 |
Previous Article | Next Article 
The Journal of Neuroscience, May 1, 2002, 22(9):3628-3637
A Hippocampal NR2B Deficit Can Mimic Age-Related Changes in
Long-Term Potentiation and Spatial Learning in the Fischer 344 Rat
Daniel A.
Clayton1, 2,
Michael H.
Mesches2, 3, 4,
Enriquez
Alvarez1, 2,
Paula
C.
Bickford5, 6, and
Michael D.
Browning2, 3
1 Medical Scientist Training Program,
2 Neuroscience Program, and 3 Department of
Pharmacology, University of Colorado Health Sciences Center, Denver,
Colorado, 80262, 4 Veterans Affairs Medical Center, Denver,
Colorado 80220, 5 James A. Haley Veterans Affairs Medical
Center, Tampa, Florida 33612, and 6 Center for Aging and
Brain Repair, Department of Neurosurgery, University of South Florida,
Tampa, Florida 33169
 |
ABSTRACT |
Aged rats are known to have deficits in spatial learning behavior
in the Morris water maze. We have found that aged rats also have
deficits in NR2B protein expression and that the protein expression
deficit is correlated with their performance in the Morris water maze.
To test whether this NR2B deficit was sufficient to account for the
behavioral deficit, we used antisense oligonucleotides to specifically
knock down NR2B subunit expression in the hippocampus of young rats.
NR2B antisense treatment diminished NMDA receptor responses, abolished
NMDA-dependent long-term potentiation (LTP), and impaired spatial
learning. These data demonstrate the important role of NR2B in LTP and
learning and memory and suggest a role for reduced NR2B expression in
age-related cognitive decline.
Key words:
NMDA; NR2B; aging; LTP; learning; antisense
 |
INTRODUCTION |
It has been known for some time that
aged rats have deficits in spatial learning tasks (Barnes, 1979 ; Barnes
et al., 1980 ; deToledo-Morrell et al., 1988 ; Ward et al., 1999a ,b ) and
in long-term potentiation (LTP), a form of synaptic plasticity, which
displays many of the characteristics thought to be required for a
molecular mechanism of memory formation (Landfield and Lynch, 1977 ;
Landfield et al., 1978 ; deToledo-Morrell et al., 1988 ; Gallagher et
al., 1993 ; Moore et al., 1993 ; Shankar et al., 1998 ; Ward et al.,
1999a ,b ).
LTP can be segregated semantically and mechanistically into at least
two phases: the early phase of LTP (usually described <1 hr after
stimulation), which does not require protein synthesis and gene
transcription; and the late phase of LTP (usually described as >3 hr
after stimulation), which does require protein synthesis and gene
transcription. Several studies of aging and LTP have failed to
demonstrate any age-related deficits using suprathreshold stimulation
paradigms, such as high-frequency stimulation (HFS; one or more trains
of 1 sec of 100 Hz stimulation) in the early phase of LTP; however,
age-related deficits have commonly been reported in the late phase
(Moore et al., 1993 ; Lanahan et al., 1997 ; Bach et al., 1999 ; Costenla
et al., 1999 ; Eckles-Smith et al., 2000 ). Perithreshold stimulation
protocols (such as theta burst and primed burst stimulation) have
revealed age-related deficits in the induction of LTP (Moore et al.,
1993 ; Lanahan et al., 1997 ; Costenla et al., 1999 ; Eckles-Smith et al.,
2000 ). The NMDA receptor is known to be critical for most forms of LTP. Voltage-gated calcium channels, however, might also contribute to LTP,
and evidence exists to support an increasing role for voltage-gated
calcium channel use in aged animals alongside a decreasing role for
NMDA receptors (Huber et al., 1995 ; Cavus and Teyler, 1996 ; Izumi and
Zorumski, 1998 ; Shankar et al., 1998 ; Morgan and Teyler, 1999 ).
We and others have reported age-related decreases in the expression
of certain subunits of the NMDA receptor and in the function of the
NMDA receptor in the CA1 subfield of the hippocampus (Granger et al.,
1996 ; Barnes et al., 1997 ; Eckles-Smith et al., 2000 ; Kuehl-Kovarik et
al., 2000 ; Sonntag et al., 2000 ; Clayton and Browning, 2001 ).
Differential assembly of the subunits of the NMDA receptor is thought
to result in channels with different functional properties (Meguro et
al., 1992 ; Zhong et al., 1995 ; Audinat et al., 1996 ; Brimecombe et al.,
1997 ; Flint et al., 1997 ; Vallano, 1998 ; Rumbaugh and Vicini, 1999 ;
Tovar and Westbrook, 1999 ). In particular, the NR2B subunit has been
suggested to have a critical role in spatial learning and LTP, as
evidenced by NR2B knock-out and overexpressing mice (Sprengel et al.,
1998 ; Tang et al., 1999 ; Tovar et al., 2000 ).
In the present report, we examine the connection between deficits in
NMDA receptor subunit expression and deficits in LTP and spatial
learning behavior both as they occur together in aged animals and in an
experimental system in which we used antisense oligonucleotides to
specifically decrease the expression of the NR2B subunit of the NMDA receptor.
 |
MATERIALS AND METHODS |
Animals. Male Fischer 344 rats were used for all
experiments in these studies and were obtained from the colony of the
National Institute on Aging at Harlan Biosciences. An age spectrum of
animals was selected ranging from 2 to 24 months of age; ages are given in individual experiments.
Semiquantitative Western blotting. Protein concentrations
were determined for each sample using a modified BCA assay (Pierce, Rockford, IL). Duplicate samples were electrophoresed on 7.5% SDS-PAGE
gels by a standard procedure. A standard hippocampal homogenate
dilution series was also run on each gel to allow for standardized
quantitation. Gels were transferred to polyvinylidene difluoride
membranes (NEN, Boston, MA) and blocked with 5% milk. Primary
antibodies were incubated with the blot for 16 hr in 1% milk.
