 |
Previous Article | Next Article 
The Journal of Neuroscience, January 1, 2003, 23(1):7-11
BRIEF COMMUNICATION
Excitation of Ventral Tegmental Area Dopaminergic and
Nondopaminergic Neurons by Orexins/Hypocretins
Tatiana M.
Korotkova,
Olga A.
Sergeeva,
Krister S.
Eriksson,
Helmut L.
Haas, and
Ritchie E.
Brown
Institut für Neurophysiologie,
Heinrich-Heine-Universität, D-40001 Düsseldorf, Germany
 |
ABSTRACT |
Orexins/hypocretins are involved in mechanisms of emotional
arousal and short-term regulation of feeding. The dense projection of
orexin neurons from the lateral hypothalamus to mesocorticolimbic dopaminergic neurons in the ventral tegmental area (VTA) is likely to
be important in both of these processes.
We used single-unit extracellular and whole-cell patch-clamp recordings
to examine the effects of orexins (A and B) and melanin-concentrating hormone (MCH) on neurons in this region. Orexins caused an increase in
firing frequency (EC50 78 nM), burst firing, or
no change in firing in different groups of A10 dopamine neurons.
Neurons showing oscillatory firing in response to orexins had smaller
afterhyperpolarizations than the other groups of dopamine neurons.
Orexins (100 nM) also increased the firing frequency of
nondopaminergic neurons in the VTA. In the presence of tetrodotoxin
(0.5 µM), orexins depolarized both dopaminergic and
nondopaminergic neurons, indicating a direct postsynaptic effect.
Unlike the orexins, MCH did not affect the firing of either group of
neurons. Single-cell PCR experiments showed that orexin receptors were
expressed in both dopaminergic and nondopaminergic neurons and that the
calcium binding protein calbindin was only expressed in neurons, which
also expressed orexin receptors.
In narcolepsy, in which the orexin system is disrupted, dysfunction of
the orexin modulation of VTA neurons may be important in triggering
attacks of cataplexy.
Key words:
dopamine; GABA; hypocretin; melanin concentrating
hormone; narcolepsy; orexin; reward; whole-cell
 |
Introduction |
Ventral tegmental area (VTA)
dopaminergic and GABAergic neurons are critically involved in brain
mechanisms of reward, reinforcement, and emotional arousal (Wise and
Rompre, 1989 ). A10 dopamine neurons project from the VTA to the nucleus
accumbens, amygdala, hippocampus, and prefrontal cortex, forming the
mesocorticolimbic dopamine system (Albanese and Minciacchi, 1983 ). VTA
GABAergic neurons also project to the prefrontal cortex and regulate
the activity of VTA dopamine neurons via local axon collaterals
(Steffensen et al., 1998 ). The firing of dopamine neurons in this
region is closely correlated with the availability of primary rewards
(food, water, and sex) (Schultz, 1998 ). Activation of VTA neurons
initiates locomotor activity to obtain such primary rewards, and this
activation is associated with a high level of arousal; compounds, which
block the dopamine transporter, leading to enhanced dopaminergic tone in target regions, are potent wake-promoting substances (Wisor et al.,
2001 ).
The VTA receives a massive input from the lateral hypothalamic area,
including projections from neurons containing the neurotransmitters orexin A and orexin B (Fadel and Deutch, 2002 ). Recent evidence has
shown that loss of orexin neurons or mutation of the orexin 2 receptor
causes the sleep disorder narcolepsy (Willie et al., 2001 ). Central
injection of orexin A, which activates both orexin receptors with high
affinity, potently enhances arousal and locomotor activity, as well as
causes a short-lasting increase in feeding (Willie et al., 2001 ). VTA
neurons are likely to be involved in both the physiological and
pathophysiological roles of orexins. The hyperlocomotion and stereotypy
induced by intracerebroventricular orexin application are blocked by
dopamine receptor antagonists, and orexins increase intracellular
calcium in acutely isolated A10 dopamine neurons (Nakamura et al.,
2000 ). The excessive daytime sleepiness of narcoleptics is currently
treated with amphetamine-like compounds, which enhance extracellular
dopaminergic levels (Nishino and Mignot, 1997 ; Wisor et
al., 2001 ). Furthermore, application of dopamine
D2 receptor agonists either systemically or
locally into the VTA exacerbates cataplexy (periods of muscle weakness triggered by emotional stimuli in narcoleptics), whereas
D2 receptor antagonists have the opposite effect
(Reid et al., 1996 ; Okura et al., 2000 ). In narcoleptic canines, the
presentation of food, one of the stimuli that potently activates VTA
dopamine neurons, is an extremely effective trigger for cataplexy
(Nishino and Mignot, 1997 ). Here we describe the effects of orexins on
dopaminergic and nondopaminergic neurons in the VTA.
Parts of this paper have been published previously in abstract form
(Korotkova et al., 2001 ).
 |
Materials and Methods |
Slice preparation and electrophysiology. Coronal
brain slices were prepared from 3- to 4-week-old male Wistar rats as
described previously (Korotkova et al., 2002 ). Slices (400 µm thick)
were cut at the level of the rostral VTA using a vibroslicer (Campden Instruments, Loughborough, UK). After slicing, they were placed into artificial CSF (ACSF) [containing (in mM)
124 NaCl, 3.7 KCl, 25.6 NaHCO3, 1.24 NaH2PO4, 2 CaCl2, 1.3 MgSO4, and 10 glucose], saturated with
95%O2-5%CO2 for 1 hr
at room temperature before being transferred to the recording chamber
at 32°C, in which they were constantly perfused with the same ACSF at
a flow rate of 1 ml/min.
