The Journal of Neuroscience, June 1, 2003, 23(11):4519-4526
Previous Article | Next Article 
Inducible cAMP Early Repressor, an Endogenous Antagonist of cAMP Responsive Element-Binding Protein, Evokes Neuronal Apoptosis In Vitro
Jacek Jaworski,1 *
Barbara Mioduszewska,1,3 *
Amelia Sánchez-Capelo,2
Izabela Figiel,1
Agata Habas,4,5
Agata Gozdz,4,5
Tomasz Proszynski,1
Michal Hetman,1,4,5
Jacques Mallet,2 and
Leszek Kaczmarek1
1 Department of Molecular and Cellular Neurobiology, Nencki Institute, Warsaw
02-093, Poland,
2 Laboratoire de Genetique Moleculaire de la Neurotransmission et des Processus
Neurodegeneratifs, Unité Mixte de Recherche 9923, Centre National de la
Recherche Scientifique, Paris 75013, France,
3 Warsaw Agriculture University, Veterinary School, Warsaw 02-787, Poland,
4 Kentucky Spinal Cord Injury Research Center and Department of Neurological
Surgery, University of Louisville, Louisville, Kentucky 40292, and
5 Laboratory of Neuropathology, International Institute of Molecular and
Cellular Biology, Warsaw 02-109, Poland
 |
Abstract
|
|---|
Active CREB (cAMP responsive element-binding protein) transcription factor
is crucial for neuronal survival. Several members of the CREM/ICER (cAMP
responsive element modulator/inducible cAMP early repressor) protein family
may act as endogenous CREB antagonists. However, their involvement in a
process of programmed cell death remains unexplored. Here we report that ICER
may play such a role in neuronal apoptosis because it is upregulated in
apoptotic neurons in vitro, and overexpression of ICER, delivered in
adenoviral vector, evokes programmed cell death of three different kinds of
cultured neurons, namely those derived from hippocampal dentate gyrus,
cerebral cortex, and superior cervical ganglion. Reporter gene assay with a
promoter containing a CREB-responsive sequence revealed a decrease in both
basal and induced CRE-dependent gene expression in neurons overexpressing
ICER. Finally, the level of expression of the anti-apoptotic protein Bcl-2, a
well known CREB target, was markedly diminished in ICER-treated neurons. We
suggest that the naturally occurring CREB functional antagonist ICER may have
a specific function in programmed cell death of neurons, probably by silencing
the expression of anti-apoptotic genes.
Key words: ICER; CREB; neuronal apoptosis; gene expression; Bcl-2; adenoviral vectors
 |
Introduction
|
|---|
ICER (inducible cAMP early repressor) is a collective name for a group of
proteins produced from the CREM/ICER gene by use of an internal promoter
within an intron of the CREM (cAMP responsive element modulator) gene
(Molina et al., 1993
;
Stehle et al., 1993
). It was
first described as the major CREM transcript in the pineal gland during
daynight fluctuations of CREM expression
(Stehle et al., 1993
). The
ICER, which contains only a DNA-binding domain, functions as a repressor of
transcription of several CRE (cAMP responsive regulatory element)-containing
genes (Molina et al., 1993
;
Stehle et al., 1993
;
Tinti et al., 1996
;
Lamas et al., 1997
). Studies
on pineal gland showed ICER to serve as a negative regulator of
cAMP-dependent, phospho-CREB (cAMP regulatory element-binding protein)-driven
expression of genes involved in circadian rhythm
(Maronde et al., 1999
;
Pfeffer et al., 2000
). Induced
expression of ICER was also reported in several other physiological conditions
(for review, see Stehle et al.,
2001
). All of these findings suggest that ICER is involved in
mechanisms responsible for returning stimulated cells to the steady-state
level (Stehle et al., 2001
).
However, increased levels of ICER mRNA were also observed in the cortex and
the hippocampus after treatment with kainate, NMDA, and dizocilpine maleate
(MK-801) (Nedivi et al., 1993
;
Konopka et al., 1998
;
Storvik et al., 2000
) at doses
that provoke neuronal apoptosis
(Filipkowski et al., 1994
;
Hetman et al., 1997
),
suggesting that it might be worthwhile to consider a possible role for ICER in
neuronal cell death, in addition to its putative physiological functions
(Stehle et al., 1993
;
Konopka et al., 1998
).
A pro-apoptotic role of ICER in neurons could be of special importance,
especially because CREB appears to have antiapoptotic activity in cultured
neurons deprived of trophic support (Bonni
et al., 1999
; Riccio et al.,
1999
). Moreover, studies on CREB null mutant embryos showed that
CREB is necessary for the survival of peripheral neurons at the time of their
neurotrophin dependency (Lonze et al.,
2002
). Furthermore, recent findings link decreased CREB activity
to neurotoxicity and neurodegeneration (for review, see
Dawson and Ginty, 2002
).
However, our knowledge about CREB downstream effectors as well as interactions
between CREB/ATF (activating transcription factor)/CREM proteins during
apoptosis still remains very limited
(Walton and Dragunow, 2000
;
Lonze et al., 2002
).
Because no functional data on ICER and neuronal apoptosis have been
reported, in this study we tested directly whether ICER may be involved in
neuronal cell death in culture. We found that indeed adenovirally delivered
ICER produces neuronal apoptosis in three different culture models.
Furthermore, L-glutamate-evoked apoptosis of dentate gyrus (DG)
neurons and serum deprivation-induced death of cortical neurons are both
accompanied by increased ICER expression. Moreover, ICER inhibited
CRE-dependent transcription along with diminishing levels of Bcl-2. Thus, our
results suggest that ICER, a natural CREB antagonist, may have a specific
function in programmed cell death of neurons, perhaps by silencing expression
of CRE-dependent genes, including anti-apoptotic ones
(Mayr and Montminy, 2001
) that
are crucial for proper metabolism of the neuronal cell.
 |
Materials and Methods
|
|---|
Adenoviral vectors. Recombinant adenoviruses were constructed by
homologous recombination of pRSV-ICER plasmid (containing the ICER
II
cDNA; kindly provided by Dr. P. Sassone-Corsi, Institut de Genetique
et de Biologie Moleculaire et Cellulaire, Illkirch-Strasbourg, France) and
adenoviral genomic DNA as described earlier
(Revah et al., 1996
). The
recombinant Ad-
-galactosidase (
gal) has been described previously
(Stratford-Perricaudet et al.,
1992
). Viral stocks were prepared according to the procedure
described by Revah et al.
(1996
). Viruses were titered
by the end-point dilution method
(Lowenstein et al., 1996
).
Other gene constructs either were previously described
(Impey et al., 1998
) or
commercially available.
Cell culture and adenoviral vector treatment. Primary cultures of
DG cells were obtained from 4-d-old Wistar rat pups as described previously
(Figiel and Kaczmarek, 1997
;
Jaworski et al., 2000
).
Cortical neurons were prepared from newborn Wistar rats
(Xia et al., 1996
;
Hetman et al., 1999
). Primary
cultures of superior cervical ganglion (SCG) neurons were obtained from
1-d-old Wistar rats (Le Gal La Salle et
al., 1993
).