Secondary antibodies were incubated for 1 hr in 1% milk. The blots
were developed using Super-Signal chemiluminescent reagent (Pierce) and
analyzed using an Alpha-Imager (Alpha-Innotech). Quantitation was
performed using AlphaEase software (Alpha-Innotech) and Excel
(Microsoft, Redmond, WA). The NR1 antibody was obtained from a
commercial source (PharMingen, San Diego, CA) and has been previously
characterized. The primary antibodies from our laboratory (NR2A, NR2B,
and synapsin) have been previously characterized in terms of
specificity and suitability for quantitative Western blot analysis
(Nayak et al., 1998 ). The Glu receptor 1 (GluR1) and GluR2 antibodies
(Chemicon, Temecula, CA) have been previously characterized as well
(Zhao et al., 1998 ).
Behavioral analyses. For correlation studies, animals were
trained in a Morris water maze (1.5 m diameter, 10-cm-diameter platform
submerged 1 cm below the surface of 27°C water) for three trials per
day for 10 d. The maze was divided into four imaginary quadrants,
and the platform was placed in the middle of one quadrant for all
trials. Animals were started from one of three start points equidistant
from the platform in a pseudorandom manner. Every other day, the third
trial was a probe trial (platform retracted to the bottom of the maze
for the first 30 sec of the trial). A trial consisted of an animal
having 60 sec of free swim time in the maze, during which the amount of
time, distance, and cumulative distance from the platform were
measured. At the end of 60 sec, if the animal had not found the
platform, the animal was gently guided to the platform. Animals
remained on the platform for 30 sec between trials. Data were collected
either with Chromotrak (San Diego Instruments, San Diego, CA) or
WaterMaze (Actimetrics, Evanston, IL) data acquisition programs using a
video camera connected to a personal computer. The tracking units used
are not in SI units but instead are relative to the number of pixels in
the field of view of the camera. Under the conditions in which the systems were assembled, these tracking units are equal to 0.63 cm. All
trials were monitored to ensure proper animal identification and
tracking (all animals were confirmed to be in the water maze during the
entire period of the experiment).
For antisense behavioral analysis, animals were trained in the Morris
water maze for four trials per day for 5 d. Training was started
on the day after injection of antisense based on preliminary data that
had determined that the greatest difference in performance occurred
between days 1 and 2; this thus superimposed the time courses of the
greatest depression in NR2B expression with the greatest period of learning.
Antisense treatment. Because of the low stability of
phosphodiester-linked oligonucleotides and the high
toxicity of completely phosphorothioated oligonucleotides, these
oligonucleotides were synthesized with "end caps" in which the
terminal three nucleotides at both the 5' and 3' ends are
phosphorothioate-linked. The sequences of the antisense-NR2B and
scrambled-NR2B oligonucleotides are as follows: antisense-NR2B,
TGGGCTTCATCTTCAGCTAG; and scrambled-NR2B, GCTATGGTCTGTCAGCTTCA.
The scrambled oligonucleotide is of the same base composition as the
antisense-NR2B oligonucleotide with the sequence scrambled such that no
homology was found to known rat genes as of September 2000. Efforts
were made to avoid the inclusion of features known to cause nonspecific
effects such as C quartets and CpG motifs.
For the expression and electrophysiology experiments, animals were
anesthetized with a ketamine-xylazine mixture (100 mg/kg ketamine and
10 mg/kg xylazine) injected intramuscularly into the posterior thigh.
The level of anesthesia was checked by squeezing both the anterior and
posterior paws and by assessing the blink response to a cotton swab.
The operative site was prepared by shaving the fur around the incision
site followed by cleaning of the site with betadine and then alcohol.
Incisions through the skin and underlying fascia were made using a
number 10 scalpel blade, and the skull was exposed by blunt dissection
to reveal both the bregma and the injection site. Holes were drilled
through the skull using a burr drill at a location determined to lie
above the desired intracranial site, and care was taken not to drill through the dura. The dura was punctured using a small-gauge needle. The cannulas were inserted stereotactically. Antisense oligonucleotides for the expression and LTP studies were injected as 10 nmol in 1 µl
of PBS containing 0.2% India ink for visualization of the injection
site postmortem over the course of 1 min. India Ink staining showed
little migration from the injection tract and was visible both grossly
and under a dissection microscope. Coordinates used (relative to
bregma) were anteroposterior, 3.8 mm; mediolateral, ±2.0 mm; and
dorsoventral, along a 0.5 mm track from 2.25 to 2.75 mm from the
surface of the brain. Injection cannulas were left in place for an
additional 2 min after injection and were "capped" with a 1 µl
air bubble by injecting the air as the cannula was slowly removed.
Antisense-NR2B or scrambled-NR2B was injected into the left
hippocampus, and vehicle (PBS and 0.2% India ink) was injected into
the right hippocampus. After injection, the skull defects were sealed
with bone wax, and the skin was approximated with the use of two to
four 2-0 Vicryl sutures. Animals were allowed to recover from
anesthesia under a heating lamp before returning to their cages.
Localization of the injection tract was possible in 400 µm
hippocampal slices; four slices to either side of the injection tract
were taken (3.2 mm block of hippocampus) for expression studies. For
electrophysiology, the two slices on either side of the injection tract
were taken.
For the behavioral studies, animals were prepared for surgery as
described above. Antisense delivery for the behavioral studies was
accomplished through the use of chronically implanted bilateral cannulas implanted 1 mm above the injection site 1 week before the
delivery of antisense to minimize surgical artifacts in the subsequent
behavior. The cannulas were stereotactically situated at
anteroposterior, 3.8 mm; mediolateral, ±2.0 or ±2.5 mm; and dorsoventral, 1.0 or 1.5 mm and were sealed in place to the skull
using dental acrylic. The second set of coordinates were chosen after
the first set of animals to achieve better delivery of the antisense to
the hippocampus. Animals were randomly assigned to one of three
treatment groups, antisense-NR2B, scrambled-NR2B, or vehicle (PBS), and
the injections were delivered through an injection cannula that
protruded 1 mm from the end of the implanted cannula the day before
behavioral training began. After behavioral testing was completed, the
animals were killed, and their brains were removed. The brains were
frozen and sectioned through the coronal plane at 40 µm on a sliding
microtome. Every fourth section was stained with cresyl violet using
standard procedures. Cannula sites were verified, and animals were
excluded from the study if both cannulas were not placed within the CA1
region of the dorsal hippocampus or if evidence of an infection was
noted at any point during the necropsy by an experimentor blinded to
the treatment group of the rats.