Extracellular recordings were obtained using glass microelectrodes
filled with 2 M NaCl (resistance of 5-10 M ).
Positioning of the electrode was controlled with a dissecting
microscope using the accessory optic tract as a marker, which is the
border between the substantia nigra and VTA. Signals were recorded
using an Axoclamp 2A or 2B amplifier (Axon Instruments, Foster City,
CA), filtered between 0.5 and 10 kHz, sampled at 20 kHz, and analyzed
with pClamp8 software (Axon Instruments). The frequency of
extracellular action potentials was determined online in bins of 15 sec duration.
Whole-cell patch-clamp recordings were made "blindly." Patch
pipettes (3-6 M ) were pulled from borosilicate glass (GB150F-8P; Science Products, Hofheim, Germany) and filled with an intracellular solution containing: 135 mM potassium gluconate, 5 mM NaCl, MgCl2, 10 mM
HEPES, 0.1 mM EGTA, 2 mM
Na2ATP, 0.5 mM NaGTP 0.5, 0.5% biocytin, pH 7.25, with KOH, 280 mOsm. Signals were recorded using an
Axoclamp 2B amplifier (Axon Instruments). Membrane potential measurements were adjusted for a 15 mV liquid junction potential between pipette and bath solutions (calculated using pClamp8 Software; Axon Instruments). Series resistance was <50 M (and was similar in
cells showing different responses to orexins); bridge balance was
continuously maintained during current-clamp experiments. Continuous
recordings of membrane voltage were made using a Gould TA550 chart
recorder (Gould Electronics, Cleveland, OH).
Drugs and statistics. Drugs used were as follows: orexin A
and B (Bachem, Heidelberg, Germany), melanin-concentrating hormone (MCH) (Bachem), quinpirole (Research Biochemicals, Natick, MA), dopamine (Sigma, Deisenhofen, Germany), and DAMGO
(Tyr-D-Ala-Gly-NMe-Phe-Gly-ol) (Tocris Cookson,
Bristol, UK). All other chemicals were obtained from Merck (Darmstadt,
Germany). DAMGO was dissolved in DMSO (final bath concentration of DMSO
was 0.1%; this concentration of DMSO did not affect the membrane
potential of cells). Drugs were bath applied. Statistical analysis was
performed with Student's t test (unpaired) and
2 test. Data are presented as mean ± SEM.
Immunocytochemistry. After recording, slices were fixed in
4% paraformaldehyde in 0.1 M phosphate buffer
(PB), pH 7.4n for 4-8 hr, cryoprotected in PB with 30% sucrose, and
cryosectioned at 40 µm thickness. Sections were mounted on
gelatin-coated slides, dried, and stained according to the
immunofluorescence staining protocol. The sections were first washed in
PBS with 0.25% Triton X-100 (PBS-T) for 5 min and then preincubated
with 2% normal goat serum in PBS-T for 30 min at room temperature.
This solution was also used to dilute a mouse monoclonal antibody
against tyrosine hydroxylase (TH) (Sigma) to 1:500. This antibody
solution was applied to the sections for 12-16 hr at 4°C. After
washing, sections were incubated with Alexa Fluor 488-labeled goat
anti-mouse IgG (1:500; Molecular Probes, Eugene, OR) to reveal the TH
immunoreactivity and Texas Red-streptavidin (1:200; Molecular Probes)
to stain biocytin-filled neurons, for 90 min at room temperature.
Acute isolation of VTA neurons and single-cell reverse
transcription-PCR. For preparation of isolated cells, the VTA was
dissected from the slice and incubated with papain (Sigma) in crude
form (0.3-0.5 mg/ml) for 20 min at 37°C. The cytoplasm was taken for reverse transcription (RT)-PCR as described by Eriksson et al. (2001) .
Protocols of the RT reaction and PCR amplification were similar to
those described previously (Vorobjev et al., 2000 ). A two-round
amplification strategy was used in each protocol. The following primers
were used (from 5' to 3'): TH, (sense) GCTGTCACGTCCCCAAGGTT, (antisense) AAGCGCACAAAATACTCCAGG, and (antisense2, for the second round) CAGCCCGAGACAAGGAGGAG (size of the product was 220 bp). For PCR
analysis of GAD expression in the first round of amplification, the
degenerated antisense primer (CCCCAAGCAGCATCCACAT) was taken either
with GAD65 cDNA-specific sense primer (TCTTTTCTCCTGGTGGTGCC) or with
GAD67 cDNA-specific sense primer (TACGGGGTTCGCACAGGTC). For the second
round, the same sense primers were used in combination with specific
antisense primers: CAGTGGTTCCAGCTGTGGC for GAD65 and
CGGTTGCATTGACATAAAGGG for GAD67. Primers designed to recognize orexin
receptors were described previously (Eriksson et al., 2001 ). Primers
for the first amplification of calbindin (CB) and neuropeptide Y (NPY)
were described by Cauli et al. (1997) ; for the 2 d amplification, the same lower primers were used in combination with CB (sense2, TCCTGCTGCTCTTTCGATGC; size of product was 303 bp) or NPY (sense2, GCTCGTGTGTTTGGGCATTCT; 251 bp). The identity of cDNA sequences was
revealed by sequencing the second-round amplification products, performed as described by Vorobjev et al. (2000) . The thin-walled PCR
tubes contained a mixture of first-strand cDNA template (1.1 µl),
10× PCR buffer (5 µl), 10 pM each of sense and
antisense primer, and 200 µM each of dNTP, and
2.5 U of Taq polymerase. The final reaction volume was
adjusted to 50 µl with nuclease-free water (Promega, Madison, WI).
