 |
Previous Article | Next Article 
The Journal of Neuroscience, January 1, 2003, 23(1):349-357
Activation of the TrkB Neurotrophin Receptor Is Induced by
Antidepressant Drugs and Is Required for Antidepressant-Induced
Behavioral Effects
Tommi
Saarelainen1, *,
Panu
Hendolin1, *,
Guilherme
Lucas4,
Eija
Koponen1,
Mikko
Sairanen1,
Ewen
MacDonald2,
Karin
Agerman4,
Annakaisa
Haapasalo1,
Hiroyuki
Nawa5,
Raquel
Aloyz6,
Patrik
Ernfors4, and
Eero
Castrén1, 3
1 Department of Neurobiology, A. I. Virtanen
Institute, Departments of 2 Pharmacology and Toxicology
and 3 Psychiatry, University of Kuopio, 70211 Kuopio,
Finland, 4 Department of Medical Biochemistry and
Biophysics, Karolinska Institute, 17177 Stockholm, Sweden,
5 Department of Molecular Biology, Neurobiology, Brain
Research Institute, Niigata University, Niigata 951-8585, Japan, and
6 Center for Neuronal Survival, Montreal Neurological
Institute, McGill University, Montreal, Quebec, Canada H3A 2B4
 |
ABSTRACT |
Recent studies have indicated that exogenously administered
neurotrophins produce antidepressant-like behavioral effects. We have
here investigated the role of endogenous brain-derived neurotrophic
factor (BDNF) and its receptor trkB in the mechanism of action
of antidepressant drugs. We found that trkB.T1-overexpressing transgenic mice, which show reduced trkB activation in brain, as well
as heterozygous BDNF null
(BDNF+/ ) mice, were resistant
to the effects of antidepressants in the forced swim test, indicating
that normal trkB signaling is required for the behavioral effects
typically produced by antidepressants. In contrast,
neurotrophin-3+/ mice showed a
normal behavioral response to antidepressants. Furthermore, acute as
well as chronic antidepressant treatment induced autophosphorylation
and activation of trkB in cerebral cortex, particularly in the
prefrontal and anterior cingulate cortex and hippocampus. Tyrosines in
the trkB autophosphorylation site were phosphorylated in response to
antidepressants, but phosphorylation of the shc binding site was
not observed. Nevertheless, phosphorylation of cAMP response
element-binding protein was increased by antidepressants in the
prefrontal cortex concomitantly with trkB phosphorylation and this
response was reduced in trkB.T1-overexpressing mice. Our
data suggest that antidepressants acutely increase trkB signaling in a
BDNF-dependent manner in cerebral cortex and that this signaling is
required for the behavioral effects typical of antidepressant drugs.
Neurotrophin signaling increased by antidepressants may induce
formation and stabilization of synaptic connectivity, which gradually
leads to the clinical antidepressive effects and mood recovery.
Key words:
TrkB; neurotrophin receptor; antidepressant; BDNF; CREB; cerebral cortex
 |
Introduction |
Antidepressant drugs facilitate
signaling of serotonin or norepinephrine either by inhibiting their
reuptake to presynaptic terminals or by inhibiting their catabolism or
binding to serotonin autoreceptors (for review, see Duman et
al., 1997 ; Skolnick, 1999 ; Manji et al., 2001 ; Nestler et al., 2002 ).
However, alterations in monoamine metabolism take place soon after drug
administration, but the clinical antidepressant effect develops slowly
during several weeks of continuous treatment (Nestler et al., 2002 ). Electroconvulsive shock therapy, the most effective antidepressant therapy known, also requires repeated administration before the patient
recovers (Duman and Vaidya, 1998 ). These observations suggest that
alterations in monoamine metabolism alone cannot explain the entire
antidepressant effect (Nestler et al., 2002 ) and indicate that
antidepressants may act by evoking adaptive changes in intracellular
signal transduction and synaptic connectivity (Duman et al., 1997 ;
Altar, 1999 ; Skolnick, 1999 ; Manji et al., 2001 ; Reid and Stewart,
2001 ; Nestler et al., 2002 ).
Neurotrophins, and particularly brain-derived neurotrophic factor
(BDNF), have been shown to function as a key regulator of neurite
outgrowth, synaptic plasticity, and the selection of functional neuronal connections in the CNS (Katz and Shatz, 1996 ; McAllister et
al., 1999 ; Mamounas et al., 2000 ; Huang and Reichardt, 2001 ; Poo,
2001 ), which makes neurotrophins potential mediators of the plastic
changes induced by antidepressants (Duman et al., 1997 ; Altar, 1999 ;
Manji et al., 2001 ; Nestler et al., 2002 ). Indeed, electroconvulsive
shock treatment rapidly and robustly increases mRNA levels of BDNF and
its receptor trkB in hippocampus and cortex, and chronic (but not
acute) treatment with antidepressants increases BDNF mRNA in the
hippocampus (Nibuya et al., 1995 ; Russo-Neustadt et al., 2000 ).
Furthermore, infusion of exogenous BDNF into hippocampus or brain stem
has antidepressant-like behavioral effects (Siuciak et al., 1997 ;
Shirayama et al., 2002 ), and BDNF administration increases serotonergic
innervation (Mamounas et al., 2000 ) as well as the levels of serotonin
and its metabolites in forebrain (Siuciak et al., 1994 , 1996 ).
Moreover, the reduction in BDNF expression induced by stress (Smith et
al., 1995 ) and behavioral abnormalities found in heterozygous BDNF
knock-out
(BDNF+/ )
mice have been reported to be counteracted by antidepressants (Smith et
al., 1995 ; Lyons et al., 1999 ). These data lead to the suggestion that
depression may actually represent an impairment of neuronal plasticity,
which could be reversed by increasing the levels of neurotrophic
factors, such as BDNF (Duman et al., 1997 ; Altar, 1999 ; Skolnick, 1999 ;
Manji et al., 2001 ; Nestler et al., 2002 ). However, direct evidence for
the role of endogenous BDNF in the mechanism of antidepressant drug
action is lacking.
We have here addressed the question of the role of endogenous BDNF
signaling in antidepressant action. By investigating transgenic mice
with reduced BDNF levels or reduced trkB signaling in brain, we provide
evidence that trkB activation is required for a behavioral response
typically induced by antidepressants. Furthermore, acute as well as
chronic antidepressant treatment induces phosphorylation and activation
of trkB in cortex in a BDNF-dependent manner.
 |
Materials and Methods |
Male mice of between 3 and 6 months of age were used in all
experiments, except in the forced swim test for
BDNF+/
mice, in which all of the transgenic and corresponding wild-type mice
were females. TrkB.T1 cDNA was tagged N-terminally with an eight amino
acid FLAG epitope and inserted into a murine Thy 1.2 expression cassette, which directs transgene expression to
postnatal neurons, as described previously (Saarelainen et al., 2000b ). Transgenic mice were generated by pronucleus injection of this construct into embryos from CD2F1 (BALB/c x DBA/2) females mated with
CD2F1 males. Transgenic founder mice were identified using Southern
blot analysis and PCR. Heterozygous mice and their wild-type littermates were used in all of these experiments. In situ
hybridization was performed according to Wisden and Morris (1994) , with
an oligonucleotide probe (GGCACTTGTCATCGTCGTCTTTGTAGTCGGCA) that
specifically recognizes the FLAG-epitope sequence.
Production of
BDNF+/ and
neurotrophin-3
(NT-3)+/
mice has been described previously (Ernfors et al., 1994a ,b ); the
genetic background of both strains and their wild-type littermates was
129Sv x BALB/c. Litters of mice were selected at the animal house such
that they contained approximately the same number of transgenic and
wild-type mice. Litters were then randomly assigned to various
treatment groups, and the person performing the tests was always blind
to the genotype. The production of transgenic mice and all of the
animal experiments were done in accordance to the guidelines of The
Society for Neuroscience and were accepted by the experimental animal
ethics committee of the University of Kuopio.
For the analysis of behavioral effects of antidepressant drugs, we used
the forced swim test, which has a high predictive value for
antidepressant activity that is applicable to mice (Porsolt et al.,
1977 ; Cryan et al., 2002 ). Adult male transgenic mice and wild-type
littermates were allowed to adapt to the test room for several days and
then randomly submitted to a forced swim test without a pre-swim.
Saline, imipramine (30 mg/kg; Sigma, St. Louis, MO), or fluoxetine (20 mg/kg; Orion Pharma, Turku, Finland) was injected intraperitoneally,
and after 30 min the mice were placed in a clear glass cylinder with a
diameter of 16 cm, half-filled with clear water at 24°C (water depth
of 14 cm did not allow the mice to reach the bottom of the cylinder; water was changed after each mouse) for a total of 6 min, and immobility was recorded live during the last 4 min by an investigator blind to the genotype and treatment.
Tyrosine phosphorylation was assayed in cortical samples of male mice
that were rapidly dissected at indicated times after saline or
antidepressant injection. Tissue lysis, protein precipitation with
wheat germ agglutinin (WGA) or pan-trk antibody, and the following
Western blot analysis from these samples were performed according to
previously described methods (Aloyz et al., 1999 ) with slight
modifications. Briefly, tissue samples were lysed in buffer containing
137 mM NaCl, 20 mM Tris, pH 8.0, 1% NP-40, 10% glycerol, 50 mM sodium fluoride, 2× Complete Mini
(Roche Diagnostics, Hertforshire, UK), and 2 mM
sodium vanadate. After homogenization, tissues were incubated at +4°C
for 20 min and centrifuged at 13,000 rpm for 15 min. TrkB was
precipitated using either 50 µl of WGA (Amersham Biosciences,
Arlington Heights, IL) or 10 µl of anti-trk antibody (sc-11; Santa
Cruz Biotechnology, Santa Cruz, CA) and collected with protein-A
Sepharose (Amersham Biosciences). Electrophoresis was performed with
7.5% SDS-polyacrylamide gels. Anti-phosphotyrosine (4G10; Upstate
Biochemicals, Waltham, MA; dilution 1:10,000), anti-phospho-trk
pY490 (New England Biolabs, Beverly, MA), pY674/675 (New England
Biolabs), and anti-trkBout (generously provided
by Dr. David Kaplan, McGill University, Montreal, Canada;
dilution 1:5000) antibodies were used to detect phosphorylated and
total trkB, respectively. Western blots were scanned and quantitated with image analysis. Data are presented as mean percentages of the
ratio of phosphorylated trk (4G10, pY674/675, pY490) to full-length trkB (anti-trkBout) signal intensity levels found
in saline-treated animals.
For phospho-cAMP response element-binding protein (CREB)
immunostaining, mice were injected intraperitoneally with saline, fluoxetine (20 mg/kg), or imipramine (30 mg/kg), deeply anesthetized by
pentobarbital 30 min after the injection, and perfused with 4%
paraformaldehyde. Floating sections were stained with
anti-phospho-CREB-specific antibody (New England Biolabs) and developed
with diaminobenzidine. Phospho-Ser131-antibody recognizes not only CREB
but also phosphorylated forms of other CREB family members;
therefore, the increased staining observed after antidepressant
treatments may also indicate changes in the phosphorylation status of
other family members as well. Stained cells in the anterior
cingulate-prefrontal cortex were counted using an unbiased
stereological method (StereoInvestigator, MicroBrightField Inc.,
Colchester, VA).
All of the data are presented as means ± SEM. Student's
t test and one-way ANOVA together with Bonferroni as a
post hoc test were used for statistical analysis.
 |
Results |
Behavioral response to antidepressants requires normal
trkB signaling
Although there is evidence that chronic antidepressant treatment
increases BDNF mRNA in hippocampus (Nibuya et al., 1995 ; Russo-Neustadt
et al., 2000 ) and infusion of BDNF into hippocampus or midbrain area
produces behavioral effects that resemble those produced by
antidepressant drugs (Siuciak et al., 1997 ; Shirayama et al., 2002 ),
the role of endogenous BDNF and trkB activation in the behavioral
responses to antidepressant drugs remains unclear. We have investigated
this question by submitting trkB.T1 transgenic mice to a forced swim
test, which is widely used for screening of potential antidepressant
drugs and has a high predictive value for antidepressant activity
(Porsolt et al., 1977 ; Cryan et al., 2002 ). These mice overexpress the
dominant-negative trkB.T1 isoform in neurons in hippocampus and cortex,
including anterior cingulate and prefrontal cortices, and show reduced
trkB signaling in brain (Saarelainen et al., 2000b ) (Fig.
1). When we previously tested these mice
in the Morris water maze, there were no differences in the swimming
speed between wild-type and transgenic littermates, although the
long-term memory of transgenic mice was impaired (Saarelainen et al.,
2000a ). These data suggest that any differences in the behavior of
these mice in the forced swim test are not simply a reflection of
altered swimming performance. Consistent with this, no differences were
observed in the immobility time between transgenic and wild-type
littermates injected with saline 30 min before the 6 min forced swim
test (Fig. 2) (p = 0.28; Mann-Whitney test). In the forced swim assay, mice respond to
antidepressants by reducing their immobility time (Porsolt et al.,
1977 ). Indeed, both imipramine and fluoxetine, two widely used
antidepressants, significantly reduced immobility in wild-type mice
(Fig. 2) (ANOVA: F = 8.52; p = 0.002).
In contrast, neither imipramine nor fluoxetine had any significant
effect on the immobility time of the trkB.T1 transgenic mice (Fig. 2)
(ANOVA: F = 0.098; p = 0.91),
indicating that inhibition of trkB signaling rendered transgenic mice
insensitive to the behavioral effects of antidepressant drugs. The
response to both antidepressants was significantly reduced in
transgenic mice when compared with wild-type littermates (imipramine,
p = 0.012; fluoxetine, p = 0.004;
Bonferroni's test)

