dUTP; A3, B3) and
actin (Alexa-594 dUTP; A4, B4).
A1, B1, Nomarski optics image of the
cocultures. Areas encompassed by the rectangles are
viewed in the remaining images. Scale bars, 30 µm. A2,
B2, Nomarski optics image of areas viewed for
distribution of tagged probes. Scale bars, 25 µm. A3,
A4, B3, B4,
Epifluorescent views of staining by antisense probes for sensorin
(3) and actin (4) 4 hr
after injections. SN neurites and the few varicosities interacting with
axon of L11 show weak staining, which diminishes significantly
after ~200 µm from the SN axon stump (bottom portion
of micrographs in A3 and A4). The
axon stump shows significant staining. By contrast, SN varicosities
contacting L7 show significant staining with probes for both sensorin
and actin mRNA (B3, B4). Staining
intensity of SN neurites and varicosities contacting L7 was 15.8 ± 1.9 and 30.6 ± 2.0, respectively (n = 6 cultures). Staining intensity of SN neurites and varicosities
contacting L11 was 9.6 ± 1.2 and 13.5 ± 1.5, respectively.
An ANOVA indicated a significant difference in staining when
contacting L7 versus L11 (df = 1, 10; F = 20.157; p < 0.001). Staining in neurites
(p < 0.03) and varicosities
(p < 0.01) was significantly higher when
contacting L7 versus L11.
|
|
A significant difference in staining was detected as well when probes
were injected into the cell body of a single SN in contact with two
separate targets (L7 and L11 or two L7s). We compared staining
intensity detected in the regenerating neurites emerging from the
stumps of bifurcate axons placed near each target (Martin et al., 1997 ;
Schacher et al., 1999 ). There was approximately a twofold increase in
staining intensity of SN neurites and varicosities contacting L7
compared with staining in neurites and varicosities contacting L11
(Fig. 9A). There was no
significant difference in staining when the SN contacted two L7 targets
(Fig. 9B). These results suggest that the target can
regulate the levels of exported mRNAs in SN neurites and varicosities.
The differences can be a consequence of target interaction on initial
export of mRNA into the regenerated neurites and varicosities or the
stability of mRNAs in those cellular compartments once they arrive.

View larger version (20K):
[in this window]
[in a new window]
|
Figure 9.
Branch-specific differences in the distribution of
sensorin mRNA detected with fluorescent-tagged antisense probe injected
into a single SN interacting with multiple contacts. A,
Staining (pixel intensity) of SN axons, neurites, and varicosities when
cocultured with both L7 and L11 was averaged for five cultures.
Staining intensity in the axons was not significantly different.
Staining intensity of neurites and varicosities regenerated from SN
branch contacting L7 was significantly greater than intensity of
neurites and varicosities regenerated from SN branch contacting L11. An
ANOVA (two-factor) revealed an overall difference (df = 2, 16;
F = 5.279; p < 0.02). Staining
in both neurites (p < 0.03) and
varicosities (p < 0.02) was significantly
higher when they contacted L7 compared with L11. B,
Staining of SN axons, neurites, and varicosities when cocultured with
two L7 cells was averaged for five cultures. Placement of each SN-L7
interaction in a specific group was determined randomly. Average EPSP
amplitudes for the two groups were not significantly different
(19.8 ± 3.2 mV vs 18.4 ± 3.0 mV). An ANOVA indicated no
significant difference in staining at the two branches (df = 2, 16; F = 0.299; p > 0.7).
|
|
To measure stability of mRNA in the distal neurites, we examined the
consequences of target interaction on mRNA levels detected in distal
neurites after removal of the SN cell body. Previously, we found that
the level of sensorin mRNA in SN neurites contacting L7 was not
significantly different from the level in SN neurites contacting L11 on
day 1 in culture. With further interaction (day 4), there was more
sensorin mRNA in neurites contacting L7 versus SN neurites contacting
L11 (Schacher et al., 1999 ). We therefore tested for stability by
comparing levels of sensorin mRNA in SN neurites after 1 d in
culture with that detected in neurites 1 d after removal of the SN
cell body (Fig.
10A,B).
SN neurites detached from their cell bodies continued to regenerate and
form new synapses with L7 (Schacher and Wu, 2002 ).

View larger version (126K):
[in this window]
[in a new window]
|
Figure 10.
Target influences stability of transported mRNA.