[Mg2+] was 2.5 mM
for all reactions. Taq enzyme, PCR buffer,
Mg2+ solution, and four dNTPs were
purchased from Qiagen (Erkrath, Germany). Oligonucleotides were
synthesized by MWG Biotech (Ebersberg, Germany), and amplification was
performed on a thermal cycler (GenAmp 9600; PerkinElmer Life Sciences,
Weiterstadt, Germany). In each round, 35 cycles of the following
thermal programs were used: denaturation at 94°C for 48 sec,
annealing at 53°C for 1 min, and extension at 72°C for 90 sec. For
the second amplification round, 1 µl of product from the first
amplification was used as a template.
 |
Results |
Whole-cell and single-unit recordings in slices
To characterize the effect of orexins on VTA neurons, we performed
whole-cell current-clamp recordings in slices. Cells were filled with
biocytin by diffusion from the patch pipette and identified post
hoc by staining for TH. To ensure that orexin effects on neuronal
firing were not an artifact of dialysis of the cells, the effects of
orexins were also investigated using extracellular single-unit recordings.
Electrophysiological characterization of the recorded neurons
The double stainings revealed that recordings were made from
TH-positive cells (n = 14) (Fig.
1A), which are assumed
to be dopaminergic cells, and TH-negative cells (n = 6)
(Figs. 2A,
3A), which are presumed to
be GABAergic neurons. They differed in a number of characteristics, as
described previously (Grace and Onn, 1989 ): spike duration was
significantly broader in dopaminergic neurons (n = 14)
than in GABAergic neurons (3.3 ± 0.13 vs 1.68 ± 0.23 msec;
p < 0.0005), and spike thresholds were more positive in dopaminergic than in GABAergic cells ( 44.7 ± 1.4 and
50.8 ± 0.7 mV; p < 0.05). Dopamine cells
possessed a prominent Ih current (Fig.
1B). Ih sag,
measured as the percentage reduction from the peak at the end of a
1-sec-long step elicited by a 400 pA current injection, was 33.1 ± 3.4%. In GABAergic cells, a 300 pA, 1 sec step led to a similar
amount of peak hyperpolarization, but the Ih sag at the end of it amounted to
only 5.0 ± 0.2%. The dopamine cells had an average firing
frequency of 2.86 ± 0.32 Hz; burst firing or spontaneous
alterations in firing rate were never observed in control cells. The
GABAergic cells could be divided into two groups according to their
firing rate. One group fired at a relatively high frequency: 8.7 ± 2.2 Hz (n = 3) (Fig. 2B). The
second group consisted of slow-firing cells: 0.63 ± 0.3 Hz
(n = 4) (Fig. 3B). Both groups of cells
fired at high frequency (>30 Hz) during depolarizing current steps.
Cells in both groups were hyperpolarized by the µ-receptor agonist
DAMGO (1 µM, 6.4 ± 1.2 mV in "fast"
and 6.1 ± 0.8 mV in "slow" neurons). These two groups of
nondopamine cells differed in afterhyperpolarization (AHP) amplitude
(10.7 ± 0.9 vs 14 ± 0.9 mV in fast-firing and slow-firing
cells, respectively; p < 0.05) and spike threshold
( 52.2 ± 0.4 and 49.4 ± 0.2 mV, respectively;
p < 0.005). Spike duration did not differ. Input resistance did not differ in dopaminergic (266 ± 48 M ;
n = 14) and GABAergic (197 ± 19 M ;
n = 6) cells.

View larger version (33K):
[in this window]
[in a new window]
|
Figure 1.
Electrophysiological properties of dopaminergic
neurons and their response to orexins. A, Double
stainings of biocytin-filled neuron (red) and
TH-immunoreactive neurons (green).
Arrows indicate the position of the neuron in the
tissue. This biocytin-filled neuron is TH positive. Scale bar, 50 µm.
B, Voltage responses to current pulses ( 0.4, 0, +0.1
pA). C, Chart recording of membrane potential and
spontaneous action potentials before and after application of orexin A
(100 nM). Orexin A was applied for 2 min. D,
Orexin B (100 nM) caused depolarization in the presence of
tetrodotoxin (0.5 µM). E, Example of a
TH-positive neuron in which application of orexin B (100 nM) caused burst firing. F, A typical
orexin-mediated burst.
|
|

View larger version (65K):
[in this window]
[in a new window]
|
Figure 2.
Presumed GABAergic neurons with high spontaneous
firing rate are excited by orexins. A, Double stainings
of biocytin-filled neuron (red) and TH-immunoreactive
neurons (green). This neuron is TH negative.
Arrows indicate the position of the neuron.