Electrophysiology. Recording electrodes were made from
finely drawn glass capillary tubes filled with artificial CSF (in
mM: 124 sodium, 4 potassium, 1 magnesium chloride, 2.5 calcium chloride, 1 monobasic potassium phosphate, and 10 glucose) into
which a silver wire was inserted. Stimulating electrodes were bipolar 100 µm nichrome wire. All recordings were performed by stimulating the Schaeffer collateral fibers and recording in the dendritic layer
for EPSPs and in the cell body layer for population spikes.
Because AMPA receptors contribute the bulk of the current for an EPSP,
the EPSP slope and amplitude were considered the AMPA receptor response
to stimulation. Varying stimulation intensity over the range of 1-10 V
produced an AMPA input-output (I-O) curve. NMDA receptor responses
were isolated by incubating hippocampal slices in 2 µM
NBQX for 1 hr without stimulation before measurement of the NMDA
response. Stimulation intensity was varied to produce an NMDA I-O
curve similar to the AMPA I-O curve.
HFS-induced LTP was produced with four trains of 1 sec of 100 Hz
stimulation (150 µsec pulse duration) separated from each other by 30 sec. Stimulation intensity was set at the voltage that elicited 50% of
the maximal clean EPSP response. A minimum of a 30 min baseline
response was collected before induction of LTP.
Nifedipine at a concentration of 25 µM was used to
inhibit postsynaptic voltage-gated calcium channels. 7-Chloro-kyurenic acid (7-CK) was used at 6 µM to inhibit NMDA responses.
Spermine was applied at 100 µM to potentiate NMDA
responses. All drugs were applied for at least 30 min before obtaining
a baseline response.
 |
RESULTS |
We first explored the relationship between NMDA receptor
expression and spatial learning using the Morris water maze in young (6 month) and aged (16-24 month) animals. As expected, an age-related deficit was evident when young and aged animals were compared by
repeated measures ANOVA across days of the training trials (Fig.
1A) and on probe trials
(Fig. 2A,C). Aged
animals had significantly higher cumulative distance from platform
(Gallagher et al., 1993 ) scores on days 3 and 4 (Figs.
1A, 2A,C); this block of 2 d
was chosen for further study, because performance during this block showed greater variability both across age groups and within the aged
group. After training, the hippocampal protein expression levels of the
NR1, NR2A, and NR2B subunits of the NMDA receptor, the GluR1 and GluR2
subunits of the AMPA receptor, and the synaptic marker protein synapsin
were determined by Western blotting, as previously described
(Eckles-Smith et al., 2000 ; Clayton and Browning, 2001 )). We found, as
previously reported (Eckles-Smith et al., 2000 ; Magnusson, 2000 ;
Sonntag et al., 2000 ; Clayton and Browning, 2001 ), that there was an
age-related decrease in NR1 and NR2B expression with no effect on NR2A,
GluR1, GluR2, or synapsin expression (Fig.
3). Regression analysis was performed
between scores for cumulative distance from the platform on days 3 and
4 and the average distance from the platform in probe trials on day 4, the days of greatest difference in performance, and receptor subunit expression. There was a significant correlation between levels of NR2B
protein and behavioral performance across ages, suggesting that
decreased expression of NR2B contributed to the difference in behavior
between these groups (Figs. 1B,
2B). There was also a significant correlation within
the aged animals, suggesting that differences in NR2B expression
contributed to the differences in behavior among the aged rats as well
(Figs. 1C, 2C). There were also significant
correlations between NR2B expression and the distance from the platform
and latency to the platform (data not shown). There were no
correlations between expression of any of the other measured receptor
subunits and the cumulative distance from the platform, the distance to
the platform, or latency to the platform on days 3 and 4 (data not
shown). No correlations were found between NR2B expression and
performance in probe trials as measured by the number of platform
crossings; we postulate that the lack of a broad dynamic range in this
measure of probe trial performance complicates a correlational
analysis. These data suggest that reduced NR2B expression could have a
significant role in the behavioral deficits seen within the aged animal
group.

View larger version (22K):
[in this window]
[in a new window]
|
Figure 1.
Spatial learning correlates with hippocampal
expression of NR2B: training trials. A, Spatial
learning, as assessed by three trials per day for 10 d in a Morris
water maze hidden platform paradigm, reveals a significant age-related
deficit in cumulative distance from platform (number of animals: aged,
n = 8 at 16 months, 24 at 22 months, and 8 at 23 months; young, n = 14 at 6 months;
p = 0.003 by repeated measures ANOVA). Distance
units shown are in a linear, calibrated arbitrary tracking unit.
B, Regression analysis between performance in the Morris
Water maze on days 3 and 4 and expression of the NR2B subunit reveals a
significant association across animals in all age groups
(p = 0.0003;
R2 = 0.23). Distance units shown
are in a linear, calibrated arbitrary tracking unit.
C, Regression analysis between performance in the
Morris Water maze on days 3 and 4 and expression of the NR2B subunit
reveals a significant association across animals in the aged group (16, 22, and 23 months; p = 0.005;
R2 = 0.20). Distance units shown
are in a linear, calibrated arbitrary tracking unit.
|
|

View larger version (21K):
[in this window]
[in a new window]
|
Figure 2.
Spatial learning correlates with hippocampal
expression of NR2B: probe trials. A, Spatial learning,
as assessed by probe trials every other day during a 10 d, three
trial per day training paradigm in a Morris water maze with a hidden
platform, reveals a significant age-related increase in the average
distance from expected platform (number of animals: aged,
n = 8 at 16 months, 24 at 22 months, and 8 at 23 months; young, n = 14 at 6 months;
p < 0.01 by repeated measures ANOVA). Distance
units shown are in a linear, calibrated arbitrary tracking unit.