View larger version (62K):
[in this window]
[in a new window]
|
Figure 1.
Transgenic mice overexpressing the truncated
trkB.T1 isoform in neurons. a, Schematic representation
of trkB activation by BDNF and of the dominant-negative role of the
truncated trkB.T1 isoform. b, TrkB.T1 transgene
expression in adult transgenic mouse brain. In situ
hybridization of a wild-type (WT) and transgenic
(TG) mouse at two different rostrocaudal levels with an
oligonucleotide probe that specifically recognizes the
FLAG-epitope sequence inserted into the transgene.
AC, Anterior cingulate cortex; HC,
hippocampus; PC, posterior cingulate cortex;
PFC, prefrontal cortex; S, striatum;
T, thalamus.
|
|

View larger version (18K):
[in this window]
[in a new window]
|
Figure 2.
TrkB.T1 transgenic mice are resistant to
antidepressants in forced swim test. Immobility time in a forced swim
test in trkB.T1 transgenic (filled bars) and wild-type
mice (open bars) after injection with saline, imipramine
(30 mg/kg), or fluoxetine (20 mg/kg; n = 8-12 for
each differently treated genotype). *p < 0.05, **p < 0.01, compared with saline-treated wild-type
animals. #p < 0.05 and
##p < 0.01 show the difference between
transgenic and wild-type animals with the same treatment (one-way
ANOVA, post hoc analysis; Bonferroni's test). Data are
presented as means ± SEM.
|
|
Because BDNF signaling influences serotonergic innervation to cortex
(Mamounas et al., 2000 ; Poo, 2001 ), we examined the tissue contents of
5-HT and 5-hydroxyindoleacetic acid (5-HIAA) from two cortical areas
from transgenic and wild-type mice by using HPLC to investigate
whether the characteristic neurochemical changes in monoamine
metabolism after antidepressant drug administration (Fuller and Wong,
1977 ) also occur in the brains of transgenic mice (Table
1). Basal concentrations of 5-HT were
similar in transgenic and wild-type mice in both anterior cingulate and
prefrontal cortex. Basal levels of 5-HIAA were similar in anterior
cingulate cortex between the different genotypes, but 5-HIAA was
reduced in the prefrontal cortex in trkB.T1 transgenic mice, which is consistent with the observation that BDNF increases brain 5-HIAA levels
(Siuciak et al., 1994 , 1996 ). Most importantly, treatment with a
selective serotonin reuptake inhibitor, fluoxetine, caused a
significant increase in serotonin concentrations in the
prefrontal and cingulate cortices in both genotypes,
demonstrating that the serotonin uptake system was functional and
similarly affected by acute administration of fluoxetine in the brains
of both wild-type and transgenic mice. The integrity of serotonergic
innervation to cortex was further investigated by immunostaining with
antibodies against serotonin or serotonin transporter. These stainings
revealed no obvious gross differences in cortical serotonin innervation between the trkB.T1 transgenic and wild-type mice (Dr. Laura
Mamounas, National Institute of Neurological Disorders and Stroke,
Bethesda, MD, personal communication).
TrkB can be activated by both BDNF and NT-3 (Soppet et al., 1991 ;
Squinto et al., 1991 ). To investigate which of the trkB ligands is
involved in the antidepressant-induced behavioral effects, we submitted
mice deficient of BDNF or NT-3 to a forced swim test. Because
BDNF /
and
NT-3 /
mice die early during postnatal development (Ernfors et al., 1994a ,b ),
we used heterozygous mice, which produce approximately half of the
corresponding neurotrophin in their brain. The swimming behavior of
saline-injected
BDNF+/ and
NT-3+/ mice
was indistinguishable from the corresponding saline-treated wild-type
mice (Fig. 3). When the mice were treated
with imipramine (30 mg/kg; 30 min before the test), the swimming
immobility of wild-type as well as
NT-3+/ mice
was significantly reduced when compared with the corresponding saline-treated mice of the same strain (Fig. 3)
(p < 0.01; one-way ANOVA and Bonferroni's
post hoc test). In contrast, the swimming immobility of
imipramine-treated
BDNF+/ mice
was not significantly different from the saline-treated (wild-type or
BDNF+/ )
mice (Fig. 3). Indeed, the swimming behavior of
BDNF+/ mice
was similar to that of trkB.T1-overexpressing mice, which suggests that
BDNF-mediated trkB activation is required for normal behavioral
response to antidepressants in the forced swim test.

View larger version (14K):
[in this window]
[in a new window]
|
Figure 3.
Forced swim test behavior of
BDNF+/ (top
panel) and
NT-3+/ mice (bottom
panel). Female
BDNF+/ mice and wild-type
littermates were injected with saline or imipramine (30 mg/kg;
n = 8 and 9 for saline and imipramine,
respectively, for both genotypes) and subjected to a forced swim test
(6 min, immobility recorded during the last 4 min) 30 min after the
injection. Male NT-3+/ mice and
wild-type littermates were treated identically (n = 9 and 10 for saline and imipramine, respectively, for both genotypes).
Means ± SEM; *p < 0.01; one-way ANOVA and
Bonferroni's post hoc test.
|
|
Antidepressant treatment induces trkB autophosphorylation
If the behavioral response to antidepressants in the forced swim
test requires intact trkB signaling in brain, as our results suggest,
then activation of endogenous trkB signaling would be expected to take
place within 30 min after antidepressant administration. Previous
studies have shown that chronic, but not acute, antidepressant administration increases BDNF mRNA levels in hippocampus and cortex (Nibuya et al., 1995 ; Russo-Neustadt et al., 2000 ), but
electroconvulsive shock therapy, the most effective antidepressant
treatment, increases BDNF mRNA also acutely (Nibuya et al., 1995 ). We
have used phosphorylation of trkB as an assay to investigate activation
of neurotrophin signaling in brain. Autophosphorylation of trk
receptors is the initial step in the intracellular signal transduction
activated by neurotrophins (Kaplan and Miller, 2000 ), and it has been
previously validated as an assay for local neurotrophin release (Aloyz
et al., 1999 ).
Western blots of WGA-precipitated cortical extracts probed with
phosphotyrosine (pTyr)-specific 4G10 antibody revealed that imipramine
and fluoxetine significantly increased phosphorylation of a protein
that migrated at 145 kDa, exactly at the same level as trk receptors
(as assayed using trkB-specific antibody) at 30 min after the injection
(1.8- and 1.4-fold for imipramine and fluoxetine, respectively),
compared with saline-treated animals (Fig.
4a); however, total trkB
protein levels were not influenced by antidepressants (Fig.
4a), suggesting the possibility that these drugs increase
trkB phosphorylation but not trkB protein synthesis.

View larger version (46K):
[in this window]
[in a new window]
|
Figure 4.
Antidepressants induce trkB autophosphorylation in
mouse brain. a, Mice were injected intraperitoneally
with imipramine (IMI) (30 mg/kg;
n = 15) or saline (Sal)
(n = 15), or with fluoxetine
(FLX) (20 mg/kg, n = 11) or
saline (Sal) (n = 11).
Top panel, Representative Western blots of
WGA-precipitated samples sequentially probed with anti-phosphotyrosine
antibody (4G10) and anti-trkBout antibody.
TrkB indicates the location of 145 kDa band.
Bottom panel, Quantitated levels of the trkB from
different treatments. Data are presented as mean ± SEM
percentages of the ratio of phosphorylated trk (4G10) to
full-length trkB (anti-trkBout) signal intensity
levels found in saline-treated animals. **p < 0.01 against saline control; Student's t test.
b, Trk immunoprecipitation. Mice received saline
(Sal) or imipramine (IMI)
(30 mg/kg, i.p.) 30 min before protein extraction. Representative
Western blots precipitated with trk antibody and sequentially probed
with anti-phosphotyrosine antibody 4G10 and anti-trkBout
antibody are shown. TrkB indicates the location of trkB.
IP, Immunoprecipitation; WB, Western
blot.
|
|
To verify that the phosphorylated 145 kDa protein represents trk
receptors, we immunoprecipitated cortical lysates from
imipramine-treated mice with a trk receptor-specific antibody. Probing
the blot with pTyr antibody revealed that imipramine indeed had induced
tyrosine phosphorylation of the trk receptor (Fig. 4b) but
had no effect on total trkB protein levels. Because trkB is the
predominant trk species in cortex (Aloyz et al., 1999 ) and the
antidepressant-induced trk activation was inhibited by a
dominant-negative trkB isoform (see Fig. 9), which inhibits the
activation of trkB but not trkA and trkC (Haapasalo et al., 2001 ), the
phosphorylated trk species is most probably trkB. Furthermore, the
abnormal forced swim response in
BDNF+/ but
not in
NT-3+/ mice
also suggests that trkB is the predominant trk species in response to
antidepressants. However, because BDNF also binds to trkC receptors,
albeit at a lower affinity than to trkB, these data do not rule out the
possibility that trkC is also phosphorylated in response to
antidepressants. Blots immunoprecipitated with trk antibody and probed
with pTyr antibody revealed two additional bands that were
coimmunoprecipitated with trkB and phosphorylated in response to
imipramine (Fig. 4b). The identity of these proteins is
currently unclear, but they may represent intracellular signaling proteins interacting with trkB and phosphorylated in response to trkB activation.
TrkB can be phosphorylated to several intracellular tyrosine residues,
and the phosphorylation of particular tyrosines leads to activation of
specific signaling pathways. Double tyrosine residues 706/707
(analogous to tyrosines 694/695 in trkA) are situated at the
autophosphorylation site, which is required for the activation of trkB.
Tyrosine 515 (analogous to Y490 in trkA) is the docking site of the
shc adaptor protein, which leads to the activation of the
extracellular signal-regulated kinase/mitogen-activated protein kinase
pathway (Kaplan and Miller, 2000 ; Huang and Reichardt, 2001 ). We used
trk phosphotyrosine-specific antibodies to investigate which of the
tyrosines are phosphorylated in response to antidepressant treatment.
pY694/695 antibody, which recognizes the tyrosine residues 706/707 at
the autophosphorylation site, demonstrated a robust increase in
phosphorylation in prefrontal cortex 30 min after imipramine treatment
(178 ± 23% of control; p < 0.01) (Fig.
5). In contrast, pY490 antibody, which
recognizes the phosphorylated tyrosine 515 at the shc binding site,
failed to show increased phosphorylation in response to antidepressants
in prefrontal cortex or hippocampus (108 ± 9% of control;
p = 0.53) (Fig. 5), although this antibody detected a
robust increase in trk phosphorylation in cultured hippocampal neurons
exposed to BDNF (data not shown). These data suggest that
antidepressants induce a tyrosine-specific phosphorylation of trkB and
indicate that pathways downstream of the pY515 may not be involved in
antidepressant-induced trkB signaling.