B, Voltage responses to current pulses ( 0.3, 0, +0.1
pA). C, Chart recording of membrane potential and
spontaneous action potentials of the neuron before and after
application of orexin B (100 nM). D, Chart
recording of the membrane potential of the neuron after application of
0.5 µM TTX. Orexin A causes depolarization of the
cell.
|
|

View larger version (54K):
[in this window]
[in a new window]
|
Figure 3.
Presumed GABAergic neurons with low spontaneous
firing rate are excited by orexins. A, Double stainings
of biocytin-filled neuron (red) and TH-immunoreactive
neurons (green). This neuron is TH negative.
B, Voltage responses to current pulses ( 0.2, 0,+0.1
pA). C, Chart recording of membrane potential and
spontaneous action potentials before and after application of orexin A
(100 nM).
|
|
The same groups of cells were found in extracellular single-unit
recordings: presumed dopaminergic neurons fired at lower frequencies
(2.23 ± 0.40 Hz; n = 25), had broader action
potentials (>2 msec), and were inhibited by the
D2 receptor agonist quinpirole (10 µM) or dopamine (30 µM). Presumed fast-firing GABAergic neurons generally fired at higher frequencies (7.31 ± 1.35Hz), had
briefer action potentials (<1.5 msec), and were unaffected by
quinpirole and their firing rate was reduced by DAMGO (1 µM) to 44.4 ± 6.4% of baseline
(n = 10). The third group of cells fired much more slowly (0.89 ± 0.33 Hz; n = 6), had the same
action potential duration as fast-firing GABAergic cells, and was
inhibited by DAMGO (39.4 ± 9.2%) but was unaffected by
quinpirole (10 µM) or dopamine (30 µM).
Responses to orexins in dopaminergic cells
Three groups of dopaminergic cells in the VTA could be
distinguished according to their response to orexin A. In 10 dopaminergic neurons tested extracellularly and four whole-cell
recordings from dopaminergic neurons, there was no effect of orexin A
(100 nM) on the firing rate or membrane potential. The
application of higher concentrations of orexin A (500 nM,
n = 6; 1 µM, n = 5) also did not influence the firing of these cells. In another group
of dopamine neurons, orexin A produced an increase in firing up to
208 ± 35% of baseline rate in extracellular recordings
(n = 8). The generation of a concentration-response
curve revealed that the EC50 for
orexin-responsive neurons in the VTA was 78 nM
(at least four neurons were tested at 10, 50, 100, 500, and 1000 nM). In whole-cell recordings, increases in
firing were accompanied by a moderate depolarization (4 ± 0.8 mV;
n = 5) (Fig. 1C). In this group of cells,
orexin B caused a similar increase in firing rate (205 ± 43%;
n = 4) and amount of depolarization in responsive cells. Two cells recorded extracellularly and one recorded in current-clamp, which had previously responded to orexin A, did not
respond to orexin B. The previous application of the voltage-gated sodium channel blocker tetrodotoxin (0.5 µM)
did not prevent the depolarization caused by orexin A
(n = 4) or orexin B (n = 3) (Fig.
1D).
In the last group of dopaminergic cells, after application of orexin A,
the regular firing pattern was changed to an oscillatory one whereby
periods of higher-frequency firing (1.3-8 Hz, 5-30 sec) alternated
with silent periods (1-5 sec). In extracellular recordings, 7 of 25 cells tested responded in this manner to orexin A (100 nM).
Orexin B was also able to elicit this kind of response (n = 4). Five cells recorded in current clamp
demonstrated an oscillatory response to orexin B (100 nM). In three of these five cells, strong
depolarizations (7 ± 0.6 mV) accompanied by bursts (three to six)
of action potentials were interrupted by periods of relative
hyperpolarization when the cell did not fire (Fig. 1E,F). In one cell, silent
periods occurred during periods of depolarization. In the final cell,
silent periods did not occur, but the firing rate changed periodically
from a lower rate (0.5 Hz) to a higher rate (4 Hz). All of these
effects were reproduced by application of orexin B (100 nM). This last group of dopaminergic cells
(showing oscillatory firing) differed from the other dopaminergic neurons in one respect only: it had a smaller
IAHP (AHP amplitude was 12.8 ± 1.9 vs 17.6 ± 0.8 mV; p < 0.005).
Responses to orexins in GABAergic cells
Both groups of presumed GABAergic cells were excited by orexins.
In extracellular recordings, application of orexin A (100 nM) to the fast firing cells caused an increase in the
firing frequency to 154 ± 21% of baseline (n = 10). Orexin B (100 nM) also increased the firing
of these cells (n = 5). In whole-cell patch-clamp
recordings, the application of orexins caused a depolarization of
3.7 ± 0.3 mV (n = 3) (Fig. 2C). A
similar amount of depolarization was seen in the presence of TTX
(n = 3) (Fig. 2D).
In extracellular recordings from the slow-firing GABAergic cells,
application of orexin A (100 nM) caused a very large
increase in firing rate to 700 ± 171% of baseline
(n = 6) (Fig. 3C). Orexin B increased the
firing rate to 570 ± 113% of baseline (n = 3; not significantly different from orexin A). After washout of orexins and stabilization of the firing rate, the frequency of firing was still
higher than before application of orexins and did not return to the
baseline level during 1 hr of washout. In intracellular recordings,
orexin A caused a depolarization of 5.0 ± 1.6 mV
(n = 4). The depolarization was not blocked by
tetrodotoxin (0.5 µM; n = 3).