B, Regression analysis between probe performance in the
Morris Water maze on day 4 (average distance) and expression of the
NR2B subunit reveals a significant association across animals in all
age groups (p < 0.01;
R2 = 0.25). Distance units shown
are in a linear, calibrated arbitrary tracking unit. C,
Regression analysis between performance in the Morris Water maze on day
4 (average distance) and expression of the NR2B subunit reveals a
significant association across animals in the aged group (16, 22, and
23 months; p < 0.05;
R2 = 0.19). Distance units shown
are in a linear, calibrated arbitrary tracking unit.
D, Spatial learning, as assessed by probe trials
every other day during a 10 d, three trial per day training
paradigm in a Morris water maze with a hidden platform, reveals a
significant age-related deficit in the numbers of platform crossings
(number of animals: aged, n = 8 at 16 months, 24 at
22 months, and 8 at 23 months, young, n = 14 at 6 months; p < 0.01 by repeated measures ANOVA).
Distance units shown are in a linear, calibrated arbitrary tracking
unit.
|
|

View larger version (28K):
[in this window]
[in a new window]
|
Figure 3.
Age-related deficits in the expression of NMDA
receptor subunits. Relative expression of NR2B protein between young
and aged groups reveals a significant age-related decrease [37.5%
reduction aged/young; number of animals: n = 38/14;
p = 0.002, ANOVA with Fisher's protected least
significant difference (PLSD) post hoc test]. A
significant age-related decrease in NR1 levels is also found (25.2%
reduction aged/young; number of animals: n = 38/14;
p = 0.01, ANOVA with Fisher's PLSD post
hoc test) that is not found in the relative expression of NR2A,
GluR1, GluR2, or synapsin (p = 0.35;
p = 0.44; p = 0.72;
p = 0.98, respectively). Asterisks
designate significant (<0.05) p values.
|
|
We next tested whether we could ameliorate the age-related deficits in
LTP by potentiating the NMDA receptor. We found that spermine (100 µM) potentiated NMDA receptor function in slices from
aged animals such that the responses were comparable with those seen in
young animals (Fig.
4A). After such
treatment, LTP in slices from aged animals was identical to that seen
in slices from young animals (Fig. 4B). We then
tested whether we could mimic age-related deficits in LTP in young
animals by a partial blockade of the NMDA receptor. In slices from
young animals, 7-CK (6 µM) partially reduced
NMDA receptor responses (Fig. 4A) to a level
comparable with that seen in slices from aged animals. Importantly,
this treatment completely blocked NMDA-dependent LTP in young animals.
All LTP experiments on aged animals were performed in the presence of
25 µM nifedipine to block contributions from
voltage-gated calcium channels, which have been shown to make a large
contribution to the size of the EPSP in aged animals; thus, we sought
to measure the amount of LTP that was elicitable solely through the
activation of NMDA receptors (Cavus and Teyler, 1996 ; Izumi and
Zorumski, 1998 ; Shankar et al., 1998 ; Morgan and Teyler, 1999 ).

View larger version (29K):
[in this window]
[in a new window]
|
Figure 4.
Age-related NMDA receptor functional deficits.
A, Representative traces from pharmacologically isolated
NMDA EPSPs recorded from Fischer 344 rats at 4 and 24 months of age
revealing a deficit in aged responses (36.2% reduction 24/4 months;
number of animals: n = 6; p = 0.02). This decline in the NMDA EPSP can be reproduced in young animals
by treatment of the NMDA response with 6 µM 7-CK (45.3%
reduction treated/untreated; number of animals: n = 6; p = 0.005) and can be ameliorated in aged
animals by 100 µM spermine (3.2% reduction 24 month
spermine/4 months; number of animals: n = 6;
p = 0.99). Responses shown are at the same stimulus
intensity at the midrange of our standard I-O response curves.
B, HFS-induced LTP measured 30 min after induction in
the presence of 10 µM nifedipine reveals a significant
age-dependent decline 24 months (94.8% reduction 24/4 months, number
of animals: n = 6; p = 0.0008)
that is reproduced in young animals by the addition of 6 µM 7-CK (92.4% reduction treated/untreated; number of
animals: n = 6; p = 0.003) and
is ameliorated in aged animals by the addition of 100 µM
spermine (103% 24 month spermine/4 months; number of animals:
n = 6; p = 1). All statistics
performed by ANOVA with Fisher's PLSD post hoc test.
*Significance (p < 0.05) compared with 4 month group.
|
|
To directly address the effect of an NR2B deficit, we used antisense
oligonucleotides to knock down NR2B expression in young animals and to
test whether this was sufficient to impair LTP and spatial learning.
Antisense oligonucleotides were derived against the NR2B subunit and
were specifically chosen not to cross-hybridize with any other known
rat genes (including NR2A) with a mismatch of >65%. Scrambled
antisense controls (in which the same base composition is maintained
but the sequence is different) were also used to control for
nonspecific phosphorothioate antisense effects. Stereotactic delivery
of 10 nmol of antisense oligonucleotide to the hippocampus of young
rats led to a time-dependent reduction (greatest decrease observed at
3 d, ~60%) in NR2B protein (Fig. 5A). There was no change was
in expression of other NMDA receptor subunits (NR1 and NR2A), in
expression of AMPA receptor subunits (GluR1 and GluR2), or in
expression of the synaptic marker synapsin (Fig. 5A).
Injection of scrambled NR2B antisense had no effect on expression of
any of the subunits that we measured (data not shown). Antisense
treatment reduced NMDA receptor responses by ~40% (Fig.
5B) and completely blocked NMDA-dependent LTP (Fig. 5C). It has been proposed that NR2B-containing receptors
might be confined primarily to extrasynaptic sites in cortical neurons (Stocca and Vicini, 1998 ). However, our data show that the NR2B subunit
is a very important component of synaptic NMDA responses in the CA1
region of the hippocampus and that even a partial reduction in the
expression of the NR2B subunit is sufficient to completely inhibit
LTP.

View larger version (37K):
[in this window]
[in a new window]
|
Figure 5.
Effect of antisense-NR2B treatment.