View larger version (58K):
[in this window]
[in a new window]
|
Figure 5.
Autophosphorylation of different trkB tyrosines
after antidepressant treatment. Top panel, Tissue
lysates from prefrontal cortex from mice injected with saline
(SAL) or imipramine (IMI) (30 mg/kg) 30 min before dissection were precipitated with anti-pan-trk
antibody (IP-trk) or wheat germ agglutinin
(WGA) and detected with phosphotyrosine antibody
(4G10), pY674/5 antibody (recognized
phosphorylated trk autophosphorylation site), pY490
antibody (recognizes shc binding site in trk), or panTrk
antibody (to verify equal loading). The three WGA-precipitated blots
show the same representative lanes on a single filter sequentially
probed with different antibodies. Bottom panel,
Quantitation of autophosphorylation-different trkB tyrosines. Data are
shown as a mean ± SEM; n = 6 for each
treatment. The experiment was repeated at least three times for each of
the antibodies, with similar results.
|
|
We also investigated the effect of antidepressants on total brain BDNF
protein levels by BDNF enzyme immunoassay (Nawa et al., 1995 ).
Imipramine did not significantly change total cortical BDNF protein
levels in wild-type mice [6.0 ± 0.3 and 6.2 ± 0.3 ng/g of
tissue in imipramine (n = 12) and saline-treated
animals (n = 11), respectively], which is consistent
with the observation that acute treatment with antidepressants does not
change BDNF mRNA levels (Nibuya et al., 1995 ). It should be noted,
however, that this assay does not measure changes in BDNF release but
detects total cortical BDNF levels. Because a recent study showed that intrahippocampal infusion of neurotrophin-3 produced
antidepressant-like behavioral effects (Shirayama et al., 2002 ),
we also investigated the effect of imipramine on cortical
neurotrophin-3 protein levels. Also in this case, no significant
differences could be observed (94 ± 6.9% of control). These data
suggest that if acute antidepressant treatment activates trkB by
increasing BDNF release, then the levels of BDNF released, although
sufficient to activate trkB signaling, are too low or too local to
detectably influence the total pool of cortical BDNF mRNA or protein.
Both acute and chronic antidepressant treatments induce
trkB phosphorylation
We next investigated the time course of trkB activation by
antidepressants. At 30 min after fluoxetine injection,
autophosphorylation of trkB was increased significantly (Fig.
6a). In contrast, at 6 hr,
trkB phosphorylation was reduced significantly below the control level,
presumably reflecting desensitization after stimulation (Fig.
6a). At 24 hr, autophosphorylation was back at the baseline. The relatively short duration of trkB autophosphorylation is consistent with the previous observation that the kainic acid-induced increase in
trkB phosphorylation was already reduced back to baseline at 2 hr after
injection (Aloyz et al., 1999 ).

View larger version (30K):
[in this window]
[in a new window]
|
Figure 6.
a, Time course of changes in trkB
autophosphorylation in response to fluoxetine administration (20 mg/kg,
i.p.). b, Autophosphorylation of trkB after acute and
chronic antidepressant treatments. Mice received saline (open
bars) or imipramine (30 mg/kg) (filled bars)
intraperitoneally once (30 min; n = 18 for both
groups) or once daily for 3 weeks (21 d; n = 11 for
both groups). Top panel, Representative Western blots
precipitated with WGA and sequentially probed with anti-phosphotyrosine
antibody 4G10 and anti-trkBout antibody. Bottom
panel and a show quantitated levels of
phosphorylated trkB from different treatments. Data are presented as
means ± SEM percentages of the ratio of phosphorylated trk
(4G10) to full-length trkB
(anti-trkBout) signal intensity levels found in
saline-treated animals. *p < 0.03, **p < 0.01 against saline control; Student's
t test.
|
|
Because the clinical effects of antidepressants require repeated
administration, we investigated whether the induction of trkB
phosphorylation persists during chronic treatment. In mice treated with
imipramine for 3 weeks, a similar significant increase in trkB
autophosphorylation levels was observed 30 min after the last injection
as was seen after acute antidepressant administration (Fig.
6b). At 6 and 24 hr after chronic imipramine treatment, trkB
phosphorylation was not significantly increased (116 ± 13% and
119 ± 16% of controls, respectively). However, no
desensitization of the trkB phosphorylation was seen at 6 hr after the
chronic treatment, as was observed 6 hr after the acute injection.
Thus, trkB autophosphorylation is stimulated to a similar degree by both acute and chronic antidepressant treatments.
TrkB activation is most pronounced in prefrontal cortex
It is unclear in which target brain area antidepressant drugs
bring about their action, but hippocampus as well as prefrontal and
anterior cingulate cortex are often implicated in this context. The
brain area that was included in our analysis of trkB phosphorylation status comprised the anterior cingulate cortex as well as the sensory
motor cortices in the frontoparietal cortex. To further investigate
whether there are brain area-dependent differences in the
responsiveness of trkB phosphorylation to antidepressants, we dissected
various cortical areas 30 min after the injection from brains of mice
treated acutely (30 min) or chronically (21 d) with imipramine. In mice
treated acutely with imipramine, a small but consistent increase in
trkB phosphorylation was observed in all the cortical areas examined
after acute imipramine injection (Fig.
7). However, the trkB autophosphorylation
response to antidepressants was by far the most robust in the anterior
cingulate-prefrontal cortex area (Fig. 7). After 21 d of
imipramine treatment, however, clearly elevated trkB
autophosphorylation could be observed also in the hippocampus in
addition to the anterior cingulate-prefrontal cortex, but not in other
cortical areas examined (Fig. 7). This observation is in agreement with
the potential role of the anterior cingulate-prefrontal cortex and
hippocampus in the pathophysiology of depression (Drevets, 1998 ).