Responses to melanin-concentrating hormone
MCH is a neuropeptide that is also expressed exclusively in the
perifornical hypothalamic area and stimulates feeding (Qu et al.,
1996 ). In extracellular recordings, the application of melanin-concentrating hormone (1 µM) failed to affect the
firing of dopaminergic (n = 7) or fast-firing GABAergic
(n = 6) cells.
Single-cell RT-PCR from acutely isolated cells
The cytoplasm was extracted from 39 acutely isolated VTA neurons,
and single-cell PCR was performed for TH, GAD, orexin receptors (OX1 and OX2), CB, and NPY
mRNA (Table 1). Recently, it has been demonstrated in mice that different functional groups of TH-positive neurons can be discriminated in the VTA according to the expression of
calbindin (Neuhoff et al., 2002 ). Interestingly, we found that calbindin was only expressed in cells that express at least one subtype
of orexin receptor and was never expressed in TH-positive cells, which
were also positive for GAD (Table 1). It was expressed in 52.4% (11 of
21) of TH-positive cells and 55.6% (five of nine) of TH-negative cells
that expressed orexin receptors and was never detected in cells that
lacked orexin receptors. In contrast, there was no correlation between
the expression of NPY and orexin receptors. CB+/TH+-positive
cells had a soma size of 20.3 ± 0.3 µm (n = 11), which was significantly smaller than for
CB /TH+-negative
cells (23.9 ± 1.2 µm; n = 15; p < 0.05). In TH-negative cells, there was no correlation between the
expression of CB and soma size, but TH-negative neurons that expressed
at least one type of orexin receptors were smaller (14.8 ± 1.1 µm) than TH-negative cells that did not express orexin receptors
(19.5 ± 1.0 µm; p < 0.02).
 |
Discussion |
We show here using extracellular and whole-cell patch-clamp
recording techniques that orexins excite the majority of neurons in the
ventral tegmental area of the rat. Whereas GABAergic cells were
uniformly excited, dopaminergic cells showed a variety of responses.
One group of cells was unaffected by orexins, similar to our findings
with dopaminergic neurons in the substantia nigra (Korotkova et al.,
2002 ). A second group of cells showed a large increase in firing
frequency that was associated with a depolarization. The depolarizing
effect of orexins was not blocked by the voltage-gated sodium channel
blocker tetrodotoxin and so is likely to represent a direct effect on
the recorded neurons. The third group of dopaminergic cells that we
encountered had their firing pattern changed by the application of
orexins to periods with increased firing separated by silent periods.
In whole-cell current-clamp recordings, silent periods were associated
with either hyperpolarizations or large depolarizations leading to
inactivation of voltage-gated sodium channels. In several cells burst
firing was observed; burst firing is commonly observed in
vivo and is associated with the unexpected appearance of rewards
or stimuli-predicting reward (Schultz, 1998 ). In vitro, a
burst-like pattern, somewhat different from "natural" bursts, can
be elicited by application of nickel, alone or in combination with
apamin, which blocks a slow afterhyperpolarization (Wolfart and Roeper,
2002 ), or by NMDA together with apamin (Seutin et al., 1993 ). In that
regard, it is interesting that those cells that later showed
oscillatory responses to orexins had a significantly reduced AHP in
contrast to other dopaminergic cells. Similar to our findings in the
substantia nigra (Korotkova et al., 2002 ), GABAergic neurons in the VTA
were strongly excited by orexins. The depolarization of these cells
persisted in the presence of tetrodotoxin, indicating that this was
also a direct effect.
In single-cell PCR experiments, we found that both orexin receptors
were expressed in VTA cells. Many cells contained only the
OX1 receptor, which is consistent with our
finding that occasional cells responded to orexin A but not to orexin B
in slice experiments. CB was expressed in half of VTA cells that
expressed orexin receptors but was never detected in cells that lacked
orexin receptors. In mice, the
TH+/CB+ cells
had smaller afterhyperpolarizations than
TH+/CB VTA
neurons (Neuhoff et al., 2002 ), so this group of cells may correspond
to the cells in which we found oscillatory responses to orexins. A
subpopulation of TH+ cells was also
positive for GAD65; recently, the existence of such a group of cells
has been demonstrated using anatomical techniques (Carr and Sesack,
2000 ; Gonzalez-Hernandez et al., 2001 ). They are likely to be excited
by orexins, because we showed that they express orexin receptors.
Dopaminergic and GABAergic neurons in the VTA were excited by orexin A
and orexin B and possess both types of orexin receptors, suggesting
that they play a role in both the arousal-narcolepsy and feeding
aspects of the function of orexins. Cataplexy is elicited in
narcoleptics by emotional arousal (Nishino and Mignot, 1997 ). In
narcoleptic dogs, which have a dysfunctional orexin type II receptor,
the most commonly used assay for cataplexy is the food-elicited cataplexy test (Nishino and Mignot, 1997 ). Given the role played by VTA
dopamine neurons in response to primary rewards such as food,
dysfunction of the orexin regulation of dopamine neurons is likely to
be an important component of the triggering mechanism for cataplexy
(Reid et al., 1996 ; Okura et al., 2000 ). In normal individuals, the
orexin modulation of VTA neurons may be important in transmitting
information about the availability of primary rewards to the
mesocorticolimbic reward system (Schultz, 1998 ). A subpopulation of
orexin neurons possess leptin receptors (Willie et al., 2001 ), and
leptin administration is known to modulate the rewarding effect of
lateral hypothalamic stimulation (Fulton et al., 2000 ). Furthermore,
orexin neurons are sensitive to metabolic state, receiving input from
glucose-sensitive neurons (Liu et al., 2001 ). One model of the role of
the orexin modulation of VTA neurons could be as follows: lack of
adequate metabolic substrate would lead to increased activity in orexin
neurons, excitation of dopaminergic and GABAergic neurons in the VTA,
leading to increased arousal, locomotor activity, and a search for food.