A, Injection of antisense-NR2B oligonucleotides leads to
a selective hippocampal loss of NR2B protein at 3 d after
injection (63% reduction antisense/scrambled; number of animals:
n = 16/8; p = 0.002; 59%
reduction antisense/vehicle; number of animals: n = 16/16; p = 0.001). No significant changes were seen
in the expression of NR1, NR2A, GluR1, GluR2, or synapsin (all
p > 0.50, statistics by ANOVA with Fisher's PLSD
post hoc test within group, Bonferroni adjusted between
groups). *Significance to vehicle treatment; **significance to
scrambled treatment. B, NMDA receptor responses are
diminished in slices from antisense-NR2B-treated animals relative to
control (number of animals: n = 6;
p = 0.04), and this difference can be ameliorated
by treatment with 100 µM spermine (number of animals:
n = 6; p = 0.25, statistics by
repeated measures ANOVA). C, Antisense-NR2B treatment
leads to a decrease in the amount of HFS-induced LTP measured 30 min
after induction (93.2% reduction antisense/vehicle;
n = 6; p = 0.003), which can be
ameliorated by 100 µM spermine (70.8% reduction
antisense/antisense and spermine; number of animals:
n = 6; p = 0.008, statistics by
ANOVA with Fisher's PLSD post hoc test). *Significance
to antisense treatment.
|
|
To test the effect of reduced NR2B expression on behavior, antisense
oligonucleotides were delivered bilaterally via cannulas to the
hippocampi of young Fischer 344 rats. Spatial task performance was
measured in the Morris water maze with four trials per day for 4 d, starting the day after injections. This training regimen was chosen
to match the time course of the antisense-induced depression in NR2B
protein levels. Antisense injection resulted in a significant impairment in spatial learning performance (Fig.
6B). This behavioral effect was most profound on the second day of training, which corresponds to the third day after injection, when the greatest suppression of NR2B protein occurred (Fig. 6A).

View larger version (30K):
[in this window]
[in a new window]
|
Figure 6.
Time dependent antisense-NR2B effects.
A, Antisense-NR2B injection leads to a time-dependent
decrease in the amount of hippocampal NR2B protein that is most
significant on day 3 after injection (35% reduction
antisense-NR2B/vehicle; number of animals: n = 16;
p = 0.002). Scrambled-NR2B controls do not show a
significant decrease in the amount of NR2B protein on either day 3 or
day 4. B, Spatial learning performance, assessed by four
trials per day for 4 d in a Morris water maze hidden platform
task, shows a significant time-dependent difference between
antisense-NR2B-treated animals and both vehicle- and
scrambled-NR2B-treated controls (p = 0.058 by repeated measures ANOVA) that is most pronounced on day 2 of
training, which corresponds to day 3 after injection
(p = 0.02, antisense-NR2B/scrambled-NR2B;
p = 0.035, antisense-NR2B/vehicle, by ANOVA with
Fisher's PLSD post hoc test). Distance units shown are
in a linear, calibrated arbitrary tracking unit.
|
|
 |
DISCUSSION |
The data we present here indicate that the age-related deficit in
the expression of NR2B is likely to have profound consequences for
cognitive function. We show for the first time that there is a
significant correlation between NR2B expression and performance in the
Morris water maze both across ages (4-24 months) and within the aged
animal group (16-24 months; no significant differences were noted
between ages within this group). These data complement a report
demonstrating that overexpression of the NR2B subunit leads to both
enhanced LTP and enhanced performance on behavioral indices of learning
and memory (Tang et al., 1999 ).
It is important to note that the pronounced decline in cognitive
function that is associated with aging has been linked to a number of
different perturbations in cellular and molecular processes that occur
with age. Thus, growth factors, antioxidants, and numerous defects in
signal transduction have all been implicated in age-related behavioral
deficits. (Williams et al., 1993 ; Backman et al., 1996 ; Yau et al.,
1996 ; Lynch, 1998 ; Markowska et al., 1998 ; Bach et al., 1999 ; McGahon
et al., 1999 ; Eckles-Smith et al., 2000 ). What remains to be elucidated
is the sequence of molecular and cellular events that lead to these
behavioral deficits. It is also critical to distinguish age-related
alterations that, for example, play key roles in memory deficits from
deficits that may reflect normal aging processes unrelated to memory
formation. For example, we have previously shown that expression of the
NR1 subunit of the NMDA receptor (NMDAR) is reduced in aged animals and
that caloric restriction reversed this deficit in NR1 expression and
ameliorated age-related deficits in LTP. However, we have not observed
a correlation between the magnitude of this NR1 deficit and behavioral
deficits; however, another recently published study suggests a link
between NR1 levels in the CA3 region of the hippocampus and learning in
aged animals (Adams et al., 2001 ). Thus, the age-related deficit in NR1
expression we have observed may not be causally linked to age-related
deficits in behavior on the Morris water maze. Even when positive
correlations between behavior and protein expression of the type we
have observed for NR2B are found, numerous additional studies are still
required to truly establish a link between expression changes and
behavior. It is also possible that the age-related changes seen in NR2B
expression represent a common end point through which multiple
mechanisms of age-related degeneration converge.
We have used an antisense strategy to further explore the link between
NR2B expression and LTP and behavior. We reasoned that if an
age-related reduction in hippocampal NR2B expression is causally linked
to age-related deficits, then we should be able to reproduce those
deficits in young animals using antisense to acutely and selectively
reduce NR2B expression. The data we have presented here show that we
can produce a transitory and selective reduction of NR2B expression
with antisense injection into the hippocampus. These injections
significantly reduced NR2B expression and NMDAR responses. It also
completely blocked induction of NMDAR-dependent LTP. Thus the NR2B
subunit appears to play a key role in LTP in the CA1 region of young
adult Fischer 344 rats. Importantly, NR2B antisense injection produced
a significant impairment in spatial learning performance. Thus a
reduction in NR2B expression is sufficient to significantly impair
behavior on the Morris water maze.