A, B, Photographs of SN-L7 cultures 24 hr
after dissection of SN cell body (A) and matching
controls (B). C, D,
Stability of sensorin mRNA in SN axon and neurites is affected by
target. RT-PCR fragments for actin and sensorin mRNA were amplified
from the neurites of SNs ( SN cell body for 24 hr or control
cultures) interacting with targets (L7 or L11) from two sets of SN-L7
and SN-L11 cocultures in each condition. When normalized for actin mRNA
levels in the entire culture, levels of sensorin mRNA were not affected
in SN-L7 cultures after cell body dissection, whereas there was a
significant reduction after dissection when SNs interacted with L11. An
ANOVA indicated a significant effect of treatment (df = 3, 18;
F = 20.036; p < 0.001).
Removal of the SN cell body did not significantly affect sensorin mRNA
levels in the neurites contacting each L7 (each cell was selected at
random to belong to a specific group; p > 0.7).
Removal of the SN cell body resulted in a significant decline in
sensorin mRNA in SN neurites contacting L11
(p < 0.01).
|
|
Sensorin mRNA exported from the SN cell body is more stable when the SN
contacts L7 compared with L11 (Fig. 10C,D). After
removal of the SN cell body (24 hr), amounts of sensorin mRNA already exported to the neurites are not significantly lowered when SN neurites
contact L7 (Fig. 10C) (n = 5 cultures each).
In contrast, sensorin mRNA declines significantly (Fig.
10D) (n = 6 cultures each;
p < 0.01) in neurites contacting L11. Thus,
preexisting sensorin mRNA in SN neurites contacting L11 appears to be
less stable than sensorin mRNA in SN neurites contacting L7.
 |
DISCUSSION |
Our results indicate that the target modulates the distribution of
mRNAs in both the cell body and neurites of the presynaptic neuron. As
synapses form and strengthen, mRNA encoding sensorin accumulates near
the axon hillock of the SN. Accumulation of sensorin or actin mRNA in
SN neurites and varicosities is regulated by the influence of the
target on local mRNA stability and transport to SN neurites and varicosities.
The accumulation of sensorin mRNA and to some extent apCAM mRNA at the
axon hillock suggests that transcripts encoding proteins destined for
distal neurites (Keller and Schacher, 1990 ; Santarelli et al., 1996 )
are targeted to sites in the cell body adjacent to the axon hillock
(Litman et al., 1993 ). Such targeting may be mediated by structural
sequences within the mRNAs and the potential interaction of the mRNAs
with binding proteins associated with the intracellular transport
apparatus (Bassell et al., 1994 ; Litman et al., 1994 ; Behar et
al., 1995 ; Knowles et al., 1996 ; Mayford et al., 1996 ; Kiebler et al.,
1999 ; Zhang et al., 2001 ). The presence of mRNAs at the axon hillock
would facilitate access of the translated products in the axon hillock
to the transport apparatus for export to specific distal sites. Because
apCAM mRNA is not transported, regulation of its overall expression
takes place in the cell body (transcription or translation) and via
turnover of existing proteins throughout the cell (Bailey et al., 1992 ;
Zhu et al., 1995 ; Schacher et al., 1999 ). In the case of
sensorin, the accumulation of its mRNA at the axon hillock may also
facilitate the transport of sensorin mRNA to distal synaptic sites
(Schacher et al., 1999 ).
Synapse formation with L7 modulates the targeting of sensorin mRNA to
the axon hillock. The consequences of target interaction increase
during the first few days in culture. Target interaction might affect
accumulation of sensorin mRNA selectively at the axon hillock by
regulating splicing events that serve to influence the expression of
appropriate mRNA sequences that are required for targeting sensorin
mRNA to the axon hillock. Alternatively, target interaction could
modulate the expression of selective binding proteins required for mRNA
distribution or targeting. Identification of the critical elements for
targeting sensorin mRNA will help determine the mechanism mediating its
selective accumulation at the axon hillock. The overall effect of this
accumulation in the axon hillock is to increase the level of expression
of sensorin at distal synaptic sites (Santarelli et al., 1996 ; Casadio et al., 1997 ).
The target also regulates the level of sensorin mRNA in SN neurites. As
was found with RT-PCR analyses (Schacher et al., 1999 , their Fig.