 |
FOOTNOTES |
Received Aug. 27, 2002; revised Oct. 11, 2002; accepted Oct. 16, 2002.
This work was supported by a grant from the Medical Faculty of the
Heinrich-Heine University (R.E.B). We thank Dr. Robert McCarley, Dr.
Mahesh Thakkar, and Dr. Radhika Basheer for helpful comments on this
manuscript and Claudia Wittrock and Annette Scherer for excellent
technical assistance.
Correspondence should be addressed to Tatiana Korotkova, Institut
für Neurophysiologie, Heinrich-Heine-Universität,
Universitätsstrasse 1, D-40001, Düsseldorf, Germany.
E-mail: tatiana.korotkova{at}uni-duesseldorf.de.
R. E. Brown's present address: Department of Psychiatry, Harvard
Medical School and Veterans Affairs Medical Center, 940 Belmont Street,
Research 151-C, Brockton, MA 02301.
 |
References |
-
Albanese A,
Minciacchi D
(1983)
Organization of the ascending projections from the ventral tegmental area: a multiple fluorescent retrograde tracer study in the rat.
J Comp Neurol
216:406-420[Web of Science][Medline].
-
Carr DB,
Sesack SR
(2000)
GABA-containing neurons in the rat ventral tegmental area project to the prefrontal cortex.
Synapse
38:114-123[Web of Science][Medline].
-
Cauli B,
Audinat E,
Lambolez B,
Angulo MC,
Ropert N,
Tsuzuki K,
Hestrin S,
Rossier J
(1997)
Molecular and physiological diversity of cortical nonpyramidal cells.
J Neurosci
17:3894-3906[Abstract/Free Full Text].
-
Eriksson KS,
Sergeeva O,
Brown RE,
Haas HL
(2001)
Orexin/hypocretin excites the histaminergic neurons of the tuberomammillary nucleus.
J Neurosci
21:9273-9279[Abstract/Free Full Text].
-
Fadel J,
Deutch AY
(2002)
Anatomical substrates of orexin-dopamine interactions: lateral hypothalamic projections to the ventral tegmental area.
Neuroscience
111:379-387[Web of Science][Medline].
-
Fulton S,
Woodside B,
Shizgal P
(2000)
Modulation of brain reward circuitry by leptin.
Science
287:125-128[Abstract/Free Full Text].
-
Gonzalez-Hernandez T,
Barroso-Chinea P,
Acevedo A,
Salido E,
Rodriguez M
(2001)
Colocalization of tyrosine hydroxylase and GAD65 mRNA in mesostriatal neurons.
Eur J Neurosci
13:57-67[Medline].
-
Grace AA,
Onn SP
(1989)
Morphology and electrophysiological properties of immunocytochemically identified rat dopamine neurons recorded in vitro.
J Neurosci
9:3463-3481[Abstract].
-
Korotkova TM,
Pak MA,
Eriksson KS,
Haas HL,
Brown RE
(2001)
Orexins increase the firing rate of GABAergic neurons in the substantia nigra (SN) pars reticulata and ventral tegmental area (VTA) of the rat.
Soc Neurosci Abstr
27:411.8.
-
Korotkova TM,
Eriksson KS,
Haas HL,
Brown RE
(2002)
Selective excitation of GABAergic neurons in the substantia nigra of the rat by orexin/hypocretin in vitro.
Regul Pept
104:83-89[Web of Science][Medline].
-
Liu XH,
Morris R,
Spiller D,
White M,
Williams G
(2001)
Orexin A preferentially excites glucose-sensitive neurons in the lateral hypothalamus of the rat in vitro.
Diabetes
50:2431-2437[Abstract/Free Full Text].
-
Nakamura T,
Uramura K,
Nambu T,
Yada T,
Goto K,
Yanagisawa M,
Sakurai T
(2000)
Orexin-induced hyperlocomotion and stereotypy are mediated by the dopaminergic system.
Brain Res
873:181-187[Web of Science][Medline].
-
Neuhoff H,
Neu A,
Liss B,
Roeper J
(2002)
I(h) channels contribute to the different functional properties of identified dopaminergic subpopulations in the midbrain.
J Neurosci
22:1290-1302[Abstract/Free Full Text].
-
Nishino S,
Mignot E
(1997)
Pharmacological aspects of human and canine narcolepsy.
Prog Neurobiol
52:27-78[Web of Science][Medline].
-
Okura M,
Riehl J,
Mignot E,
Nishino S
(2000)
Sulpiride, a D2/D3 blocker, reduces cataplexy but not REM sleep in canine narcolepsy.
Neuropsychopharmacology
23:528-538[Medline].