All three types of neuronal cell cultures were exposed to adenoviral
vectors 34 d after plating. DG cells were incubated overnight with 50
pfu per cell [multiplicities of infection (MOI) 50] suspended in a culture
medium. The next day, the cultures were washed several times with DMEM (Sigma,
St. Louis, MO) and placed in a new culture medium. In case of cortical
cultures, culture medium was replaced with Basal Medium Eagle (BME;
BioWhittaker, Walkersville, MD) and saved. Adenoviral vectors (MOI, 100) were
added to the cultures for 1 hr. Afterward, virus-containing BME was removed,
and saved culture medium was added back to the infected cultures. SCG neurons
were infected exactly the same way as cortical neurons with the exception that
instead of BME, replacement culture medium was changed to L15CO2 medium
(Invitrogen Life Technologies, Carlsbad, CA). For quantification of apoptosis,
the cultures were fixed as follows: DG, 6 and 24 hr; cortical neurons, 24, 48,
and 72 hr; SCG cells, 24, 48, and 72 hr. For other applications the cells were
treated as indicated below.
Serum deprivation. Serum deprivation was performed with cortical
neurons at 6 d in vitro as described previously
(Hetman et al., 1999
).
Briefly, cells were washed twice with serum-free BME and incubated in
serum-free BME supplemented with 35 mM glucose, 1 mM
L-glutamine, 100 U/ml penicillin, 0.1 mg/ml streptomycin, and 2.5
mM cytosine arabinoside (all from Sigma) in the presence of the
NMDA receptor antagonist MK-801 (10 mM; Sigma). Control cells were
washed similarly and then incubated for matched time points in
serum-containing conditioned medium.
X-gal staining of cell cultures. Forty-eight hours after
infection, Ad-
gal-infected cell cultures were washed once with PBS and
fixed for 5 min in 1% formaldehyde, 0.2% glutaraldehyde in PBS. Then the cells
were incubated overnight at 37°C in 0.8 mg/ml X-gal, 4 mM
K3Fe(CN)6, 4 mM
K4Fe(CN)6, 4 mM MgCl2, 6
H2O in PBS (all from Sigma). After incubation, cultures were washed
several times with PBS.
Quantification of apoptosis by nuclear morphological changes. To
visualize nuclear morphology, cells were fixed in 4% paraformaldehyde and
stained with 2.5 mg/ml DNA dye Hoechst 33258 (bis-benzimide; Sigma). Apoptosis
was quantified by scoring the percentage of neurons (as revealed by staining
with NeuN antibody) with apoptotic nuclear morphology at the single-cell level
after Hoechst staining. Uniformly stained nuclei were scored as healthy,
viable neurons. Condensed or fragmented nuclei were scored as apoptotic.
Statistical analysis of the data were performed using the nonparametric
KruskalWallis ANOVA test.
DNA ladder assay and MTT assay. To examine DNA cleavage, 5 x
106 cortical neurons were plated in a 60 mm dish and infected with
Ad-
gal or Ad-ICER (MOI, 100). Seventy-two hours after infection, soluble
cytoplasmic DNA was isolated from each plate and loaded to 1.8% agarose gel
for DNA ladder analysis, as described
(Hetman et al., 1999
).
In cortical cultures, neuronal survival was assayed by measuring the
conversion of the yellow, water-soluble tetrazolium, MTT (Sigma) to the blue,
water-insoluble formazan at 24, 48, 72, and 96 hr after infection with either
Ad-
gal or Ad-ICER as described previously
(Hetman et al., 1999
). Optical
blanks, used as controls, were generated by incubating MTT with the
conditioned medium. The colorimetric reaction was evaluated
spectrophotometrically (A570).
Immunocytochemistry. Immunocytochemical staining was done as
described previously (Jaworski et al.,
2000
). The color reactions were developed using a diaminobenzidine
substrate kit (Vector Laboratories, Burlingame, CA). For fluorescence
immunocytochemistry, the primary antibody was visualized by incubating the
cultures with a biotinconjugated appropriate secondary IgG (Vector
Laboratories) diluted 1:500 and then with streptavidinFITC or
streptavidinTexas Red complex (Vector Laboratories) diluted 1:500.
Primary antibodies were as follows: monoclonal anti-MAP2 protein (Sigma)
diluted 1:400, monoclonal anti-NeuN (Chemicon, Temecula, CA) diluted 1:500,
and polyclonal ICER 1:20,000 (Molina et
al., 1993
).
RT-PCR analysis. For RT-PCR analysis, total RNA was isolated from
5 x 105 dentate gyrus cells or 5 x 106
cortical cells by use of TRI Reagent (Sigma). The remaining DNA was removed by
digestion with DNase I (Roche, Indianapolis, IN). Next, RNA was reverse
transcribed by use of Expand Reverse Transcriptase (Roche, Indianapolis, IN)
in presence of oligo-dT. The cDNA was then amplified by PCR with a set of
oligonucleotides designed to recognize either different isoforms of ICER cDNA
(5'ICER: 5'-ACA AGA CCA CTC TGT ATG CA-3'; 3'ICER:
5'-GGG AGA GCA AAT GCT TTT CA-3') or ICERII
produced from
adenoviral vector (5'UTRSV: 5'-ACC ATT CAC CAC ATT GGT
GT-3'; 3'ICER). The following temperature profile was applied for
both reactions: 94°C for 30 sec, 48°C for 30 sec, 72°C for 1 min,
followed by 15 min incubation at 72°C. Amplification of
glyceraldehyde-3-phosphate dehydrogenase (GAPDH) cDNA was used for
verification of the amount of template used for reaction (GAPDH3: 5'-AAC
TAC ATG GTC TAC ATG TT-3'; GAPDH4: 5'-GTG GTG CAG GAT GCA TTG
CT-3').
Electrophoretic mobility shift assay. For electrophoretic mobility
shift assay (EMSA), 107 cortical neurons were plated in a 100 mm
Petri dish. Seventy-two hours after infection with adenoviral vectors, nuclear
extracts were isolated and EMSA was done as described previously
(Kaminska et al., 1994
). A
double-stranded 32P-labeled oligonucleotide containing CRE sequence
(AGAGATTGCCTGACGTCAGAGAGCTAG) was used as a probe in the binding
reactions.
Western blot analysis. For immunoblot analysis, 5 x
106 cortical neurons were plated in a 60 mm Petri dish. Seventy-two
hours after infection with adenoviral vectors, total protein extracts were
isolated and separated by SDS-PAGE (12%). Next, the proteins were transferred
onto Hybond-ECL membrane (Amersham Biosciences, Piscataway, NJ) by semidry
electroblotting. Blots were then incubated overnight with 5% nonfat milk in
TBS-T (150 mM NaCl, 20 mM Tris, pH 7.4, 0.05% Tween 20)
at 4°C. For immunochemical detection, the membranes were incubated at
4°C overnight with the following antibodies: anti-CREM/ICER antibody
(Santa Cruz Biotechnology, Santa Cruz, CA; diluted 1:500), ICER
(Molina et al., 1993
) (diluted
1:1000), CREB (Cell Signaling Technology, Beverly, MA; diluted 1:1000),
phospho-CREB (Cell Signaling Technology; diluted 1:1000), GAPDH (Chemicon;
diluted 1:2000), or Bcl-2 (BD Transduction Laboratories, Palo Alto, CA;
diluted 1:500). The next day, the membranes were washed three times with TBS-T
and incubated with the appropriate secondary peroxidase-conjugated antibody
(Amersham Biosciences; diluted 1:500) in 5% nonfat milk in TBS-T for 1 hr.