4), staining for sensorin in SN neurites correlated with EPSP
amplitude. Because the number of SN varicosities contacting the major
processes of L7 increases with EPSP amplitude (Glanzman et al., 1989 ;
Schacher and Montarolo, 1991 ), the high level of sensorin mRNA staining
may reflect the greater density of SN varicosities contacting L7. SN
varicosities may also represent a preferred target site where sensorin
mRNA accumulates. Sensorin neuropeptide is concentrated at SN
varicosities (Santarelli et al., 1996 ). Translation from the
accumulated mRNA in the axon hillock and subsequent transport along
with local translation of mRNA at distal sites may contribute to the
increase expression of the peptide in varicosities contacting L7. The
peptide may have a direct physiological role at SN synapses (Brunet et
al., 1991 ) or some other signaling function that affects the properties
of SN or L7 or both.
Target interaction does not appear to influence the distribution of
actin mRNA in the cell body of the SN where it is expressed uniformly
in the cytoplasm. The uniform expression of actin mRNA throughout the
cell body reflects the distribution of the protein itself and suggests
that mRNAs encoding this cytoplasmic protein either lack instructions
for targeting or contain structural elements that ensure cell body-wide
distribution. For example, actin mRNA may contain sequences that
prevent its degradation in the cell body, whereas sensorin mRNA may be
degraded unless it is protected by binding a molecule that is targeted
to the region of the axon hillock (Cooperstock and Lipshitz, 1997 ). In
this scheme, target interaction enhances the expression of a molecule
that is targeted to specific sites and serves to stabilize the
expression of specific mRNAs that happen to find their way to those
sites. This type of mechanism may explain why expression of actin mRNA
in SN neurites is enhanced by interaction and synapse formation with L7
and not when the SN neurites contact L11 and fail to form synapses
(Glanzman et al., 1989 ). The local translation of actin mRNA at
varicosities may facilitate neuritic growth (Zhang et al., 2001 ) or the
formation of new synapses (Hatada et al., 2000 ; Schacher and Wu,
2002 ).
The greater amount of staining of sensorin and actin mRNA in SN
neurites and varicosities contacting L7 compared with neurites and
varicosities contacting L11 suggests that accumulation at varicosities
may be mediated via target-dependent effects on the stability of the
mRNA once it arrives at varicosities. That the stability is modulated
is supported by the RT-PCR analysis of the level of sensorin mRNA
expression remaining in SN neurites 24 hr after removal of the SN cell
body. Preexisting sensorin mRNA in the neurites appears to be stable if
the SN neurites contact L7 compared with SN neurites that contact L11.
A similar mechanism may contribute to the greater staining intensity
for actin mRNA in live SN neurites and varicosities when they contact
L7 compared with staining intensity in SN neurites and varicosities
contacting L11. Because the target neuron has high levels of actin
mRNA, we could not test directly the stability of actin mRNA stability in the SN neurites contacting the target. The target might influence expression of mRNA binding proteins that target mRNAs to
varicosities and serve to stabilize local mRNA. When contacting L7,
proteins that might protect mRNA from degradation are induced and
transported to distal neurites of SNs. When contacting L11, SNs may
express low levels of these proteins, leading to the degradation of
mRNAs at distal sites. These molecules might include those critical for
the development or acquisition of the macromolecular complex required
for local protein synthesis at distal sites (Tiedge et al., 1999 ;
Kiebler and DesGroseillers, 2000 ; Steward and Schuman, 2001 ). Thus the
same mechanisms that might affect distribution of some mRNAs in the
cell body may contribute to levels of mRNA expression at distal sites.
 |
FOOTNOTES |
Received Oct. 22, 2001; revised Dec. 25, 2001; accepted Jan. 22, 2002.
This research was supported by National Science Foundation Grant
IBN-9808938 and National Institutes of Health (NIH) Grant MH-60387, and
animals were provided by the National Center for Research Resources for
Aplysia at the University of Miami supported by NIH Grant RR
10294. We thank Rachel Yarmolinsky and Eve Vagg for assistance in
preparing the figures, and Drs. Kupfermann and Schwartz for comments on
this manuscript.
Correspondence should be addressed to Dr. Samuel Schacher, Center for
Neurobiology and Behavior, Columbia University College of Physicians
and Surgeons, New York State Psychiatric Institute, 1051 Riverside
Drive, New York, NY 10032. E-mail:
sms2{at}columbia.edu.
 |
REFERENCES |
-
Bailey CH,
Chen M,
Keller F,
Kandel ER
(1992)
Serotonin-mediated endocytosis of apCAM; an early step of learning-related synaptic growth in Aplysia.
Science
256:645-648[Abstract/Free Full Text].
-
Bassell GJ,
Zhang H,
Kosik KS
(1994)
Association of polyA mRNA with microtubules in cultured neurons.
Neuron
12:571-582[Web of Science][Medline].