-
Qu D,
Ludwig DS,
Gammeltoft S,
Piper M,
Pellymounter MA,
Cullen MJ,
Mathes WF,
Przpek R,
Kanarek R,
Maratos-Flier E
(1996)
A role for melanin-concentrating hormone in the central regulation of feeding behaviour.
Nature
380:243-247[Medline].
-
Reid MS,
Tafti M,
Nishino S,
Sampathkumaran R,
Siegel JM,
Mignot E
(1996)
Local administration of dopaminergic drugs into the ventral tegmental area modulates cataplexy in the narcoleptic canine.
Brain Res
733:83-100[Medline].
-
Schultz W
(1998)
Predictive reward signal of dopamine neurons.
J Neurophysiol
80:1-27[Abstract/Free Full Text].
-
Seutin V,
Johnson SW,
North RA
(1993)
Apamin increases NMDA-induced burst-firing of rat mesencephalic dopamine neurons.
Brain Res
630:341-344[Web of Science][Medline].
-
Steffensen SC,
Svingos AL,
Pickel VM,
Henriksen SJ
(1998)
Electrophysiological characterization of GABAergic neurons in the ventral tegmental area.
J Neurosci
18:8003-8015[Abstract/Free Full Text].
-
Vorobjev VS,
Sharonova IN,
Haas HL,
Sergeeva OA
(2000)
Differential modulation of AMPA receptors by cyclothiazide in two types of striatal neurons.
Eur J Neurosci
12:2871-2880[Web of Science][Medline].
-
Willie JT,
Chemelli RM,
Sinton CM,
Yanagisawa M
(2001)
To eat or to sleep? orexin in the regulation of feeding and wakefulness.
Annu Rev Neurosci
24:429-458[Web of Science][Medline].
-
Wise RA,
Rompre PP
(1989)
Brain dopamine and reward.
Annu Rev Psychol
40:191-225[Web of Science][Medline].
-
Wisor JP,
Nishino S,
Sora I,
Uhl GH,
Mignot E,
Edgar DM
(2001)
Dopaminergic role in stimulant-induced wakefulness.
J Neurosci
21:1787-1794[Abstract/Free Full Text].
-
Wolfart J,
Roeper J
(2002)
Selective coupling of T-type calcium channels to SK potassium channels prevents intrinsic bursting in dopaminergic midbrain neurons.
J Neurosci
22:3404-3413[Abstract/Free Full Text].
Copyright © 2003 Society for Neuroscience 0270-6474/03/2317-05$05.00/0
This article has been cited by other articles:

|
 |

|
 |
 
S. L. Borgland, S.-J. Chang, M. S. Bowers, J. L. Thompson, N. Vittoz, S. B. Floresco, J. Chou, B. T. Chen, and A. Bonci
Orexin A/Hypocretin-1 Selectively Promotes Motivation for Positive Reinforcers
J. Neurosci.,
September 9, 2009;
29(36):
11215 - 11225.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
P. Malherbe, E. Borroni, E. Pinard, J. G. Wettstein, and F. Knoflach
Biochemical and Electrophysiological Characterization of Almorexant, a Dual Orexin 1 Receptor (OX1)/Orexin 2 Receptor (OX2) Antagonist: Comparison with Selective OX1 and OX2 Antagonists
Mol. Pharmacol.,
September 1, 2009;
76(3):
618 - 631.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
N. Tsujino and T. Sakurai
Orexin/Hypocretin: A Neuropeptide at the Interface of Sleep, Energy Homeostasis, and Reward System
Pharmacol. Rev.,
June 1, 2009;
61(2):
162 - 176.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. T. C. Brown, P. Henny, J. P. Bolam, and P. J. Magill
Activity of Neurochemically Heterogeneous Dopaminergic Neurons in the Substantia Nigra during Spontaneous and Driven Changes in Brain State
J. Neurosci.,
March 4, 2009;
29(9):
2915 - 2925.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
Z. M. Khaliq and B. P. Bean
Dynamic, Nonlinear Feedback Regulation of Slow Pacemaking by A-Type Potassium Current in Ventral Tegmental Area Neurons
J. Neurosci.,
October 22, 2008;
28(43):
10905 - 10917.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
K. A. Kohlmeier, S. Watanabe, C. J. Tyler, S. Burlet, and C. S. Leonard
Dual Orexin Actions on Dorsal Raphe and Laterodorsal Tegmentum Neurons: Noisy Cation Current Activation and Selective Enhancement of Ca2+ Transients Mediated by L-Type Calcium Channels
J Neurophysiol,
October 1, 2008;
100(4):
2265 - 2281.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
E. B. Margolis, J. M. Mitchell, J. Ishikawa, G. O. Hjelmstad, and H. L. Fields
Midbrain Dopamine Neurons: Projection Target Determines Action Potential Duration and Dopamine D2 Receptor Inhibition
J. Neurosci.,
September 3, 2008;
28(36):
8908 - 8913.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
H. L. Haas, O. A. Sergeeva, and O. Selbach
Histamine in the Nervous System
Physiol Rev,
July 1, 2008;
88(3):
1183 - 1241.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
K. Rasmussen, M.-A. Hsu, S. Noone, B. G. Johnson, L. K. Thompson, and S. K. Hemrick-Luecke
The Orexin-1 Antagonist SB-334867 Blocks Antipsychotic Treatment Emergent Catalepsy: Implications for the Treatment of Extrapyramidal Symptoms
Schizophr Bull,
November 1, 2007;
33(6):
1291 - 1297.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
H. Zheng, L. M. Patterson, and H.-R. Berthoud
Orexin Signaling in the Ventral Tegmental Area Is Required for High-Fat Appetite Induced by Opioid Stimulation of the Nucleus Accumbens
J. Neurosci.,
October 10, 2007;
27(41):
11075 - 11082.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. W. Muschamp, J. M. Dominguez, S. M. Sato, R.-Y. Shen, and E. M. Hull
A Role for Hypocretin (Orexin) in Male Sexual Behavior
J. Neurosci.,
March 14, 2007;
27(11):
2837 - 2845.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
E. B. Margolis, H. Lock, G. O. Hjelmstad, and H. L. Fields
The ventral tegmental area revisited: is there an electrophysiological marker for dopaminergic neurons?