After the next three washings, peroxidase was detected with ECL reagent
(Amersham Biosciences). For the statistical evaluation of the immunoblots,
they were scanned densitometrically, and data were expressed in arbitrary
units (AU). For evaluation of the phosphorylated (P)-CREB/CREB ratio, the data
in AU were compared for the Ad-ICER versus Ad-
-gal versus control
cultures and first nonparametric ANOVA differences among all the groups, and
then the MannWhitney nonparametric test was applied for all the pairs
of comparisons. No difference was found between Ad-
-gal and control
cultures. The statistics for the Ad-ICER and Ad-
-gal comparison are
shown in Figure 1.

View larger version (43K):
[in this window]
[in a new window]
|
Figure 1. Effect of ICER overexpression on CREB function. A, CRE-sequence
binding 72 hr after Ad-ICER infection of cortical neurons (electrophoretic
mobility shift assay; comp. indicates competition with nonlabeled CREB probe;
I, II, and III designate different complexes formed by neuronal nuclear
extracts proteins). B, Immunoblotting detection of P-CREB, CREB,
CREM, and ICER proteins in Ad- galversus Ad-ICER-infected cultures.
C, Quantitative analysis of effects of ICER overexpression on P-CREB
levels. The immunoblots such as those shown in B were scanned
densitometrically and analyzed in such a way that for each lane (n =
10; 5 independent culture experiments) the result of P-CREB expression was
divided by the level of CREB immunoreactivity and expressed in arbitrary units
(AU). Next, the data were statistically evaluated with nonparametric
KruskalWallis ANOVA, followed by MannWhitney U test.
The difference between P-CREB/CREB ratios in Ad-ICER-versus
Ad- -gal-treated cultures is significant atp=0.008(**).
D, Effects of ICER overexpression on firefly luciferase driven by a
CRE-containing promoter. Then eurons first were transiently transfected with
pCRE-Luc and pRL-TK by use of Lipofectamine2000 and next infected with either
Ad- gal or Ad-ICER. Then, either 10 µM for skolinor vehicle
(DMSO) was added to the transfected cells. After 24 hr, lysates from cells
were prepared, and luminescence of both firefly and Renilla
luciferases was measured with the aid of the Dual-Luciferase Reporter Assay.
Results are given as a ratio of luminescence of firefly to Renilla
luciferases measured in relative fluorescence units ± SD. E,
Immunoblotting detection of Bcl-2 and GAPDH proteins in Ad-ICER- and
Ad- gal-treated cortical neurons; the results of two of three independent
experiments are presented. B, C, E, Three days after the plating, the
cells were infected with control, -galactosidase-encoding
(Ad- gal), or ICER-encoding (Ad-ICER) adenoviral vector. Seventy-two
hours after infection, the cultures were harvested for protein extraction and
immunoblotting analysis.
|
|
Transient transfections and reporter gene assay. Cortical neurons,
cultured in 24-well dishes (5 x 105 cells per well) were
transiently transfected with pCRE-Luc and pRL-TK with the aid of
Lipofectamine2000 (Invitrogen Life Technologies, Carlsbad, CA) as described by
Ohki et al. (2001
) with
modifications. Briefly, 3 d after the plating, the cells were exposed to the
mixture of plasmid DNA and Lipofectamine2000 (0.6 µg of total DNA per well,
with DNA/Lipofectamine2000 ratio 1:2.5) for 2 hr in serum-free culture medium
(BME) supplemented with 35 mM glucose, 1 mM glutamine,
penicillin (100 U/ml), streptomycin (100 µg/ml) and infected immediately
afterward with either Ad-
gal or Ad-ICER. Afterward, the neurons were
returned to saved conditioned media and cultured for the next 48 hr before any
additional treatment. Next, 10 µM forskolin (Sigma) or vehicle
(DMSO) was added to the transfected cells. After next 24 hr, lysates from
cells were prepared in Passive Lysis Buffer (Promega, Madison, WI), and
luminescence of both firefly and Renilla luciferases in 10 µl of
cell lysate were measured by use of Dual-Luciferase Reporter Assay
(Promega).
 |
Results
|
|---|
Adenovirally delivered ICER inhibits CRE-dependent transcription
To study ICER function, we developed an adenoviral vector carrying the
ICERII
sequence controlled by the Rous sarcoma virus (RSV) constitutive
promoter Ad-ICER. To test whether this experimental tool inhibits CRE-driven
transcription in our experimental conditions, we first investigated with an
EMSA whether exogenous ICER can bind the CRE sequence. In nuclear extracts
prepared from control Ad-
gal-treated cortical neurons, only a slow
migrating complex was detected by EMSA
(Fig. 1A, I). This
band reflected specific binding of the CRE probe as it disappeared in
competition experiments with an unlabeled CRE probe
(Fig. 1A). On the
other hand, in nuclear extracts obtained from Ad-ICER-infected cultures, two
additional faster migrating complexes (II, III) were detected
(Fig. 1A). Such fast
migrating complexes were described previously as containing ICER proteins
(Lamas et al., 1997
;
Trocme et al., 2001
). No such
binding could be observed in material collected from Ad-
gal-infected
cultures (Fig. 1A). By
use of immunoblotting technique we did not observe any significant decrease in
the CREB or CREM protein levels (Fig.
1B). However, use of an antibody against the
phosphorylated form of CREB showed a decrease in its amount in Ad-ICER-treated
cultures (Fig.
1B,C).
Next, we checked whether exogenous ICER could inhibit both basal and
forskolin-induced CRE-promoter activity. Forskolin is a well known activator
of cAMP and thus also CREB function
(Gonzalez and Montminy, 1989
).
The cultures were transiently cotransfected with a plasmid containing firefly
luciferase gene under the control of CRE-sequence (pCRE-Luc) as well as
plasmid constitutively expressing Renilla luciferase (pRL-TK; for
standardization purpose) and next infected with either Ad-
gal or
Ad-ICER. Forty-eight hours after the transfectioninfection treatment,
the cultures were stimulated with 10 µM forskolin for the next
24 hr. The basal level (after vehicle treatment) of CRE-dependent luciferase
expression was decreased in Ad-ICER-infected cells almost twofold when
compared with Ad-
gal-treated cells
(Fig. 1D). Moreover,
the levels of CRE-driven reporter expression after for-skolin stimulation were
also decreased in ICER-overexpressing cells when compared with cultures
infected with control virus (Fig.
1D).
The finding that ICER overexpression resulted in a decrease of
CRE-dependent transcription suggested that specific CRE-driven gene(s) might
be affected by ICER in neuronal apoptosis. In this context, we studied the
expression of a known anti-apoptotic CREB target: Bcl-2
(Wilson et al., 1996
;
Riccio et al., 1999
). We found
that the level of Bcl-2 protein, as determined by the immunoblotting 72 hr
after infection, in ICER-overexpressing cultures dropped to 62.3 ± 2.5%
(n = 6 lines for each virus; three independent culture experiments)
of expression level in those treated with Ad-
gal
(Fig. 1 E). Thus, our
results show that ICER overexpression-evoked apoptosis correlates with an
inhibition of CRE-dependent transcription and with a decrease in the amount of
the anti-apoptotic protein Bcl-2.