-
Behar L,
Marz R,
Sadot E,
Barg J,
Ginzburg I
(1995)
Cis-acting signals and trans-acting proteins are involved in tau mRNA targeting into neurites of differentiating neuronal cells.
Int J Dev Neurosci
13:113-127[Web of Science][Medline].
-
Brunet J-F,
Shapiro E,
Foster SA,
Kandel ER,
Yuichi I
(1991)
Identification of a peptide specific for Aplysia sensory neurons by PCR-based differential screening.
Science
252:856-859[Abstract/Free Full Text].
-
Cabelli RJ,
Shelton DL,
Segal RA,
Shatz CJ
(1997)
Blockade of endogenous ligands of trkB inhibits formation of ocular dominance columns.
Neuron
19:63-76[Web of Science][Medline].
-
Camardo J,
Proshansky E,
Schacher S
(1983)
Identified Aplysia neurons form specific chemical synapses in culture.
J Neurosci
3:2614-2620[Abstract].
-
Casadio A,
Martin KC,
Bailey CH,
Chen M,
Zhu H,
Kandel ER
(1997)
Molecular mechanisms underlying synapse-specific long-term facilitation of Aplysia sensory to motor synapses.
Soc Neurosci Abstr
24:234.
-
Cooperstock RL,
Lipshitz HD
(1997)
Control of mRNA stability and translation during Drosophila development.
Semin Cell Dev Biol
8:541-549[Web of Science][Medline].
-
Crino PB,
Eberwine J
(1996)
Molecular characterization of the dendritic growth cone: regulated mRNA transport and local protein synthesis.
Neuron
17:1173-1187[Web of Science][Medline].
-
DesGroseillers L,
Auclair D,
Wickham L,
Maalouf M
(1994)
A novel actin cDNA is expressed in the neurons of Aplysia californica.
Biochim Biophys Acta
121:322-324.
-
Fitzsimonds RM,
Poo M-M
(1998)
Retrograde signaling in the development and modification of synapses.
Physiol Rev
78:143-170[Abstract/Free Full Text].
-
Glanzman DL,
Kandel ER,
Schacher S
(1989)
Identified target motor neuron regulates neurite outgrowth and synapse formation of Aplysia sensory neurons in vitro.
Neuron
3:441-450[Web of Science][Medline].
-
Glanzman DL,
Kandel ER,
Schacher S
(1990)
Target-dependent structural changes accompanying long-term synaptic facilitation in Aplysia neurons.
Science
249:799-802[Abstract/Free Full Text].
-
Goodman CS,
Shatz CJ
(1993)
Developmental mechanisms that generate precise patterns of neuronal connectivity.
Cell [Suppl]
72:77-98.
-
Hatada Y,
Wu F,
Sun ZY,
Schacher S,
Goldberg DJ
(2000)
Presynaptic morphological changes associated with long-term synaptic facilitation are triggered by actin polymerization at pre-existing varicosities.
J Neurosci
20:RC82(1-5).
-
Hawver D,
Schacher S
(1993)
Selective fasciculation as a mechanism for the formation of specific chemical connections between Aplysia neurons in vitro.
J Neurobiol
24:368-383[Web of Science][Medline].
-
Keller F,
Schacher S
(1990)
Neuron-specific membrane glycoproteins promoting neurite fasciculation in Aplysia californica.
J Cell Biol
111:2637-2650[Abstract/Free Full Text].
-
Kiebler MA,
DesGroseillers L
(2000)
Molecular insights in mRNA transport and local translation in the mammalian nervous system.
Neuron
25:19-28[Web of Science][Medline].
-
Kiebler MA,
Hemraj I,
Verkade P,
Kohrman M,
Fortes P,
Marion RM,
Ortin J,
Dotti CG
(1999)
The mammalian Staufen protein localizes to the somatodendritic domain of cultured hippocampal neurons: implications for its involvement in mRNA transport.
J Neurosci
19:288-297[Abstract/Free Full Text].
-
Knowles RB,
Sabry JH,
Martone ME,
Deerinck TJ,
Ellisman MH,
Bassell GJ,
Kosik KS
(1996)
Translocation of RNA granules in living neurons.
J Neurosci
16:7812-7820[Abstract/Free Full Text].
-
Litman P,
Barg J,
Rindzoonski L,
Ginzburg I
(1993)
Subcellular localization of tau mRNA in differentiating neuronal cell culture: implications for neuronal polarity.
Neuron
10:627-638[Web of Science][Medline].