J. Physiol.,
December 15, 2006;
577(3):
907 - 924.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
P. Pissios, R. L. Bradley, and E. Maratos-Flier
Expanding the Scales: The Multiple Roles of MCH in Regulating Energy Balance and Other Biological Functions
Endocr. Rev.,
October 1, 2006;
27(6):
606 - 620.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C. O. Alberto, R. B. Trask, M. E. Quinlan, and M. Hirasawa
Bidirectional Dopaminergic Modulation of Excitatory Synaptic Transmission in Orexin Neurons
J. Neurosci.,
September 27, 2006;
26(39):
10043 - 10050.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. Koyama and S. B. Appel
A-type K+ Current of Dopamine and GABA Neurons in the Ventral Tegmental Area
J Neurophysiol,
August 1, 2006;
96(2):
544 - 554.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. Narita, Y. Nagumo, S. Hashimoto, M. Narita, J. Khotib, M. Miyatake, T. Sakurai, M. Yanagisawa, T. Nakamachi, S. Shioda, et al.
Direct Involvement of Orexinergic Systems in the Activation of the Mesolimbic Dopamine Pathway and Related Behaviors Induced by Morphine
J. Neurosci.,
January 11, 2006;
26(2):
398 - 405.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
B. Boutrel, P. J. Kenny, S. E. Specio, R. Martin-Fardon, A. Markou, G. F. Koob, and L. de Lecea
Role for hypocretin in mediating stress-induced reinstatement of cocaine-seeking behavior
PNAS,
December 27, 2005;
102(52):
19168 - 19173.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
K. Takakusaki, K. Takahashi, K. Saitoh, H. Harada, T. Okumura, Y. Kayama, and Y. Koyama
Orexinergic projections to the cat midbrain mediate alternation of emotional behavioural states from locomotion to cataplexy
J. Physiol.,
November 1, 2005;
568(3):
1003 - 1020.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
L. Zhang, Y. Liu, and X. Chen
Carbachol induces burst firing of dopamine cells in the ventral tegmental area by promoting calcium entry through L-type channels in the rat
J. Physiol.,
October 15, 2005;
568(2):
469 - 481.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. B. Hardy, J. Aioun, C. Baly, K. A. Julliard, M. Caillol, R. Salesse, and P. Duchamp-Viret
Orexin A Modulates Mitral Cell Activity in the Rat Olfactory Bulb: Patch-Clamp Study on Slices and Immunocytochemical Localization of Orexin Receptors
Endocrinology,
September 1, 2005;
146(9):
4042 - 4053.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
E. Hurliman, J. C. Nagode, and J. V. Pardo
Double Dissociation of Exteroceptive and Interoceptive Feedback Systems in the Orbital and Ventromedial Prefrontal Cortex of Humans
J. Neurosci.,
May 4, 2005;
25(18):
4641 - 4648.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
D. G. Smith, E. T. Tzavara, J. Shaw, S. Luecke, M. Wade, R. Davis, C. Salhoff, G. G. Nomikos, and D. R. Gehlert
Mesolimbic Dopamine Super-Sensitivity in Melanin-Concentrating Hormone-1 Receptor-Deficient Mice
J. Neurosci.,
January 26, 2005;
25(4):
914 - 922.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
Y. Li and A. N. van den Pol
Direct and Indirect Inhibition by Catecholamines of Hypocretin/Orexin Neurons
J. Neurosci.,
January 5, 2005;
25(1):
173 - 183.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
D. B. Rye
The two faces of Eve: Dopamine's modulation of wakefulness and sleep
Neurology,
October 26, 2004;
63(8_suppl_3):
S2 - S7.
[Abstract]
[Full Text]
|
 |
|

|
 |

|
 |
 
M. Wu, L. Zaborszky, T. Hajszan, A. N. van den Pol, and M. Alreja
Hypocretin/Orexin Innervation and Excitation of Identified Septohippocampal Cholinergic Neurons
J. Neurosci.,
April 7, 2004;
24(14):
3527 - 3536.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. Kaslin, J. M. Nystedt, M. Ostergard, N. Peitsaro, and P. Panula
The Orexin/Hypocretin System in Zebrafish Is Connected to the Aminergic and Cholinergic Systems
J. Neurosci.,
March 17, 2004;
24(11):
2678 - 2689.
[Abstract]
[Full Text]
[PDF]
|
 |
|
|

|