We have also demonstrated that we can at least partially ameliorate the
age-related deficits in LTP by using spermine to potentiate the NMDAR
receptor. However, spermine affects a number of other signaling
pathways in addition to the NMDAR. Moreover, it is not practical to
explore the effects of spermine on behavior. What is clearly needed is
an intervention that can selectively enhance NR2B expression in aged
animals. The mechanism underlying the age-related reduction in NR2B
expression is unknown; however, several possible mechanisms can be
proposed. Aged animals are thought to have elevated intracellular
calcium levels attributable to alterations in calcium homeostasis and
elevated voltage-gated calcium channel activity (Campbell et al., 1996 ;
Thibault et al., 1998 ), and activity-dependent increases in calcium
lead to a selective downregulation of NR2B (Audinat et al., 1994 ;
Vallano et al., 1996 ). Thus the reduced NR2B expression in aged animals
could be a consequence of elevated voltage-gated calcium channel
activity. Defects in protein kinase A (PKA) signaling have also been
implicated in aging; activators of PKA signaling ameliorate or reverse
age-related deficits in behavior and LTP (Gould and Bickford, 1997 ;
Bach et al., 1999 ). The promoter region of the NR2B gene contains a
cAMP response element-binding protein (CREB) consensus sequence (Myers et al., 1999 ); thus, decreased activity of PKA could lead via decreased
activation of CREB to a reduction in expression of NR2B.
In summary, the data we have presented here indicate that NR2B plays an
important role in NMDA-dependent LTP in young animals. Moreover, these
data provide strong support for the hypothesis that a deficit in NR2B
expression may play a critically important role in age-related
cognitive decline.
 |
FOOTNOTES |
Received Jan. 7, 2002; revised Jan. 7, 2002; accepted Jan. 29, 2002.
Correspondence should be addressed to Michael D. Browning, 4209 East
Ninth Avenue, Box C236, Denver, CO 80262. E-mail:
Michael.Browning{at}uchsc.edu.
 |
REFERENCES |
-
Adams MM,
Smith TD,
Moga D,
Gallagher M,
Wang Y,
Wolfe BB,
Rapp PR,
Morrison JH
(2001)
Hippocampal dependent learning ability correlates with N-methyl-D-aspartate (NMDA) receptor levels in CA3 neurons of young and aged rats.
J Comp Neurol
432:230-243[ISI][Medline].
-
Audinat E,
Lambolez B,
Rossier J,
Crepel F
(1994)
Activity-dependent regulation of N-methyl-D-aspartate receptor subunit expression in rat cerebellar granule cells.
Eur J Neurosci
6:1792-1800[ISI][Medline].
-
Audinat E,
Lambolez B,
Rossier J
(1996)
Functional and molecular analysis of glutamate-gated channels by patch-clamp and RT-PCR at the single cell level.
Neurochem Int
28:119-136[ISI][Medline].
-
Bach ME,
Barad M,
Son H,
Zhuo M,
Lu YF,
Shih R,
Mansuy I,
Hawkins RD,
Kandel ER
(1999)
Age-related defects in spatial memory are correlated with defects in the late phase of hippocampal long-term potentiation in vitro and are attenuated by drugs that enhance the cAMP signaling pathway.
Proc Natl Acad Sci USA
96:5280-5285[Abstract/Free Full Text].
-
Backman C,
Rose GM,
Hoffer BJ,
Henry MA,
Bartus RT,
Friden P,
Granholm AC
(1996)
Systemic administration of a nerve growth factor conjugate reverses age-related cognitive dysfunction and prevents cholinergic neuron atrophy.
J Neurosci
16:5437-5442[Abstract/Free Full Text].
-
Barnes CA
(1979)
Memory deficits associated with senescence: a neurophysiological and behavioral study in the rat.
J Comp Physiol Psychol
93:74-104[ISI][Medline].
-
Barnes CA,
Nadel L,
Honig WK
(1980)
Spatial memory deficit in senescent rats.
Can J Psychol
34:29-39[ISI][Medline].
-
Barnes CA,
Rao G,
Shen J
(1997)
Age-related decrease in the N-methyl-D-aspartateR-mediated excitatory postsynaptic potential in hippocampal region CA1.
Neurobiol Aging
18:445-452[ISI][Medline].
-
Brimecombe JC,
Boeckman FA,
Aizenman E
(1997)
Functional consequences of NR2 subunit composition in single recombinant N-methyl-D-aspartate receptors.
Proc Natl Acad Sci USA
94:11019-11024[Abstract/Free Full Text].
-
Campbell LW,
Hao SY,
Thibault O,
Blalock EM,
Landfield PW
(1996)
Aging changes in voltage-gated calcium currents in hippocampal CA1 neurons.
J Neurosci
16:6286-6295[Abstract/Free Full Text].
-
Cavus I,
Teyler T
(1996)
Two forms of long-term potentiation in area CA1 activate different signal transduction cascades.
J Neurophysiol
76:3038-3047[Abstract/Free Full Text].
-
Clayton DA,
Browning MD
(2001)
Deficits in the expression of the NR2B subunit in the hippocampus of aged Fisher 344 rats.
Neurobiol Aging
22:165-168[ISI][Medline].
-
Costenla AR,
de Mendonca A,
Ribeiro JA
(1999)
Adenosine modulates synaptic plasticity in hippocampal slices from aged rats.
Brain Res
851:228-234[ISI][Medline].
-
deToledo-Morrell L,
Geinisman Y,
Morrell F
(1988)
Age-dependent alterations in hippocampal synaptic plasticity: relation to memory disorders.
Neurobiol Aging
9:581-590[ISI][Medline].
-
Eckles-Smith K,
Clayton D,
Bickford P,
Browning MD
(2000)
Caloric restriction prevents age-related deficits in LTP and in NMDA receptor expression.
Brain Res Mol Brain Res
78:154-162[Medline].
-
Flint AC,
Maisch US,
Weishaupt JH,
Kriegstein AR,
Monyer H
(1997)
NR2A subunit expression shortens NMDA receptor synaptic currents in developing neocortex.
J Neurosci
17:2469-2476[Abstract/Free Full Text].