-
Litman P,
Barg J,
Ginzburg I
(1994)
Microtubules are involved in the localization of tau mRNA in primary neuronal cultures.
Neuron
13:1463-1474[Web of Science][Medline].
-
Martin KC,
Casadio A,
Zhu H,
Yaping E,
Rose JC,
Chen M,
Bailey CH,
Kandel ER
(1997)
Synapse-specific, long-term facilitation of Aplysia sensory to motor synapses: a function for local protein synthesis in memory storage.
Cell
91:927-938[Web of Science][Medline].
-
Mayford M,
Barzilai A,
Keller F,
Schacher S,
Kandel ER
(1992)
Modulation of an NCAM-related adhesion molecule with long-term synaptic plasticity in Aplysia.
Science
256:638-644[Abstract/Free Full Text].
-
Mayford M,
Baranes D,
Podsypanina K,
Kandel ER
(1996)
The 3' UTR of CAMKII
mRNA is a cis-acting signal for the localization and translation of mRNA in dendrites.
Proc Natl Acad Sci USA
93:13250-13255[Abstract/Free Full Text]. -
Montarolo PG,
Goelet P,
Castellucci VF,
Morgan J,
Kandel ER,
Schacher S
(1986)
A critical period for macromolecular synthesis in long-term heterosynaptic facilitation in Aplysia.
Science
234:1249-1254[Abstract/Free Full Text].
-
Rayport SG,
Schacher S
(1986)
Synaptic plasticity in vitro: cell culture of identified Aplysia neurons mediating short-term habituation and sensitization.
J Neurosci
6:759-763[Abstract].
-
Sanes JR,
Apel ED,
Gautam M,
Glass D,
Grady RM,
Martin PT,
Nicholl MC,
Yancopoulus GD
(1998)
Agrin receptors at the skeletal neuromuscular junction.
Ann NY Acad Sci
841:1-13[Web of Science][Medline].
-
Santarelli L,
Montarolo PG,
Schacher S
(1996)
Neuropeptide localization in varicosities of Aplysia sensory neurons is regulated by target and neuromodulators evoking long-term synaptic plasticity.
J Neurobiol
31:297-308[Web of Science][Medline].
-
Schacher S,
Montarolo PG
(1991)
Target-dependent structural changes in sensory neurons of Aplysia accompany long-term heterosynaptic inhibition.
Neuron
6:679-690[Web of Science][Medline].
-
Schacher S, Wu F (2002) Synapse formation in the absence of
cell bodies requires protein synthesis. J Neurosci, in
press.
-
Schacher S,
Wu F,
Panyko JD,
Sun ZY,
Wang D
(1999)
Expression and branch-specific export of mRNA are regulated by synapse formation and interaction with specific postsynaptic targets.
J Neurosci
19:6338-6347[Abstract/Free Full Text].
-
Sherff CM,
Carew TJ
(1999)
Coincident induction of long-term facilitation in Aplysia: cooperativity between cell bodies and remote synapses.
Science
285:1911-1914[Abstract/Free Full Text].
-
Spencer GE,
Syed NI,
van Kesteren E,
Lukowiak K,
Geraerts WP,
van Minnen J
(2000)
Synthesis and functional integration of a neurotransmitter receptor in isolated invertebrate axons.
J Neurobiol
44:72-81[Web of Science][Medline].
-
Steward O
(1997)
mRNA localization in neurons: a multipurpose mechanism?
Neuron
18:9-12[Web of Science][Medline].
-
Steward O,
Schuman EM
(2001)
Protein synthesis at synaptic sites on dendrites.
Annu Rev Neurosci
24:299-325[Web of Science][Medline].
-
Steward O,
Worley PF
(2001)
A cellular mechanism for targeting newly synthesized mRNAs to synaptic sites on dendrites.
Proc Natl Acad Sci USA
98:7062-7068[Abstract/Free Full Text].
-
Sun Z-Y,
Schacher S
(1996)
Development of short-term heterosynaptic facilitation at Aplysia sensorimotor synapses is accompanied by changes in the functional expression of presynaptic serotonin receptors.
J Neurophysiol
76:2250-2261[Abstract/Free Full Text].
-
Sun Z-Y,
Wu F,
Schacher S
(2001)
Rapid bidirectional modulation of mRNA expression and export accompany long-term facilitation and depression of Aplysia synapses.
J Neurobiol
46:41-47[Web of Science][Medline].
-
Tiedge H,
Bloom FE,
Richter D
(1999)
RNA, whither goest thou.
Science
283:186-188[Free Full Text].