Glutamate-evoked neuronal cell death is accompanied by ICER
expression
We have reported previously that high doses of glutamate evoked apoptotic
cell death of dentate gyrus neurons cultured in vitro
(Figiel and Kaczmarek, 1997
)
(Fig. 2A). To test the
possibility that ICER is related to neuronal cell death, we analyzed ICER mRNA
levels in these cultures and found an increase of its expression
(Fig. 2B) that peaked
at 4 hr after incubation with glutamate and was observed also at 24 hr. On the
other hand, glutamate did not change the mRNA level of a housekeeping gene,
GAPDH (Fig. 2B).

View larger version (44K):
[in this window]
[in a new window]
|
Figure 2. Glutamate-evoked neuronal cell death is accompanied by ICER mRNA
expression. A, Nuclear morphology of control dentate gyrus cultures
(top panel) and after 24 hr exposure to 0.5 mM glutamate (bottom
panel) visualized by Hoechst 33258 staining. Arrows indicate fragmented and
condensed nuclei. B, Level of ICERII mRNA isoform expression in
dentate gyrus cultures treated with 0.5 mM glutamate as verified by
RT-PCR. GAPDH mRNA analysis was performed to verify equal reaction and
loading.
|
|
ICER expression and apoptosis of the dentate gyrus hippocampal
neurons
The fact that a pro-apoptotic dose of glutamate caused an increase in
expression of ICER mRNA raised a question regarding whether overexpression of
ICER is sufficient to induce neuronal cell death. To test such a possibility
we used the adenoviral vector Ad-ICER. The ability of adenoviral vectors to
transfer genes into DG neurons in culture was verified by infection with
Ad-
gal (MOI, 50) (Fig.
3A). Next, the cultures were infected with Ad-ICER, and
expression of the transgene after 24 hr was confirmed by RT-PCR. The primers
were designed to recognize only the expression of ICER mRNA driven by the
adenoviral vector (Fig.
3B). ICER overexpression was accompanied by dramatic
changes in morphology of the cells 24 hr after infection
(Fig. 3D). In
contrast, cultures treated with Ad-
gal did not display any apparent
abnormalities (Fig.
3D). The nuclear morphology of neurons infected with
either Ad-
gal or Ad-ICER was compared after staining the cell nuclei
with Hoechst 33285 dye. Neuronal identity of the cells was revealed by
staining for a neuronal marker, NeuN. In noninfected or Ad-
gal-treated
cultures at 6 hr (data not shown) as well at 24 hr after infection, the
majority of the neurons displayed typical, healthy-looking chromatin structure
(Fig. 3C,D). On the
other hand, in Ad-ICER-infected cultures >50% of neurons had condensed
nuclei 24 hr after treatment (Fig.
3C,D). In contrast, 6 hr after Ad-ICER infection there
was no increase in the level of neuronal cell death in comparison with control
cultures (data not shown).

View larger version (105K):
[in this window]
[in a new window]
|
Figure 3. Apoptosis of dentate gyrus neurons induced by adenovirally delivered ICER
overexpression. A, -Galactosidase enzymatic activity in dentate
gyrus neurons (note brownish MAP2 immunostaining) infected with an adenoviral
vector encoding -galactosidase (Ad- gal; arrows). B,
RT-PCR analysis of expression of exogenous recombinant adenovirus-delivered
ICERII gene. RNA was isolated 24 hr after infection (with either
Ad- gal or the adenovirus-carrying ICERII gene Ad-ICER). The
primers were designed to recognize only the transgenes that were used:
Ad-ICER, cDNA from cultures treated with Ad-ICER was used for the reaction;
Ad- gal, cDNA from cultures treated with Ad- gal; pRSV-ICER,
pRSV-ICER plasmid DNA was used as a template for positive control of the
reaction. C, Quantitative analysis of neurons with altered chromatin
morphology after exposure to Ad-ICER. The cultures were exposed overnight to
either Ad- gal or Ad-ICER (MOI, 50, for both). Cells were fixed 24 hr
after infection and stained with Hoechst 33285 and an anti body against NeuN.
For each experimental variant, the cells were counted from 24 incidental
microscopic fields from four independent cultures grown on 10 mm glass
coverslips. Results are shown as an average percentage of neurons with changed
chromatin morphology per coverslip ± SEM; ***p < 0.001;
KruskalWallis ANOVA. D, Changes of neuronal morphology evoked
by Ad-ICER at 24 hr after the infection; arrows point to neuronal (as
indicated by the NeuN immunostaining) nuclei with condensed and fragmented
chromatin.
|
|
ICER expression and apoptosis of the cortical neurons
Dentate gyrus cultures consist of both glial and neuronal cells, and one
could reason that the observed Ad-ICER-evoked neuronal cell death might be
secondary to the ICER affecting the glia. To extend the observations to
predominantly neuronal cultures and to study the phenomenon at the biochemical
level, which requires more material than the amount available from the DG
cultures, in the following experiments we switched to more homogeneous and
abundant cultures of the cerebral cortex neurons. Importantly, it has been
reported previously that serum deprivation in the presence of the glutamate
receptor antagonist MK-801 evokes apoptotic cell death of cortical neurons
cultured in vitro (Hetman et al.,
1997
) (Fig.
4A). This pro-apoptotic stimulation increased in ICER
mRNA expression, evident at 1 hr after serum withdrawal and observed also at
24 hr (Fig. 4B,C). On
the other hand, serum deprivation/MK-801 treatment did not change the
expression of the mRNA level of a housekeeping gene, GAPDH
(Fig. 4B).

View larger version (51K):
[in this window]
[in a new window]
|
Figure 4. Serum deprivation-evoked neuronal cell death accompanied by ICER mRNA
expression. A, Nuclear morphology of control cortical cultures and
after 24 hr serum deprivation in the presence of 10 mM MK-801 was
visualized by Hoechst 33258 staining. Arrows indicate fragmented and condensed
nuclei. B, Levels of ICERII mRNA isoform expression in cortical
cultures treated with glutamate were verified by RT-PCR at 1, 3, 6, or 24 hr
after the infection. C, Levels of ICER mRNA expression as detected by
RT-PCR.
|
|
Adenoviral gene transfer of Ad-
gal (MOI, 100) resulted in expression
of the transgene in almost 80% of the cortical cells (data not shown).
ICERII
expression 72 hr after Ad-ICER infection of neurons was
documented by RT-PCR (data not shown). Similar to the experiments performed on
DG cultures, for the cell death studies the cultures were infected with either
Ad-
gal (MOI, 100) or Ad-ICER (MOI, 100). Seventy-two hours after
infection, when marked changes in neuronal morphology of Ad-ICER-treated cells
were observed under phase-contrast microscope, alterations in chromatin
structure were also verified by Hoechst staining. In noninfected cultures or
those treated with Ad-
gal, the percentage of dying neurons was very low
(Fig. 5A). In
contrast, up to 35% of Ad-ICER-infected neurons showed fragmentation and
condensation of chromatin (Fig.
5A). Triple staining with Hoechst 33285 and antibodies
against NeuN and ICER revealed dying neurons in Ad-ICER-treated cultures that
were overexpressing ICER protein (Fig.