View larger version (16K):
[in this window]
[in a new window]
|
Figure 7.
Effects of acute or chronic antidepressant
treatments on trkB phosphorylation in different cortical areas. Lysates
of dissected samples from anterior cingulate-prefrontal cortex
(AC), hippocampus (HC),
posterior cingulate cortex (PC), and parietal
cortex (CX) of mice injected once or for 21 d with imipramine (30 mg/kg, 30 min before dissection;
n = 6) were precipitated with WGA, and blots were
probed with anti-phospho-trk 674/675 antibody. Means ± SEM;
percentage of saline-treated control in the same cortical area
(n = 6) shown (Cont) is saline
control of the AC area. *p < 0.05, #p = 0.053; Student's t
test.
|
|
Antidepressants induce trkB-dependent phosphorylation of CREB
Phosphorylation of CREB has been shown to be increased in brain in
response to trkB activation (Shaywitz and Greenberg, 1999 ) as well as
after chronic antidepressant administration (Thome et al., 2000 ). We
used an antibody recognizing phosphorylated CREB (as well as other
phosphorylated members of the CREB/ATF family) to investigate whether
trkB activation in response to antidepressant treatment might induce
intracellular signal transduction leading to CREB phosphorylation. In
saline-injected mice, a variable staining of nuclei was observed in
many cortical areas (Fig. 8). However, in
the anterior cingulate and prefrontal cortex, a robust increase in
nuclear phospho-CREB staining was observed in five of six mice 30 min
after imipramine injection, whereas only few nuclei were stained in
this region in six mice injected with saline (1 ± 0.58 and
20.5 ± 6.7 positive cells within the counted area in saline- and
imipramine-injected mice, respectively; p < 0.05). A
similar, albeit less pronounced response, was also observed in the
prefrontal cortex of mice injected with fluoxetine (1 ± 0.58 and
6.25 ± 1.4 positive cells within the counted area in saline- and
fluoxetine-injected mice, respectively; p < 0.05). Induction of CREB phosphorylation in anterior cingulate cortex by
imipramine was clearly weaker in transgenic mice, which overexpress dominant-negative trkB isoform (Fig. 8), suggesting that
antidepressant-induced CREB phosphorylation is at least partially a
consequence of increased trkB signaling. Thome et al. (2000) did not
observe any significant increase in phospho-CREB levels in hippocampus
after acute fluoxetine or desipramine administration; however, they
assayed phospho-CREB at 6 hr after injection, at the time when trkB
phosphorylation was downregulated (Fig. 6a). Our data
suggest that the signal initiated by trkB autophosphorylation in
response to antidepressant drugs is further transmitted and conveyed to
nucleus by phosphorylated CREB.

View larger version (140K):
[in this window]
[in a new window]
|
Figure 8.
Phosphorylation of CREB in the anterior cingulate
cortex 30 min after saline (SAL) or imipramine
(IMI) (30 mg/kg, i.p.) administration. Top
panel, Wild-type mice; bottom panel,
trkB.T1-overexpressing mice; magnification, 40×.
Inset shows a larger magnification (400×),
demonstrating nuclear localization of the phosphorylated CREB.
|
|
TrkB autophosphorylation correlates with the behavioral response
to antidepressants
To be able to correlate the lack of behavioral responsiveness to
antidepressants in trkB.T1 transgenic mice with the trkB autophosphorylation status, we investigated trkB phosphorylation status
in a group of mice subjected to the forced swim test. Exposure to
saline injection and forced swim stress alone did not influence the
phosphorylation status of trkB when compared with naive mice gently
taken directly from their home cage (98 ± 12% of control for
trkB; n = 8), indicating that any observed changes in
trkB phosphorylation can be attributed to the antidepressant treatment. Fluoxetine injection followed by a forced swim test reduced immobility time (data not shown) and increased trkB phosphorylation at 30 min in
wild-type mice (Fig. 9), which was
similar to that seen in mice not subjected to forced swim. In trkB.T1
transgenic mice, the basal trkB phosphorylation status was
significantly lower than in wild-type mice, consistent with the
inhibition of trkB activation by the dominant-negative transgene (Fig.
9). More importantly, and in contrast to that observed in wild-type
mice, fluoxetine injection did not significantly increase trkB
phosphorylation levels in transgenic mice (Fig. 9), which is consistent
with the insensitivity of these mice to the behavioral effects of
fluoxetine. These data strongly suggest that the trkB activation and
signaling observed within 30 min after antidepressant injection is
required for the behavioral effects characteristically produced by
antidepressants in mice.