-
van Minnen J
(1994)
Axonal localization of neuropeptide-encoding mRNA in identified neurons of the snail Lymnaea stagnalis.
Cell Tissue Res
276:155-161[Web of Science][Medline].
-
van Minnen J,
Bergman JJ,
van Kesteren ER,
Smit AB,
Geraerts WPM,
Lukowiak K,
Hasan SU,
Syed NI
(1997)
De novo protein synthesis in isolated axons of identified neurons.
Neuroscience
80:1-7[Web of Science][Medline].
-
Winberg ML,
Mitchell KJ,
Goodman CS
(1998)
Genetic analysis of the mechanisms controlling target selection: complementary and combinatorial functions of netrins, semaphorins and IgCams.
Cell
93:581-592[Web of Science][Medline].
-
Zhang HL,
Eom T,
Oleynikov Y,
Shenoy SM,
Liebelt DA,
Dictenberg JB,
Singer RH,
Bassell GJ
(2001)
Neurotrophin-induced transport of a beta-actin mRNP complex increases beta-actin levels and stimulates growth cone motility.
Neuron
31:261-275[Web of Science][Medline].
-
Zhu H,
Wu F,
Schacher S
(1994)
Aplysia cell adhesion molecules and serotonin regulate sensory cell-motor cell interactions during early stages of synapse formation in vitro.
J Neurosci
14:6886-6900[Abstract].
-
Zhu H,
Wu F,
Schacher S
(1995)
Changes in expression and distribution of Aplysia cell adhesion molecules can influence synapse formation and elimination in vitro.
J Neurosci
15:4173-4183[Abstract].
Copyright © 2002 Society for Neuroscience 0270-6474/02/2272669-10$05.00/0
This article has been cited by other articles:

|
 |

|
 |
 
J.-Y. Hu, Y. Chen, and S. Schacher
Multifunctional Role of Protein Kinase C in Regulating the Formation and Maturation of Specific Synapses
J. Neurosci.,
October 24, 2007;
27(43):
11712 - 11724.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J.-Y. Hu, Y. Chen, and S. Schacher
Protein Kinase C Regulates Local Synthesis and Secretion of a Neuropeptide Required for Activity-Dependent Long-Term Synaptic Plasticity
J. Neurosci.,
August 15, 2007;
27(33):
8927 - 8939.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. A. Marti, X. Li, S. Jockusch, Z. Li, B. Raveendra, S. Kalachikov, J. J. Russo, I. Morozova, S. V. Puthanveettil, J. Ju, et al.
Pyrene binary probes for unambiguous detection of mRNA using time-resolved fluorescence spectroscopy
Nucleic Acids Res.,
June 12, 2006;
34(10):
3161 - 3168.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. Liu, J.-Y. Hu, F. Wu, J. H. Schwartz, and S. Schacher
Two mRNA-Binding Proteins Regulate the Distribution of Syntaxin mRNA in Aplysia Sensory Neurons.
J. Neurosci.,
May 10, 2006;
26(19):
5204 - 5214.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J.-Y. Hu, F. Wu, and S. Schacher
Two Signaling Pathways Regulate the Expression and Secretion of a Neuropeptide Required for Long-Term Facilitation in Aplysia
J. Neurosci.,
January 18, 2006;
26(3):
1026 - 1035.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J.-Y. Hu, J. Goldman, F. Wu, and S. Schacher
Target-Dependent Release of a Presynaptic Neuropeptide Regulates the Formation and Maturation of Specific Synapses in Aplysia
J. Neurosci.,
November 3, 2004;
24(44):
9933 - 9943.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. Liu, J.-Y. Hu, S. Schacher, and J. H. Schwartz
The Two Regulatory Subunits of Aplysia cAMP-Dependent Protein Kinase Mediate Distinct Functions in Producing Synaptic Plasticity
J. Neurosci.,
March 10, 2004;
24(10):
2465 - 2474.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. Bi, X. Hu, H. H. Loh, and L.-N. Wei
Mouse {kappa}-Opioid Receptor mRNA Differential Transport in Neurons
Mol. Pharmacol.,
September 1, 2003;
64(3):
594 - 599.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J.-Y. Hu, X. Meng, and S. Schacher
Redistribution of Syntaxin mRNA in Neuronal Cell Bodies Regulates Protein Expression and Transport during Synapse Formation and Long-Term Synaptic Plasticity
J. Neurosci.,
March 1, 2003;
23(5):
1804 - 1815.
[Abstract]
[Full Text]
[PDF]
|
 |
|
|