-
Gallagher M,
Burwell R,
Burchinal M
(1993)
Severity of spatial learning impairment in aging: development of a learning index for performance in the Morris water maze.
Behav Neurosci
107:618-626[ISI][Medline].
-
Gould TJ,
Bickford PC
(1997)
Age-related deficits in the cerebellar beta adrenergic signal transduction cascade in Fischer 344 rats.
J Pharmacol Exp Ther
281:965-971[Abstract/Free Full Text].
-
Granger R,
Deadwyler S,
Davis M,
Moskovitz B,
Kessler M,
Rogers G,
Lynch G
(1996)
Facilitation of glutamate receptors reverses an age-associated memory impairment in rats.
Synapse
22:332-337[ISI][Medline].
-
Huber KM,
Mauk MD,
Kelly PT
(1995)
Distinct LTP induction mechanisms: contribution of NMDA receptors and voltage-dependent calcium channels.
J Neurophysiol
73:270-279[Abstract/Free Full Text].
-
Izumi Y,
Zorumski CF
(1998)
LTP in CA1 of the adult rat hippocampus and voltage-activated calcium channels.
NeuroReport
9:3689-3691[ISI][Medline].
-
Kuehl-Kovarik MC,
Magnusson KR,
Premkumar LS,
Partin KM
(2000)
Electrophysiological analysis of NMDA receptor subunit changes in the aging mouse cortex.
Mech Aging Dev
115:39-59.
-
Lanahan A,
Lyford G,
Stevenson GS,
Worley PF,
Barnes CA
(1997)
Selective alteration of long-term potentiation-induced transcriptional response in hippocampus of aged, memory-impaired rats.
J Neurosci
17:2876-2885[Abstract/Free Full Text].
-
Landfield PW,
Lynch G
(1977)
Impaired monosynaptic potentiation in in vitro hippocampal slices from aged, memory-deficient rats.
J Gerontol
32:523-533[ISI][Medline].
-
Landfield PW,
McGaugh JL,
Lynch G
(1978)
Impaired synaptic potentiation processes in the hippocampus of aged, memory-deficient rats.
Brain Res
150:85-101[ISI][Medline].
-
Lynch MA
(1998)
Age-related impairment in long-term potentiation in hippocampus: a role for the cytokine, interleukin-1 beta?
Prog Neurobiol
56:571-589[ISI][Medline].
-
Magnusson KR
(2000)
Declines in mRNA expression of different subunits may account for differential effects of aging on agonist and antagonist binding to the NMDA receptor.
J Neurosci
20:1666-1674[Abstract/Free Full Text].
-
Markowska AL,
Mooney M,
Sonntag WE
(1998)
Insulin-like growth factor-1 ameliorates age-related behavioral deficits.
Neuroscience
87:559-569[ISI][Medline].
-
McGahon BM,
Murray CA,
Horrobin DF,
Lynch MA
(1999)
Age-related changes in oxidative mechanisms and LTP are reversed by dietary manipulation.
Neurobiol Aging
20:643-653[Medline].
-
Meguro H,
Mori H,
Araki K,
Kushiya E,
Kutsuwada T,
Yamazaki M,
Kumanishi T,
Arakawa M,
Sakimura K,
Mishina M
(1992)
Functional characterization of a heteromeric NMDA receptor channel expressed from cloned cDNAs.
Nature
357:70-74[Medline].
-
Moore CI,
Browning MD,
Rose GM
(1993)
Hippocampal plasticity induced by primed burst, but not long-term potentiation, stimulation is impaired in area CA1 of aged Fischer 344 rats.
Hippocampus
3:57-66[ISI][Medline].
-
Morgan SL,
Teyler TJ
(1999)
VDCCs and NMDARs underlie two forms of LTP in CA1 hippocampus in vivo.
J Neurophysiol
82:736-740[Abstract/Free Full Text].
-
Myers SJ,
Dingledine R,
Borges K
(1999)
Genetic regulation of glutamate receptor ion channels.
Annu Rev Pharmacol Toxicol
39:221-241[ISI][Medline].
-
Nayak A,
Zastrow DJ,
Lickteig R,
Zahniser NR,
Browning MD
(1998)
Maintenance of late-phase LTP is accompanied by PKA-dependent increase in AMPA receptor synthesis.
Nature
394:680-683[Medline].
-
Rumbaugh G,
Vicini S
(1999)
Distinct synaptic and extrasynaptic NMDA receptors in developing cerebellar granule neurons.
J Neurosci
19:10603-10610[Abstract/Free Full Text].
-
Shankar S,
Teyler TJ,
Robbins N
(1998)
Aging differentially alters forms of long-term potentiation in rat hippocampal area CA1.
J Neurophysiol
79:334-341[Abstract/Free Full Text].
-
Sonntag WE,
Bennett SA,
Khan AS,
Thornton PL,
Xu X,
Ingram RL,
Brunso-Bechtold JK
(2000)
Age and insulin-like growth factor-1 modulate N-methyl-D-aspartate receptor subtype expression in rats.
Brain Res Bull
51:331-338[ISI][Medline].
-
Sprengel R,
Suchanek B,
Amico C,
Brusa R,
Burnashev N,
Rozov A,
Hvalby O,
Jensen V,
Paulsen O,
Andersen P,
Kim JJ,
Thompson RF,
Sun W,
Webster LC,
Grant SG,
Eilers J,
Konnerth A,
Li J,
McNamara JO,
Seeburg PH
(1998)
Importance of the intracellular domain of NR2 subunits for NMDA receptor function in vivo.
Cell
92:279-289[ISI][Medline].
-
Stocca G,
Vicini S
(1998)
Increased contribution of NR2A subunit to synaptic NMDA receptors in developing rat cortical neurons.
J Physiol (Lond)
507:13-24[Abstract/Free Full Text].
-
Tang YP,
Shimizu E,
Dube GR,
Rampon C,
Kerchner GA,
Zhuo M,
Liu G,
Tsien JZ
(1999)
Genetic enhancement of learning and memory in mice.
Nature
401:63-69[Medline].