View larger version (21K):
[in this window]
[in a new window]
|
Figure 9.
a, TrkB autophosphorylation in
trkB.T1 transgenic and wild-type littermate mice after acute fluoxetine
treatment and forced swim test (n = 8-16 for each
differently treated genotype). There was no significant difference in
the extent of trkB phosphorylation induction between saline- and
fluoxetine-treated transgenic mice. *p < 0.05, **p < 0.01, compared with saline-treated wild-type
animals (Student's t test). Data presented as
means ± SEM. b, Representative Western blots
corresponding to data shown in a precipitated with WGA
and probed first with anti-phosphotyrosine antibody 4G10 and reprobed
with anti-trkBout antibody to ascertain that samples
contained similar amounts of trkB. Wt, Wild type;
Tg, transgenic.
|
|
 |
Discussion |
Previous data show that infusion of BDNF into hippocampus or
midbrain area produces behavioral effects similar to those seen after
antidepressant treatment (Siuciak et al., 1997 ; Shirayama et al.,
2002 ). These data have suggested that BDNF may play a role in the
long-term effects of antidepressants, but they have not addressed the
role of endogenous BDNF in this context. We have here shown that acute
as well as chronic antidepressant administration activates neurotrophin
signaling in a BDNF-dependent manner in prefrontal cortex and that this
signaling is required for the typical behavioral effects produced
by these drugs in experimental animals. Together with previous
observations of increased BDNF mRNA levels after chronic antidepressant
administration (Nibuya et al., 1995 ; Russo-Neustadt et al., 2000 ), our
data strongly suggest that this clinically widely used class of drugs
may act at least partially by activating endogenous BDNF signaling.
Drugs that locally enhance the production and release of endogenous
neurotrophins at their normal site of synthesis would have obvious
advantages as neurotrophic therapy when compared with infusion of
exogenous BDNF into brain or even with potential small molecular weight
mimetics of neurotrophin action, which activate neurotrophin receptors
all over the body (Thoenen et al., 1994 ). We show here that
antidepressant drugs activate release of endogenous BDNF and induce its
signal transduction. Activation of neurotrophin signaling with
potential long-term effects on various neuronal systems is consistent
with the relatively wide therapeutic efficacy of antidepressants in
many CNS disorders. In addition to being used to treat depression,
antidepressants are used to treat chronic pain, phobia,
obsessive-compulsive disorders, bulimia, and premenstrual syndrome,
among others (Nestler et al., 2002 ). Remarkably, sensory motor
activation in stroke patients was recently shown to be improved by a
single fluoxetine injection (Pariente et al., 2001 ), which is
consistent with the important role of endogenous BDNF in stroke
(Saarelainen et al., 2000b ). In addition to antidepressants,
antagonists of 2 adrenoreceptors were recently
shown to increase BDNF release and trkB activation in cortex (Aloyz et
al., 1999 ). Furthermore, we have recently shown that memantine, a
glutamate receptor antagonist that is used clinically to treat mild
dementia (Parsons et al., 1999 ), increases BDNF mRNA in cortex and
hippocampus (Marvanova et al., 2001 ). These data suggest that drugs
already in clinical use may act at least partially by locally
increasing neurotrophin release.
The mechanism through which antidepressants activate trkB signaling
remains unclear. The observation that
BDNF+/ mice
and trkB.T1 mice showed a similar phenotype in the forced swim test
suggests that antidepressants might directly or indirectly stimulate
BDNF release, which then leads to trkB activation. Antidepressant drugs
acutely facilitate signaling of serotonin or norepinephrine by
inhibiting their reuptake to presynaptic terminals (tricyclic antidepressants, such as imipramine) or by inhibiting their catabolism (monoamine oxidase inhibitors), or binding to serotonin
autoreceptors (for review, see Duman et al., 1997 ; Charney,
1998 ; Skolnick, 1999 ; Manji et al., 2001 ; Nestler et al., 2002 ). BDNF
is anterogradely transported to nerve terminals and released in
response to nerve stimulation in a manner similar to neuropeptides
(Altar and DiStefano, 1998 ; Aloyz et al., 1999 ; Balkowiec and Katz,
2000 ). Inhibition of presynaptic
2-adrenoreceptors on noradrenergic nerve
terminals by yohimbine has been shown to increase the release not only
of norepinephrine but also of BDNF, and this increased release induces trkB autophosphorylation in cortex (Aloyz et al., 1999 ). However, because long-term antidepressant treatment silences rather than activates monoaminergic neuronal firing (Szabo et al., 1999 ), it is
possible that increased 5-HT and norepinephrine levels may locally
induce increased BDNF release. Indeed, exposure of cultured raphe
neurons to serotonin increased BDNF release, which in turn enhanced
serotonergic differentiation of the neurons (Galter and Unsicker,
2000 ). Taken together, these data are clear evidence that manipulation
of monoamine transmission may induce BDNF release. It is possible that
changes in synaptic serotonin and norepinephrine levels induced by
antidepressants increase BDNF release through a comparable mechanism,
thereby initiating trkB signaling and a neurotrophic response. However,
because we failed to observe any changes in total BDNF protein content
in response to antidepressants, it is also possible that
antidepressants activate trkB through intracellular signal
transduction, as has been reported recently for certain
G-protein-coupled receptors (Lee and Chao, 2001 ). The observation that
only a subset of tyrosines in trkB is phosphorylated might also favor
an intracellular activation mechanism.
We have observed a robust autophosphorylation response to
antidepressants in the autophosphorylation site of trkB (tyrosines 706/707), but no response was observed when a phospho-specific antibody
to the shc site (tyrosine 515) was used. The lack of specific
antibodies to the other phosphorylated tyrosines in trkB prevented us
from testing whether the phosphorylation occurs exclusively to
tyrosines 706/707 or whether other tyrosines in trkB are also phosphorylated in trkB. These results suggest that trkB signal transduction induced by antidepressants does not involve the shc interaction with trkB. Mice that have tyrosine 515 of trkB gene mutated
to phenylalanine are viable and fertile and display defects mainly in
systems dependent on NT-4 signaling, suggesting that tyrosine 515 is
not absolutely required for BDNF-dependent signaling in vivo
(Minichiello et al., 1998 ). Although tyrosine 515-dependent pathways
are robustly activated in vitro and when high concentrations of BDNF are injected into brain in vivo, signaling changes
that take place after the release of endogenous BDNF in brain may use, at least partially, other signal transduction pathways.
The response of trkB phosphorylation to antidepressant administration
was highest in the region of anterior cingulate and prefrontal cortex
after both acute and chronic treatments but was observed in hippocampus
only after chronic treatment. Several studies have implicated
dysfunction of prefrontal and anterior cingulate cortices in the
pathophysiology of depression (for review, see Drevets, 1998 ).