5C). Furthermore, a soluble fraction of cytoplasmic DNA
isolated from cultures treated with Ad-ICER was found to contain material that
was cleaved into oligonucleosomal fragments (DNA laddering), which is one of
the hallmarks of apoptosis (Fig.
5B). The cytoplasmic fraction of DNA was absent from the
Ad-
gal-infected cultures as well as noninfected neurons
(Fig. 5B). To
determine cell viability, a colorimetric tetrazolium assay on the basis of
mitochondrial conversion of MTT was performed. A significant decrease of
neuronal viability in cortical cultures after infection with Ad-ICER was
confirmed 96 hr after infection with the MTT test (A570 = 0.283
± 0.03 SEM) when compared with Ad-
gal-treated cultures
(A570 = 0.111 ± 0.03 SEM; p < 0.05;
KruskalWallis ANOVA).

View larger version (63K):
[in this window]
[in a new window]
|
Figure 5. Apoptosis of cortical neurons after ICER overexpression. A,
Percentage of cortical apoptotic neurons at 72 hr after infection with
Ad-ICER; ***p < 0.001; KruskalWallis ANOVA. B, DNA
fragmentation into ladder-like pattern 72 hr after infection of cortical
neurons with either Ad- gal or Ad-ICER. Arrows indicate fragmented,
oligonucleosomal DNA. C, Changes in nuclei morphology (Hoechst 33258,
left panel) of neurons (NeuN, middle panel) overexpressing ICER (right panel)
after Ad-ICER infection of cortical cultures. Arrow points to ICER
overexpressing neuron with condensed and fragmented chromatin.
|
|
ICER-evoked neuronal apoptosis in cultures derived from superior
cervical ganglion
The experiments performed on cultures of DG and cerebral cortex showed that
overexpression of ICER in CNS neurons was sufficient to cause their apoptotic
death. To extend these observations to the neurons derived from the peripheral
nervous system, we investigated the effect of ICER on SCG cultures. These
cultures are homogenously neuronal and provide a well characterized model of
physiological apoptosis and CREB-dependent survival
(Riccio et al., 1999
).
Initially, we confirmed that SCG neurons could be efficiently infected with
Ad-
gal, the control recombinant adenovirus. Next, the SCG neurons were
treated either with ICER-encoding adenoviral vector (MOI, 100) or with control
recombinant adenovirus (Ad-
gal; MOI, 100) and fixed 6, 24, 48, and 72 hr
after infection. Condensation of chromatin was evident at 72 hr after
infection (36.2 ± 3.6% of neurons; p < 0.001;
KruskalWallis ANOVA), and to a lesser extent also at 48 hr, only in the
Ad-ICER-infected cultures. We did not observe any changes in nuclear
morphology of ICER-treated neurons at 6 and 24 hr or in cultures treated with
control virus or noninfected even after 72 hr (7.9 ± 1.3 and 5.5
± 1.1% of dying neurons, respectively).
 |
Discussion
|
|---|
The survival and programmed cell death (apoptosis) of neurons depend on the
activity of a number of genes, and therefore transcription factors controlling
gene expression play a key role in these events
(Dragunow and Preston, 1995
;
Herdegen et al., 1997
;
Pettmann and Henderson, 1998
;
Hughes et al., 1999
;
Sastry and Rao, 2000
;
Walton and Dragunow, 2000
;
Yuan and Yankner, 2000
;
Zagulska-Szymczak et al.,
2001
). CREB is one of the transcription factors that has already
been studied in the context of neuronal survival, physiological apoptosis, and
neurodegeneration (for review, see
Finkbeiner, 2000
;
Walton and Dragunow, 2000
).
Increased levels of its phosphorylated active form were observed in neurons
resistant to brain ischemia, whereas decrease of CREB phosphorylation was
observed in neurons vulnerable to this treatment
(Walton et al., 1996
;
Hu et al., 1999
;
Mabuchi et al., 2001
).
Furthermore, stimulation of extrasynaptic NMDA receptors, which leads to
excitotoxic cell death of hippocampal neurons, resulted in a decrease in CREB
phosphorylation, whereas synaptic stimulation increased the amount of
phospho-CREB and was able to prevent staurosporine-evoked apoptosis
(Hardingham et al., 2002
).
Additionally, CREB might be involved in protection against the adverse effects
of deafferentation (Zirpel et al.,
2000
). Furthermore, Riccio et al.
(1999
) demonstrated that
transcriptionally active CREB is necessary and sufficient for survival of
sympathetic neurons under both normal and NGF-withdrawal conditions. Recently,
Mantamadiotis et al. (2002
)
showed extensive apoptosis and progressive neurodegeneration in mouse brain in
conditional CREB knock-out on CREM -/- background. One of the pro-survival
targets for CREB seems to be bcl-2
(Riccio et al., 1999
;
Mabuchi et al., 2001
), which
was shown to be able to block apoptosis of the sympathetic neurons evoked by
neurotrophin starvation (Garcia et al.,
1992
).
In contrast to growing evidence of the significance of CREB for neuronal
survival, involvement of other CRE-binding proteins that belong to the
CREM/ICER family in making decisions about neuronal cell fate remains
essentially unexplored. In this report, we describe for the first time a
novel, pro-apoptotic function of the transcription factor ICER, an endogenous,
functional CREB antagonist. We show the increased levels of ICERII mRNA after
glutamate stimulation that leads to apoptotic death of dentate gyrus neurons
as well as under conditions of trophic deprivation of the cortical neurons
in vitro. We also provide evidence that infection of three different
types of neurons, namely dentate gyrus, cortical, and sympathetic neurons,
with recombinant adenovirus carrying ICERII
cDNA is capable of provoking
robust neuronal cell death. Morphological features, including nuclear
fragmentation, together with DNA-laddering, widely accepted methods for
visualizing apoptotic changes (Willingham,
1999
), have proven the apoptotic character of the neuronal cell
death evoked by ICER. We also provide evidence for the competence of exogenous
ICER to block CRE-dependent transcription both at the basal state and on
activation with forskolin. Additionally our studies on the phosphorylated,
i.e., possibly transcriptionally active form of CREB (P-CREB), revealed its
downregulation in cortical cultures treated with Ad-ICER. Finally, we show
that the level of Bcl-2 anti-apoptotic protein (Vaux et al.,
1988
,
1992
) that was previously
described to be regulated via CRE sequence
(Wilson et al., 1996
;
Riccio et al., 1999
) was
decreased in cultures infected with adenoviral vector coding for
ICERII
.
Despite correlative results obtained in gene expression studies on the
brain treated with stimuli provoking neurodegeneration by drugs acting on
glutamate receptors (Konopka et al.,
1998
; Storvik et al.,
2000
), no direct evidence was previously available on the
functional ability of ICER to evoke neuronal cell death. Our results directly
indicating such a possibility are not surprising, however. The major
biological function of ICER appears to be its antagonism toward CREB, as
indicated by studies on a number of genes
(Molina et al., 1993
;
Stehle et al., 1993
;
Tinti et al., 1996
;
Lamas et al., 1997
). In this
report we add the gene encoding Bcl-2 to this list of those that are
negatively regulated by ICER. Our data are in a good agreement with a
postulated prosurvival activity of CREB and Bcl-2
(Walton et al., 1996
;
Hu et al., 1999
;
Walton and Dragunow, 2000
;
Mabuchi et al., 2001
).