-
Thibault O,
Porter NM,
Chen KC,
Blalock EM,
Kaminker PG,
Clodfelter GV,
Brewer LD,
Landfield PW
(1998)
Calcium dysregulation in neuronal aging and Alzheimer's disease: history and new directions.
Cell Calcium
24:417-433[ISI][Medline].
-
Tovar KR,
Westbrook GL
(1999)
The incorporation of NMDA receptors with a distinct subunit composition at nascent hippocampal synapses in vitro.
J Neurosci
19:4180-4188[Abstract/Free Full Text].
-
Tovar KR,
Sprouffske K,
Westbrook GL
(2000)
Fast NMDA receptor-mediated synaptic currents in neurons from mice lacking the epsilon2 (NR2B) subunit.
J Neurophysiol
83:616-620[Abstract/Free Full Text].
-
Vallano ML
(1998)
Developmental aspects of NMDA receptor function.
Crit Rev Neurobiol
12:177-204[ISI][Medline].
-
Vallano ML,
Lambolez B,
Audinat E,
Rossier J
(1996)
Neuronal activity differentially regulates NMDA receptor subunit expression in cerebellar granule cells.
J Neurosci
16:631-639[Abstract/Free Full Text].
-
Ward MT,
Oler JA,
Markus EJ
(1999a)
Hippocampal dysfunction during aging I: deficits in memory consolidation.
Neurobiol Aging
20:363-372[Medline].
-
Ward MT,
Stoelzel CR,
Markus EJ
(1999b)
Hippocampal dysfunction during aging II: deficits on the radial-arm maze.
Neurobiol Aging
20:373-380[ISI][Medline].
-
Williams JH,
Li YG,
Nayak A,
Errington ML,
Murphy KP,
Bliss TV
(1993)
The suppression of long-term potentiation in rat hippocampus by inhibitors of nitric oxide synthase is temperature and age dependent.
Neuron
11:877-884[ISI][Medline].
-
Yau JL,
Olsson T,
Morris RG,
Noble J,
Seckl JR
(1996)
Decreased NGFI-A gene expression in the hippocampus of cognitively impaired aged rats.
Brain Res Mol Brain Res
42:354-357[Medline].
-
Zhao HM,
Wenthold RJ,
Petralia RS
(1998)
Glutamate receptor targeting to synaptic populations on Purkinje cells is developmentally regulated.
J Neurosci
18:5517-5528[Abstract/Free Full Text].
-
Zhong J,
Carrozza DP,
Williams K,
Pritchett DB,
Molinoff PB
(1995)
Expression of mRNAs encoding subunits of the NMDA receptor in developing rat brain.
J Neurochem
64:531-539[ISI][Medline].
Copyright © 2002 Society for Neuroscience 0270-6474/02/2293628-10$05.00/0
This article has been cited by other articles:

|
 |

|
 |
 
J. C. Gant, M. M. Sama, P. W. Landfield, and O. Thibault
Early and simultaneous emergence of multiple hippocampal biomarkers of aging is mediated by Ca2+-induced Ca2+ release.
J. Neurosci.,
March 29, 2006;
26(13):
3482 - 3490.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
G. H. Son, D. Geum, S. Chung, E. J. Kim, J.-H. Jo, C.-M. Kim, K. H. Lee, H. Kim, S. Choi, H. T. Kim, et al.
Maternal stress produces learning deficits associated with impairment of NMDA receptor-mediated synaptic plasticity.
J. Neurosci.,
March 22, 2006;
26(12):
3309 - 3318.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
Y. Wu, R. Kawakami, Y. Shinohara, M. Fukaya, K. Sakimura, M. Mishina, M. Watanabe, I. Ito, and R. Shigemoto
Target-Cell-Specific Left-Right Asymmetry of NMDA Receptor Content in Schaffer Collateral Synapses in {epsilon}1/NR2A Knock-Out Mice
J. Neurosci.,
October 5, 2005;
25(40):
9213 - 9226.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. M. Ramsey, M. M. Adams, O. J. Ariwodola, W. E. Sonntag, and J. L. Weiner
Functional Characterization of Des-IGF-1 Action at Excitatory Synapses in the CA1 Region of Rat Hippocampus
J Neurophysiol,
July 1, 2005;
94(1):
247 - 254.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. S. Kumar and J. R. Huguenard
Pathway-Specific Differences in Subunit Composition of Synaptic NMDA Receptors on Pyramidal Neurons in Neocortex
J. Neurosci.,
November 5, 2003;
23(31):
10074 - 10083.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
D. J. Froc, B. Eadie, A. M. Li, K. Wodtke, M. Tse, and B. R. Christie
Reduced Synaptic Plasticity in the Lateral Perforant Path Input to the Dentate Gyrus of Aged C57BL/6 Mice
J Neurophysiol,
July 1, 2003;
90(1):
32 - 38.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C. A. Dickey, J. F. Loring, J. Montgomery, M. N. Gordon, P. S. Eastman, and D. Morgan
Selectively Reduced Expression of Synaptic Plasticity-Related Genes in Amyloid Precursor Protein + Presenilin-1 Transgenic Mice
J. Neurosci.,
June 15, 2003;
23(12):
5219 - 5226.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. M. Thakkar, S. Winston, and R. W. McCarley
A1 Receptor and Adenosinergic Homeostatic Regulation of Sleep-Wakefulness: Effects of Antisense to the A1 Receptor in the Cholinergic Basal Forebrain
J. Neurosci.,
May 15, 2003;
23(10):
4278 - 4287.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
G. S. Mitchell and S. M. Johnson
Plasticity in Respiratory Motor Control: Invited Review: Neuroplasticity in respiratory motor control
J Appl Physiol,
January 1, 2003;
94(1):
358 - 374.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
G. C. Tombaugh, W. B. Rowe, A. R. Chow, T. H. Michael, and G. M. Rose
Theta-Frequency Synaptic Potentiation in CA1 In Vitro Distinguishes Cognitively Impaired from Unimpaired Aged Fischer 344 Rats
J. Neurosci.,
November 15, 2002;
22(22):
9932 - 9940.
[Abstract]
[Full Text]
[PDF]
|
 |
|
|