Depression is associated with reduced cortical thickness and neuronal
size (Rajkowska et al., 1999 ) as well as with decreased blood flow and
metabolism in prefrontal and anterior cingulate cortex (Drevets et al.,
1997 ; Drevets, 1998 ), and these effects are reversed when depression is
treated successfully (Wu et al., 1992 ; Nobler et al., 1994 ). These
studies suggest that depression is associated with and perhaps even
caused by cortical neuronal atrophy and the accompanying loss of
neuronal communication in prefrontal cortex. Because neuronal atrophy
has also been observed in cortex of mice lacking trkB in forebrain (Xu
et al., 2000 ) and serotonergic innervation to cortex is gradually lost
with age in
BDNF+/ mice
(Lyons et al., 1999 ), it is possible that reduced trkB signaling may be
one of the factors that leads to decreased neuronal communication and
development of depression. However, we did not observe any baseline
deficits in the forced swim behavior in trkB.T1 and
BDNF+/
mice, and similar findings were recently reported for
BDNF+/ mice
(MacQueen et al., 2001 ), which indicates that trkB signaling may be
more important for the antidepressant drug effect than for the baseline
alterations of depression.
Increase in BDNF release and trkB activation in cortex after
antidepressant administration is expected to lead to plastic changes in
synaptic function and neuronal connectivity. BDNF stimulates outgrowth
and regeneration of dendrites and axons (McAllister et al., 1999 ;
Mamounas et al., 2000 ; Poo, 2001 ), promotes synaptogenesis (Poo, 2001 ),
and mediates activity-dependent selection and maturation of functional
synapses (Katz and Shatz, 1996 ). It is conceivable that BDNF-induced
plastic changes may take time to develop and mature, which might
explain in part why the clinical antidepressive effect develops with a
delay after the beginning of the treatment. Although antidepressants
induce BDNF release and trkB signaling virtually immediately after
administration, the neuronal events that are produced by increased
neurotrophin signaling may develop slowly and correlate with the
gradual appearance of the clinical response. Our results support the
hypothesis that neurotrophin-mediated improvement in neuronal
communication (Duman et al., 1997 ; Altar, 1999 ; Skolnick, 1999 ; Manji
et al., 2001 ; Reid and Stewart, 2001 ), or perhaps regeneration of
synaptic connections lost during depression (Drevets, 1998 ; Rajkowska
et al., 1999 ), may be the underlying mechanism of antidepressant drug
action and suggest that stimulation of BDNF release and trkB signaling
in response to antidepressant drug treatment may be the critical event
that initiates this effect.
 |
FOOTNOTES |
Received May 24, 2002; revised Oct. 9, 2002; accepted Oct. 15, 2002.
*
T.S. and P.H. contributed equally to this work.
This work was supported by grants from The Academy of Finland, Finnish
National Technology Agency, and Sigrid Juselius Foundation to
E.C., and from the Swedish Research Council and Göran Gustafssons Foundation to P.E. We thank Dr. D. Kaplan (Montreal Neurological Institute, McGill University, Canada) for the trkB antibodies, Dr. L. Mamounas (National Institute of Neurological Disorders and
Stroke, National Institutes of Health) for help with 5-HT and
SERT stainings, Drs. H. Thoenen, M. Castrén, M. Saarma, J. Tuomisto, and J. Lehtonen for their comments on this manuscript, Dr. J. Sirviö (Orion-Pharma, Turku, Finland) for the donation of
fluoxetine, and L. Kaskela, A.-M. Friis, I. Sipola, O. Kontkanen, and
T. Rauramaa for assistance.
Correspondence should be addressed to Eero Castrén, A. I. Virtanen Institute, University of Kuopio, P.O. Box 1627, 70211 Kuopio,
Finland. E-mail: Eero.Castren{at}uku.fi.
R. Aloyz's present address: Lady Davis Institute for Medical Research,
Sir Mortimer B. Davis-Jewish General Hospital, and McGill University,
Montreal, Quebec, Canada H3A 2B4.
 |
References |
-
Aloyz R,
Fawcett JP,
Kaplan DR,
Murphy RA,
Miller FD
(1999)
Activity-dependent activation of TrkB neurotrophin receptors in the adult CNS.
Learn Mem
6:216-231[Abstract/Free Full Text].
-
Altar CA
(1999)
Neurotrophins and depression.
Trends Pharmacol Sci
20:59-61[Medline].
-
Altar CA,
DiStefano PS
(1998)
Neurotrophin trafficking by anterograde transport.
Trends Neurosci
21:433-437[Web of Science][Medline].
-
Balkowiec A,
Katz DM
(2000)
Activity-dependent release of endogenous brain-derived neurotrophic factor from primary sensory neurons detected by ELISA in situ.
J Neurosci
20:7417-7423[Abstract/Free Full Text].
-
Charney DS
(1998)
Monoamine dysfunction and the pathophysiology and treatment of depression.
J Clin Psychiatry
59:11-14.
-
Cryan JF,
Markou A,
Lucki I
(2002)
Assessing antidepressant activity in rodents: recent developments and future needs.
Trends Pharmacol Sci
23:238-245[Medline].
-
Drevets WC
(1998)
Functional neuroimaging studies of depression: the anatomy of melancholia.
Annu Rev Med
49:341-361[Web of Science][Medline].
-
Drevets WC,
Price JL,
Simpson Jr JR,
Todd RD,
Reich T,
Vannier M,
Raichle ME
(1997)
Subgenual prefrontal cortex abnormalities in mood disorders.
Nature
386:824-827[Medline].
-
Duman RS,
Vaidya VA
(1998)
Molecular and cellular actions of chronic electroconvulsive seizures.
J Ect
14:181-193[Medline].
-
Duman RS,
Heninger GR,
Nestler EJ
(1997)
A molecular and cellular theory of depression.
Arch Gen Psychiatry
54:597-606[Abstract/Free Full Text].
-
Ernfors P,
Lee KF,
Jaenisch R
(1994a)
Mice lacking brain-derived neurotrophic factor develop with sensory deficits.
Nature
368:147-150[Medline].
-
Ernfors P,
Lee KF,
Kucera J,
Jaenisch R
(1994b)
Lack of neurotrophin-3 leads to deficiencies in the peripheral nervous system and loss of limb proprioceptive afferents.
Cell
77:503-512[Web of Science][Medline].
-
Fuller RW,
Wong DT
(1977)
Inhibition of serotonin reuptake.
Fed Proc
36:2154-2158[Web of Science][Medline].
-
Galter D,
Unsicker K
(2000)
Sequential activation of the 5-HT1(A) serotonin receptor and TrkB induces the serotonergic neuronal phenotype.
Mol Cell Neurosci
15:446-455[Web of Science][Medline].
-
Haapasalo A,
Koponen E,
Hoppe E,
Wong G,
Castrén E
(2001)
Truncated trkB.T1 is dominant negative inhibitor of trkB.TK+-mediated cell survival.
Biochem Biophys Res Commun
280:1352-1358[Web of Science][Medline].
-
Huang EJ,
Reichardt LF
(2001)
Neurotrophins: roles in neuronal development and function.
Annu Rev Neurosci
24:677-736[Web of Science][Medline].
-
Kaplan DR,
Miller FD
(2000)
Neurotrophin signal transduction in the nervous system.
Curr Opin Neurobiol
10:381-391[Web of Science][Medline].
-
Katz LC,
Shatz CJ
(1996)
Synaptic activity and the construction of cortical circuits.
Science
274:1133-1138[Abstract/Free Full Text].
-
Lee FS,
Chao MV
(2001)
Activation of Trk neurotrophin receptors in the absence of neurotrophins.
Proc Natl Acad Sci USA
98:3555-3560[Abstract/Free Full Text].
-
Lyons WE,
Mamounas LA,
Ricaurte GA,
Coppola V,
Reid SW,
Bora SH,
Wihler C,
Koliatsos VE,
Tessarollo L
(1999)
Brain-derived neurotrophic factor-deficient mice develop aggressiveness and hyperphagia in conjunction with brain serotonergic abnormalities.
Proc Natl Acad Sci USA
96:15239-15244[Abstract/Free Full Text].
-
MacQueen GM,
Ramakrishnan K,
Croll SD,
Siuciak JA,
Yu G,
Young LT,
Fahnestock M
(2001)
Performance of heterozygous brain-derived neurotrophic factor knockout mice on behavioral analogues of anxiety, nociception, and depression.