Directly relevant to our work are also the results obtained with use of
dominant negative mutants of CREB in vitro that showed this
transcription regulator to be necessary for the pro-survival neuronal response
to trophic factors (Bonni et al.,
1999
; Riccio et al.,
1999
), as well as studies by Mabuchi et al.
(2001
) who reported that
blockade of CRE-dependent Bcl-2 expression by use of CRE-decoy
oligonucleotides resulted in enhanced neuronal cell death within cultures
exposed to glutamate. However, to the best of our knowledge, there was no
previous evidence that overexpression of naturally occurring CREB functional
antagonist(s) may result in neuronal cell death. Some previous reports,
however, involved ectopic overexpression of ICER to study regulation of
expression of various genes (Zauli et al.,
2000
; Colgin et al.,
2001
). Notably, the pro-aptotic effect of ICER has not been shown
in either neuronal-like cell lines or in neurons. The discrepancy of these
results and ours might be explained by the differences in experimental design,
mainly by the fact that in most of these studies ICER was overexpressed for
the shorter periods of time that are necessary to observe its severe
pro-apoptotic effect. Such a delay of apoptotic effect of inhibition of
CRE-dependent transcription was described previously by Riccio et al.
(1999
) for dominant negative
mutants of CREB.
In addition to the reports showing correlation of ICER mRNA expression and
neurodegeneration, a physiological role for this protein has also been
suggested by studies documenting its elevated expression in conditions with
enhanced neuronal activity but with no apparent component of cell death. The
activation of ICER gene expression has been reported in the pineal gland
during daynight fluctuations
(Stehle et al., 1993
), in
hippocampus, frontal cortex, and cerebellum after electroconvulsive seizures
(Fitzgerald et al., 1996
), in
visual and barrel cortex in response to sensory stimulation
(Konopka et al., 1998
;
Staiger et al., 2000
), in
amygdala after lithium chloride injection
(Spencer and Houpt, 2001
), in
hypothalamus after osmotic stimulation
(Luckman and Cox, 1995
), and
in adrenal medulla after trans-synaptic stimulation with reserpine
(Trocme et al., 2001
). An
explanation for the differential involvement of ICER in various phenomena
could be derived from analysis of the time course of expression. In those
reports suggesting physiological roles for ICER, its expression was short
lasting, in contrast to our results obtained after glutamate stimulation of DG
cultures as well as kainic acid treatment of animals
(Konopka et al., 1998
; S.
Szymczak and J. Jaworski, unpublished observations). Thus, it might be
suggested that prolonged ICER activity is detrimental to the neurons. This
hypothesis might be supported further by the finding that HIV-1 Tat protein
treatment of PC-12 cells resulted in prolonged increased expression of ICER
mRNA (Zauli et al., 2000
), and
exposure of both PC-12 and neurons to high doses of this protein was found to
induce programmed cell death (Weeks at
al., 1995
; Kruman et al.,
1998
). Furthermore, Zauli et al.
(2000
) showed that injection
of Tat protein into rat striatum caused progressive loss of dopaminergic
neurons in substantia nigra.
Our results show a decrease of CREB phosphorylation in
Ad-ICER-overexpressing cultures without a significant decrease of the total
amount of CREB protein. Most of the current models of initiation of CREB
transcriptional activity suggest that CREB binding to its specific DNA
sequence precedes CREB phosphorylation as well as further recruitment of
transcription coactivators (for review, see
Shaywitz and Greenberg, 1999
).
Our results showing that ICER overexpression diminishes the CREB DNA binding
fully support such a notion.
Finally, we note that our approach with ectopic expression of ICER, an
endogenous antagonist of CREB reported herein to have a specific biological
function, might be useful for studies on ICER in other physiological and
pathological conditions. It should also prove to be valuable in probing
cellular activities of CREB that have recently been investigated extensively.
Notably, adenoviral vectors appear to offer a very convenient tool for such
studies. They are devoid of significant side effects in culture, and they have
been used previously to deliver also anti-apoptotic genes into the cells
(Simons et al., 1999
;
Kugler et al., 2001
).
In conclusion, our data as well as the aforementioned considerations
strongly suggest that the mechanism of ICER-evoked apoptosis in neurons is
based on its ability to antagonize CREB anti-apoptotic action that involves
activation of pro-survival genes. Thus, we postulate that the effects of ICER
on neuronal survival might depend on a balance between the active form of CREB
on the one hand and ICER on the other.
 |
Footnotes
|
|---|
Received Oct. 30, 2002;
revised Mar. 11, 2003;
accepted Mar. 13, 2003.
This research was supported by KBN (Komitet Badan Naukowych, Poland) Grant
Z-KBN004/P04/98. Joint studies between the Laboratory of Molecular
Neuroscience and Laboratoire de Genetique Moleculaire de la Neurotransmission
et des Processus Neurodegeneratifs were a part of a Centre National de la
Recherche ScientifiquePolish Academy of Sciences collaborative project.
J.J. was supported by scholarships of the French Government, the Polish
Foundation of Experimental and Clinical Oncology, the Batory Foundation, the
European Molecular Biology Organization, and the Foundation for Polish
Science. We express our gratitude to Dr. Sassone-Corsi for providing
ICERII
cDNA, Dr. Molina for antibody against ICER, S. De Gois and Dr.
Millecamps for introducing us to SCG culture, and Dr. Nikolaev and K.
Radwanska for assistance with statistical analysis. We thank also Drs. M.
Sheng, G. Schütz, J. Kuznicki, R. Przewlocki, and J. Platenik for helpful
comments.
Correspondence should be addressed to Dr. Jacek Jaworski, Picower Center
for Learning and Memory, Massachusetts Institute of Technology, E18-215, 77
Massachusetts Avenue, Cambridge, MA02139. E-mail:
jaworski{at}mit.edu.
Copyright © 2003 Society for Neuroscience
0270-6474/03/234519-08$15.00/0
* J.J. and B.M. contributed equally to the results of this work. 
 |
References
|
|---|
Bonni A, Brunet A, West AE, Datta SR, Takasu MA, Greenberg ME
(1999) Cell survival promoted by the Ras-MAPK signaling pathway
by transcription-dependent and -independent mechanisms. Science
286:
13581362.[Abstract/Free Full Text]
Colgin MA, Smith RL, Wilcox CL (2001) Inducible cyclic
AMP early repressor produces reactivation of latent herpes simplex virus type
1 in neurons in vitro. J Virol 75:
29122920.[Abstract/Free Full Text]
Dawson TM, Ginty DD (2002) CREB family transcription
factors inhibit neuronal suicide. Nat Med
8: 450451.[Medline]
Dragunow M, Preston K (1995) The role of inducible
transcription factors in apoptotic nerve cell death. Brain Res
Rev 21:
128.[Medline]
Figiel I, Kaczmarek L (1997) Cellular and molecular
correlates of glutamate-evoked neuronal programmed cell death in the in
vitro culture of rat hippocampal dentate gyrus. Neurochem
Int 31:
229240.[Medline]
Filipkowski RK, Hetman M, Kaminska B, Kaczmarek L
(1994) DNA fragmentation in rat brain after intraperitoneal
administration of kainate. NeuroReport
5:
15381540.[ISI][Medline]
Finkbeiner S (2000) CREB couples neurotrophin signals
to survival messages. Neuron 25:
1114.[ISI][Medline]
Fitzgerald LR, Vaidya VA, Terwilliger RZ, Duman RS
(1996) Electroconvulsive seizure increases the expression of CREM
(cyclic AMP response element modulator) and ICER (inducible camp early
repressor) in rat brain. J Neurochem 66:
429432.[ISI][Medline]
Garcia I, Martinou I, Tsujimoto Y, Martinou JC (1992)
Prevention of programmed cell death of sympathetic neurons by the
bcl-2 proto-oncogene. Science
258:
302304.[Abstract/Free Full Text]
Gonzalez GA, Montminy MR (1989) Cyclic AMP stimulates
somatostatin gene transcription by phosphorylation of CREB at serine 133.
Cell 59:
675680.[ISI][Medline]
Hardingham GE, Fukunaga Y, Bading H (2002)
Extrasynaptic NMDARs oppose synaptic NMDARs by triggering CREB shut-off and
cell death pathways. Nat Neurosci 5:
405414.[ISI][Medline]
Herdegen T, Skene P, Bahr M (1997) The c-Jun
transcription factorbipotential mediator of neuronal death, survival
and regeneration. Trends Neurosci 5:
227231.
Hetman M, Danysz W, Kaczmarek L (1997) Increased
expression of cathepsin D in retrosplenial cortex of MK-801-treated rats.
Exp Neurol 147:
229237.[Medline]
Hetman M, Kanning K, Cavanaugh JE, Xia Z (1999)
Neuroprotection by brain-derived neurotrophic factor is mediated by
extracellular-signal-regulated kinase and phosphatidylinositol-3 kinase.
J Biol Chem 274:
2256922580.[Abstract/Free Full Text]
Hu BR, Fux CM, Martone ME, Zivin JA, Ellisman MH
(1999) Persistent phosphorylation of cyclic AMP responsive
element binding protein and activating transcription factor 2 transcription
factors following transient cerebral ischemia in rat brain.
Neuroscience 89:
437452.[Medline]
Hughes PE, Alexi T, Walton M, Williams CE, Dragunow M, Clark RG,
Gluckman PD (1999) Activity and injury-dependent expression of
inducible transcription factors, growth factors and apoptosis-related genes
within the central nervous system. Prog Neurobiol
57: 421450.[ISI][Medline]
Impey S, Obrietan K, Wong ST, Poser S, Yano S, Wayman G, Deloulme
JC, Chan G, Storm DR (1998) Cross talk between ERK and PKA is
required for Ca 2+ stimulation of CREB-dependent
transcription and ERK nuclear translocation. Neuron
21: 869883.[ISI][Medline]
Jaworski J, Figiel I, Proszynski T, Kaczmarek L (2000)
Efficient expression of tetracycline-responsive gene following transfection of
dentate gyrus neurons in vitro. J Neurosci Res
60: 754760.[Medline]
Kaminska B, Filipkowski RK, Zurkowska G, Lason W, Przewlocki R,
Kaczmarek L (1994) Dynamic changes in composition of the AP-1
transcription factor DNA binding activity in rat brain following kainate
induced seizures and cell death. Eur J Neurosci
6:
15581566.[ISI][Medline]
Konopka D, Szklarczyk AW, Filipkowski RK, Trauzold A, Nowicka D,
Hetman M, Kaczmarek L (1998) Plasticity- and
neurodegeneration-linked CREM/ICER mRNA expression in the rat brain.
Neuroscience 86:
499510.[ISI][Medline]
Kruman II, Nath A, Mattson MP (1998) HIV-1 protein Tat
induces apoptosis of hippocampal neurons by a mechanism involving caspase
activation, calcium overload, and oxidative stress. Exp Neurol
154:
276288.[ISI][Medline]
Kugler S, Meyn L, Holzmuller H, Gerhardt E, Isenmann S, Schulz JB,
Bahr M (2001) Neuron-specific expression of therapeutic proteins:
evaluation of different cellular promoters in recombinant adenoviral vectors.
Mol Cell Neurosci 17:
7896.[Medline]
Lamas M, Molina C, Foulkes NS, Jansen E, Sassone-Corsi P
(1997) Ectopic ICER expression in pituitary corticotroph AtT20
cells: effects on morphology, cell cycle, and hormonal production. Mol
Endocrinol 11:
14251434.[Abstract/Free Full Text]
Le Gal La Salle G, Robert JJ, Berrard S, Ridoux V,
Stratford-Perricaudet LD, Perricaudet M, Mallet J (1993) An
adenovirus vector for gene transfer into neurons and glia in the brain.
Science 259:
988990.[Abstract]
Lonze BE, Riccio A, Cohen S, Ginty DD (2002)
Apoptosis, axonal growth defects, and degeneration of peripheral neurons in
mice lacking CREB. Neuron 34:
371385.[Medline]
Lowenstein PR, Shering AF, Bain D, Castro MG, Wilkinson GWG
(1996) The use of adenovirus vectors to transfer genes to
identified target brain cells in vitro. In: Protocols for gene
transfer in neuroscience: towards gene therapy of neurological
disorders (Lowenstein PR, Enquist LW, eds), pp
93114. New York: Wiley.
Luckman SM, Cox HJ (1995) Expression of inducible camp
early repressor (ICER) in hypothalamic magnocellular neurons. Mol Brain
Res 34:
231238.[Medline]
Mabuchi T, Kitagawa K, Kuwabara K, Takasawa K, Ohtsuki T, Xia Z,
Storm D, Yanagihara T, Hori M, Matsumoto M (2001) Phosphorylation
of cAMP response element-binding protein in hippocampal neurons as a
protective response after exposure to glutamate in vitro and ischemia
in vivo. J Neurosci 21:
92049213.[Abstract/Free Full Text]
Mantamadiotis T, Lemberger T, Bleckman SC, Kern H, Kretz O,
Martin-Villalba A, Tronche F, Kellendonk C, Gau D, Kapfhammer J, Otto C,
Schmid W, Schutz G (2002) Disruption of CREB function in brain
leads to neurodegeneration. Nat Genet
31: 4754.[ISI][Medline]
Maronde E, Wicht H, Tasken K, Genieser HG, Dehghani F, Olcese J,
Korf HW (1999) CREB phosphorylation and melatonin biosynthesis in
the rat pineal gland: involvement of cyclic AMP dependent protein kinase type
II. J Pineal Res 27:
170182.[Medline]
Mayr B, Montminy M (2001) Transcriptional regulation
by the phosphorylation-dependent factor CREB. Nat Rev Mol Cell
Biol 2:
599609.[ISI][Medline]
Molina CA, Foulkes NS, Lalli E, Sassone-Corsi P (1993)
Inducible and negative autoregulation of CREM: an alternative promoter directs
the expression of ICER, an early response repressor. Cell
75: 875886.[ISI][Medline]
Nedivi E, Hevroni D, Naot D, Israeli D, Citri Y (1993)
Numerous candidate plasticity-related genes revealed by differential cDNA
cloning. Nature 363:
718722.[Medline]
Ohki EC, Tilkins ML, Ciccarone VC, Price PJ (2001)
Improving the transfection efficiency of post-mitotic neurons J
Neurosci Methods 112:
9599.[ISI][Medline]
Pettmann B, Henderson CE (1998) Neuronal cell death.