Behav Neurosci
115:1145-1153[Web of Science][Medline].
-
Mamounas LA,
Altar CA,
Blue ME,
Kaplan DR,
Tessarollo L,
Lyons WE
(2000)
BDNF promotes the regenerative sprouting, but not survival, of injured serotonergic axons in the adult rat brain.
J Neurosci
20:771-782[Abstract/Free Full Text].
-
Manji HK,
Drevets WC,
Charney DS
(2001)
The cellular neurobiology of depression.
Nat Med
7:541-547[Web of Science][Medline].
-
Marvanova M,
Lakso M,
Pirhonen J,
Nawa H,
Wong G,
Castren E
(2001)
The neuroprotective agent memantine induces brain-derived neurotrophic factor and trkB receptor expression in rat brain.
Mol Cell Neurosci
18:247-258[Web of Science][Medline].
-
McAllister AK,
Katz LC,
Lo DC
(1999)
Neurotrophins and synaptic plasticity.
Annu Rev Neurosci
22:295-318[Web of Science][Medline].
-
Minichiello L,
Casagranda F,
Tatche RS,
Stucky CL,
Postigo A,
Lewin GR,
Davies AM,
Klein R
(1998)
Point mutation in trkB causes loss of NT4-dependent neurons without major effects on diverse BDNF responses.
Neuron
21:335-345[Web of Science][Medline].
-
Nawa H,
Carnahan J,
Gall C
(1995)
BDNF protein measured by a novel enzyme immunoassay in normal brain and after seizure: partial disagreement with mRNA levels.
Eur J Neurosci
7:1527-1535[Web of Science][Medline].
-
Nestler EJ,
Barrot M,
DiLeone RJ,
Eisch AJ,
Gold SJ,
Monteggia LM
(2002)
Neurobiology of depression.
Neuron
34:13-25[Web of Science][Medline].
-
Nibuya M,
Morinobu S,
Duman RS
(1995)
Regulation of BDNF and trkB mRNA in rat brain by chronic electroconvulsive seizure and antidepressant drug treatments.
J Neurosci
15:7539-7547[Abstract].
-
Nobler MS,
Sackeim HA,
Prohovnik I,
Moeller JR,
Mukherjee S,
Schnur DB,
Prudic J,
Devanand DP
(1994)
Regional cerebral blood flow in mood disorders. III. Treatment and clinical response.
Arch Gen Psychiatry
51:884-897[Abstract/Free Full Text].
-
Pariente J,
Loubinoux I,
Carel C,
Albucher JF,
Leger A,
Manelfe C,
Rascol O,
Chollet F
(2001)
Fluoxetine modulates motor performance and cerebral activation of patients recovering from stroke.
Ann Neurol
50:718-729[Web of Science][Medline].
-
Parsons CG,
Danysz W,
Quack G
(1999)
Memantine is a clinically well tolerated N-methyl-D-aspartate (NMDA) receptor antagonist-a review of preclinical data.
Neuropharmacology
38:735-767[Web of Science][Medline].
-
Poo MM
(2001)
Neurotrophins as synaptic modulators.
Nat Rev Neurosci
2:24-32[Web of Science][Medline].
-
Porsolt RD,
Bertin A,
Jalfre M
(1977)
Behavioral despair in mice: a primary screening test for antidepressants.
Arch Int Pharmacodyn Ther
229:327-336[Web of Science][Medline].
-
Rajkowska G,
Miguel-Hidalgo JJ,
Wei J,
Dilley G,
Pittman SD,
Meltzer HY,
Overholser JC,
Roth BL,
Stockmeier CA
(1999)
Morphometric evidence for neuronal and glial prefrontal cell pathology in major depression.
Biol Psychiatry
45:1085-1098[Web of Science][Medline].
-
Reid IC,
Stewart CA
(2001)
How antidepressants work: new perspectives on the pathophysiology of depressive disorder.
Br J Psychiatry
178:299-303[Abstract/Free Full Text].
-
Russo-Neustadt AA,
Beard RC,
Huang YM,
Cotman CW
(2000)
Physical activity and antidepressant treatment potentiate the expression of specific brain-derived neurotrophic factor transcripts in the rat hippocampus.
Neuroscience
101:305-312[Web of Science][Medline].
-
Saarelainen T,
Pussinen R,
Koponen E,
Alhonen L,
Wong G,
Sirviö J,
Castrén E
(2000a)
Transgenic mice overexpressing truncated trkB neurotrophin receptors in neurons have impaired long-term spatial memory but normal hippocampal LTP.
Synapse
38:102-104[Web of Science][Medline].
-
Saarelainen T,
Lukkarinen JA,
Koponen S,
Gröhn OH,
Jolkkonen J,
Koponen E,
Haapasalo A,
Alhonen L,
Wong G,
Koistinaho J,
Kauppinen RA,
Castrén E
(2000b)
Transgenic mice overexpressing truncated trkB neurotrophin receptors in neurons show increased susceptibility to cortical injury after focal cerebral ischemia.
Mol Cell Neurosci
16:87-96[Web of Science][Medline].
-
Shaywitz AJ,
Greenberg ME
(1999)
CREB: a stimulus-induced transcription factor activated by a diverse array of extracellular signals.
Annu Rev Biochem
68:821-861[Web of Science][Medline].
-
Shirayama Y,
Chen AC,
Nakagawa S,
Russell DS,
Duman RS
(2002)
Brain-derived neurotrophic factor produces antidepressant effects in behavioral models of depression.
J Neurosci
22:3251-3261[Abstract/Free Full Text].
-
Siuciak JA,
Altar CA,
Wiegand SJ,
Lindsay RM
(1994)
Antinociceptive effect of brain-derived neurotrophic factor and neurotrophin-3.
Brain Res
633:326-330[Web of Science][Medline].
-
Siuciak JA,
Boylan C,
Fritsche M,
Altar CA,
Lindsay RM
(1996)
BDNF increases monoaminergic activity in rat brain following intracerebroventricular or intraparenchymal administration.
Brain Res
710:11-20[Web of Science][Medline].
-
Siuciak JA,
Lewis DR,
Wiegand SJ,
Lindsay RM
(1997)
Antidepressant-like effect of brain-derived neurotrophic factor (BDNF).
Pharmacol Biochem Behav
56:131-137[Web of Science][Medline].
-
Skolnick P
(1999)
Antidepressants for the new millennium.
Eur J Pharmacol
375:31-40[Web of Science][Medline].
-
Smith MA,
Makino S,
Kvetnansky R,
Post RM
(1995)
Stress and glucocorticoids affect the expression of brain-derived neurotrophic factor and neurotrophin-3 mRNAs in the hippocampus.
J Neurosci
15:1768-1777[Abstract].
-
Soppet D,
Escandon E,
Maragos J,
Middlemas DS,
Reid SW,
Blair J,
Burton LE,
Stanton BR,
Kaplan DR,
Hunter T
(1991)
The neurotrophic factors brain-derived neurotrophic factor and neurotrophin-3 are ligands for the trkB tyrosine kinase receptor.
Cell
65:895-903[Web of Science][Medline].
-
Squinto SP,
Stitt TN,
Aldrich TH,
Davis S,
Bianco SM,
Radziejewski C,
Glass DJ,
Masiakowski P,
Furth ME,
Valenzuela DM,
DiStefano PS,
Yancopoulos GD
(1991)
TrkB encodes a functional receptor for brain-derived neurotrophic factor and neurotrophin-3 but not nerve growth factor.
Cell
65:885-893[Web of Science][Medline].
-
Szabo ST,
de Montigny C,
Blier P
(1999)
Modulation of noradrenergic neuronal firing by selective serotonin reuptake blockers.
Br J Pharmacol
126:568-571[Web of Science][Medline].
-
Thoenen H,
Castren E,
Berzaghi M,
Blöchl A,
Lindholm D
(1994)
Neurotrophic factors: possibilities and limitations in the treatment of neurodegenerative disorders.
In: Recent advances in the treatment of neurodegenerative disorders and cognitive dysfunction (Racagni G,
Brunello N,
Langer SZ,
eds), pp 197-203. Basel: Karger.
-
Thome J,
Sakai N,
Shin K,
Steffen C,
Zhang YJ,
Impey S,
Storm D,
Duman RS
(2000)
cAMP response element-mediated gene transcription is upregulated by chronic antidepressant treatment.
J Neurosci
20:4030-4036[Abstract/Free Full Text].
-
Wisden W,
Morris B
(1994)
In situ hybridization with synthetic oligonucleotide probes.
In: In situ hybridization protocols for neurobiology (Wisden W,
Morris B,
eds), pp 1-34. London: Academic.
-
Wu JC,
Gillin JC,
Buchsbaum MS,
Hershey T,
Johnson JC,
Bunney Jr WE
(1992)
Effect of sleep deprivation on brain metabolism of depressed patients.
Am J Psychiatry
149:538-543[Abstract/Free Full Text].
-
Xu B,
Zang K,
Ruff NL,
Zhang YA,
McConnell SK,
Stryker MP,
Reichardt LF
(2000)
Cortical degeneration in the absence of neurotrophin signaling: dendritic retraction and neuronal loss after removal of the receptor TrkB.
Neuron
26:233-245[Web of Science][Medline].
Copyright © 2003 Society for Neuroscience 0270-6474/03/231349-09$05.00/0
This article has been cited by other articles:

|
 |

|
 |
 
O. Bozdagi, E. Rich, S. Tronel, M. Sadahiro, K. Patterson, M. L. Shapiro, C. M. Alberini, G. W. Huntley, and S. R. J. Salton
The Neurotrophin-Inducible Gene Vgf Regulates Hippocampal Function and Behavior through a Brain-Derived Neurotrophic Factor-Dependent Mechanism
J. Neurosci.,
September 24, 2008;
28(39):
9857 - 9869.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. E. Malberg and L. M. Monteggia
VGF, a New Player in Antidepressant Action?
Sci. Signal.,
May 6, 2008;
1(18):
pe19 - pe19.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. Thakker-Varia, J. J. Krol, J. Nettleton, P. M. Bilimoria, D. A. Bangasser, T. J. Shors, I. B. Black, and J. Alder
The Neuropeptide VGF Produces Antidepressant-Like Behavioral Effects and Enhances Proliferation in the Hippocampus
J. Neurosci.,
November 7, 2007;
27(45):
12156 - 12167.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
K. Narushima, S. Paradiso, D. J. Moser, R. Jorge, and R. G. Robinson
Effect of antidepressant therapy on executive function after stroke
The British Journal of Psychiatry,
March 1, 2007;
190(3):
260 - 265.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
Y. Yagasaki, T. Numakawa, E. Kumamaru, T. Hayashi, T.-P. Su, and H. Kunugi
Chronic Antidepressants Potentiate via Sigma-1 Receptors the Brain-derived Neurotrophic Factor-induced Signaling for Glutamate Release
J. Biol. Chem.,
May 5, 2006;
281(18):
12941 - 12949.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
T. Hajszan and N. J. MacLusky
Neurologic links between epilepsy and depression in women: Is hippocampal neuroplasticity the key?
Neurology,
March 28, 2006;
66(66_suppl_3):
S13 - S22.
[Abstract]
[Full Text]
|
 |
|

|
 |

|
 |
 
D. Tardito, J. Perez, E. Tiraboschi, L. Musazzi, G. Racagni, and M. Popoli
Signaling pathways regulating gene expression, neuroplasticity, and neurotrophic mechanisms in the action of antidepressants: a critical overview.
Pharmacol. Rev.,
March 1, 2006;
58(1):
115 - 134.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. Sairanen, G. Lucas, P. Ernfors, M. Castren, and E. Castren
Brain-Derived Neurotrophic Factor and Antidepressant Drugs Have Different But Coordinated Effects on Neuronal Turnover, Proliferation, and Survival in the Adult Dentate Gyrus
J. Neurosci.,
February 2, 2005;
25(5):
1089 - 1094.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
P. R. Albert and S. Lemonde
5-HT1A Receptors, Gene Repression, and Depression: Guilt by Association
Neuroscientist,
December 1, 2004;
10(6):
575 - 593.
[Abstract]
[PDF]
|
 |
|

|
 |

|
 |
 
R. DeLong
Autism and Familial Major Mood Disorder: Are They Related?
J Neuropsychiatry Clin Neurosci,
May 1, 2004;
16(2):
199 - 213.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. S. Newton, E. F. Collier, J. Hunsberger, D. Adams, R. Terwilliger, E. Selvanayagam, and R. S. Duman
Gene Profile of Electroconvulsive Seizures: Induction of Neurotrophic and Angiogenic Factors
J. Neurosci.,
November 26, 2003;
23(34):
10841 - 10851.
[Abstract]
[Full Text]
[PDF]
|
 |
|
|