Neuron 20:
633647.[ISI][Medline]
Pfeffer M, Maronde E, Korf HW, Stehle JH (2000)
Antisense experiments reveal molecular details on mechanisms of ICER
suppressing cAMP-inducible genes in rat pinealocytes. J Pineal
Res 29:
2433.[ISI][Medline]
Revah F, Horellou P, Vigne E, Le Gal La Salle G, Robert JJ,
Perricaudet M, Mallet J (1996) Gene transfer into the central and
peripheral nervous system using adenoviral vectors. In: Protocols for
gene transfer in neuroscience: towards gene therapy of neurological
disorders (Lowenstein PR, Enquist LW, eds), pp
8192. New York: Wiley.
Riccio A, Ahn S, Davenport CM, Blendy JA, Ginty DD
(1999) Mediation by a CREB family transcription factor of
NGF-dependent survival of sympathetic neurons. Science
286:
23582361.[Abstract/Free Full Text]
Sastry PS, Rao SK (2000) Apoptosis and nervous system.
J Neurochem 74:
120.[ISI][Medline]
Shaywitz AJ, Greenberg ME (1999) CREB: a
stimulus-induced transcription factor activated by a diverse array of
extracellular signals. Annu Rev Biochem
68: 821861.[ISI][Medline]
Simons M, Beinroth S, Gleichmann M, Liston P, Korneluk RG,
MacKenzie AE, Bahr M, Klockgether T, Robertson GS, Weller M, Schulz JB
(1999) Adenovirus-mediated gene transfer of inhibitors of
apoptosis protein delays apoptosis in cerebellar granule neurons. J
Neurochem 72:
292301.[ISI][Medline]
Spencer CM, Houpt TA (2001) Dynamics of c-fos and ICER
mRNA expression in rat forebrain following lithium chloride injection.
Mol Brain Res 93:
113126.[Medline]
Staiger JF, Bisler S, Schleicher A, Gass P, Stehle JH, Zilles K
(2000) Exploration of a novel environment leads to the expression
of inducible transcription factors in barrel-related columns.
Neuroscience 99:
716.[Medline]
Stehle JH, Foulkes NS, Molina CA, Simonneaux V, Pevet P,
Sassone-Corsi P (1993) Adrenergic signals direct rhythmic
expression of transcriptional repressor CREM in the pineal gland.
Nature 365:
314320.[Medline]
Stehle JH, von Gall C, Korf HW (2001) Analysis of cell
signalling in the rodent pineal gland deciphers regulators of dynamic
transcription in neural/endocrine cells. Eur J Neurosci
14: 19.[ISI][Medline]
Storvik M, Linden A-M, Kontkanen O, Lakso M, Castren E, Wong G
(2000) Induction of cAMP response element modulator (CREM) and
inducible cAMP early repressor (ICER) expression in rat brain by uncompetitive
N-methyl-D-aspartate receptor antagonist. J
Pharmacol Exp Ther 294:
5260.[Abstract/Free Full Text]
Stratford-Perricaudet LD, Makeh I, Perricaudet M, Briand P
(1992) Wide-spread long-term gene transfer to mouse skeletal
muscles and heart. J Clin Invest 90:
626630.
Tinti C, Conti B, Cubells JF, Kim KS, Baker H, Joh TH
(1996) Inducible cAMP early repressor can modulate tyrosine
hydroxylase gene expression after stimulation of cAMP synthesis. J Biol
Chem 271:
2537525381.[Abstract/Free Full Text]
Trocme C, Ravassard P, Sassone-Corsi P, Mallet J, Biguet NF
(2001) CREM and ICER are differentially implicated in
trans-synaptic induction of tyrosine hydroxylase gene expression in adrenal
medulla and sympathetic ganglia of rat. J Neurosci Res
65: 9199.[Medline]
Vaux DL, Cory S, Adams JM (1988) Bcl-2 gene promotes
haemopoietic cell survival and cooperates with c-myc to immortalize pre-B
cells. Nature 335:
440442.[Medline]
Vaux DL, Weissman IL, Kim SK (1992) Prevention of
programmed cell death in Caenorhabditis elegans by human bcl-2.
Science 258:
19551957.[Abstract/Free Full Text]
Walton M, Sirimanne E, Williams C, Gluckman P, Dragunow M
(1996) The role of the cyclic AMP response element binding
protein (CREB) in hypoxic-ischemic brain damage and repair. Mol Brain
Res 43:
2129.[Medline]
Walton MR, Dragunow M (2000) Is CREB a key to neuronal
survival? Trends Neurosci 23:
4852.[ISI][Medline]
Weeks BS, Lieberman DM, Johnson B, Roque E, Green M, Loewenstein P,
Oldfield EH, Kleinman HK (1995) Neurotoxicity of the human
immunodeficiency virus type 1 tat transactivator to PC12 cells requires the
Tat amino acid 4958 basic domain. J Neurosci Res
42: 3440.[Medline]
Willingham MC (1999) Cytochemical methods for the
detection of apoptosis. J Histochem Cytochem
47:
11011110.[Abstract/Free Full Text]
Wilson BE, Mochon E, Boxer LM (1996) Induction of
bcl-2 expression by phosphorylated CREB proteins during B-cell activation and
rescue from apoptosis. Mol Cell Biol 16:
55465556.[Abstract]
Xia Z, Dudek H, Miranti CK, Greenberg ME (1996)
Calcium influx via NMDA receptor induces immediate early gene transcription by
MAP kinase/ERK-dependent mechanism. J Neurosci
16:
54255436.[Abstract/Free Full Text]
Yuan J, Yankner BA (2000) Apoptosis in the nervous
system. Nature 407:
802809.[Medline]
Zagulska-Szymczak S, Filipkowski R, Kaczmarek L (2001)
Kainate-induced genes in the hippocampus: lessons from expression patterns.
Neurochem Int 8:
485501.
Zauli G, Secchiero P, Rodella L, Gibellini D, Mirandola P, Mazzoni
M, Milani D, Dowd DR, Capitani S, Vitale M (2000) HIV-1
Tat-mediated inhibition of the tyrosine hydroxylase gene expression in
dopaminergic neuronal cells. J Biol Chem
275:
41594165.[Abstract/Free Full Text]
Zirpel L, Janowiak MA, Veltri CA, Parks TN (2000) AMPA
receptormediated, calcium-dependent CREB phosphorylation in a subpopulation of
auditory neurons surviving activity deprivation. J Neurosci
20:
62676275.[Abstract/Free Full Text]
This article has been cited by other articles:

|
 |

|
 |
 
N. Kojima, G. Borlikova, T. Sakamoto, K. Yamada, T. Ikeda, S. Itohara, H. Niki, and S. Endo
Inducible cAMP Early Repressor Acts as a Negative Regulator for Kindling Epileptogenesis and Long-Term Fear Memory
J. Neurosci.,
June 18, 2008;
28(25):
6459 - 6472.
[Abstract]
[Full Text]
[PDF]
|
 |
|