The Journal of Neuroscience, July 9, 2003, 23(14):6030-6040
Previous Article | Next Article 
Retinoschisin, a Photoreceptor-Secreted Protein, and Its Interaction with Bipolar and Müller Cells
Silvia N. M. Reid,1
Clyde Yamashita,1 and
Debora B. Farber1,2
1Jules Stein Eye Institute, University of
California Los Angeles School of Medicine, Los Angeles, California 90095, and
2Molecular Biology Institute, University of California
Los Angeles, Los Angeles, California 90095
 |
Abstract
|
|---|
Usually, photoreceptors interact with other retinal cells through the
neurotransmitter glutamate. Here we describe a nonsynaptic interaction via a
secreted protein, retinoschisin. Using in situ hybridization, we
found that from early postnatal life retinoschisin mRNA is present only in the
outer retina of the mouse, and with single-cell RT-PCR we demonstrated its
localization in rod and cone photoreceptor cells but not in Müller cells.
Western blot analyses of proteins from cultured ocular tissues and
microdissected outer and inner retinas, as well as from the culture media of
these samples, showed that retinoschisin is secreted from the photoreceptor
cells. Immunostaining of permeabilized and nonpermeabilized dissociated
retinal cells revealed that retinoschisin is mainly inside and outside the
photoreceptors, outside bipolar cells, and associated with plasma membranes of
Müller cells and inside their distal processes. Because we showed
previously that retinoschisin is distributed all over the retina, our current
data suggest that after synthesis and secretion by the photoreceptors,
retinoschisin reaches the surface of retinal cells and mediates
interactions/adhesion between photoreceptor, bipolar, and Müller cells,
contributing to the maintenance of the cytoarchitectural integrity of the
retina. These interactions may not occur when the gene encoding retinoschisin
is mutated, as it occurs in X-linked juvenile retinoschisis, a disease that
results in morphological and electrophysiological defects of the retina.
Key words: photoreceptor; glia; neurodegenerative disease; retinal disease; retinal development; neurodegeneration; bipolar cell; protein secretion; cell interaction; retinoschisis; Müller cell
 |
Introduction
|
|---|
Signaling molecules are intricately woven into the nervous system
communication network. In addition to neurotransmitters, extracellular
signaling molecules such as adhesion proteins and trophic factors also
participate in cellcell interactions for facilitation of synaptic
transmission, neurite growth, axon guidance, cell migration, and cell
differentiation. Neuropilin-1, neurexin IV, contactin-associated protein,
SCO-spondin, and tyrosine protein kinase Ptk-3proteins involved in
axon-pathfinding, cell migration, cell aggregation, and cell interactions with
gliaall contain the FA58C/discoidin domain
(Sánchez et al., 1994
;
Baumgartner et al., 1996
;
Gobron et al., 1996
;
Einheber et al., 1997
;
He and Tessier-Lavigne, 1997
;
Kitsukawa et al., 1997
;
Kolodkin et al., 1997
;
Peles et al., 1997
;
Marín et al., 2001
)
that has been described in the InterPro database to function in
cellcell adhesion (Apweiler et al.,
2001
). Because the FA58C/discoidin domain makes up
70% of the
retinal protein retinoschisin (Sauer et
al., 1997
; Reid et al.,
1999
), studies on this protein will provide insights into
cellcell interactions in the retina.
Mutations in the gene encoding retinoschisin cause X-linked juvenile
retinoschisis (XLRS) (Sauer et al.,
1997
; The Retinoschisis
Consortium, 1998
). This disease is characterized by
pinwheel-shaped folds in the fovea and a reduced b-wave in the
electroretinogram (ERG) (George et al.,
1995
) that reflects defective activity in the inner retina
(Peachey et al., 1987
). The
XLRS retina displays macular atrophy, microcysts present mainly in the macular
region, separation of the nerve fiber layer/inner limiting membrane from the
remaining retina, and accumulation of extracellular filaments in retina and
vitreous (Yanoff et al., 1968
;
Manschot, 1972
;
Condon et al., 1986
). It has
been speculated that Müller cells, the principal glial cells of the
vertebrate retina, are responsible for XLRS
(Condon et al., 1986
). However,
recent evidence attributed the physiological defects of XLRS to bipolar cells
(Alexander et al., 2000
;
Shinoda et al., 2001
).
Retinoschisin is found throughout the retina
(Grayson et al., 2000
;
Molday et al., 2001
), whereas
the mRNA required for its synthesis is present only in the outer retina,
mainly in the photoreceptor inner segments
(Reid et al., 1999
). The
association of retinoschisin with photoreceptors was first reported by Grayson
et al. (2000
) and was
confirmed by Molday et al.
(2001
). Because retinoschisin
contains a secretory leader peptide (Sauer
et al., 1997
; Reid et al.,
1999
) and is in the culture media of photoreceptor-like
retinoblastoma cells (Grayson et al.,
2000
), we hypothesized previously that after its secretion from
photoreceptors, retinoschisin interacts with inner retinal cells to maintain
the retinal cytoarchitecture (Reid et al.,
1999
; Grayson et al.,
2000
). However, immunostaining results led Molday et al.
(2001
) to propose that
retinoschisin is also synthesized by the inner retinal bipolar cells. In this
paper, we document the disparate distribution of retinoschisin mRNA (confined
to the photoreceptors) and protein throughout postnatal development of the
mouse retina. We also demonstrate retinoschisin secretion from photoreceptor
cells and its localization on the surface of bipolar and Müller cells.
These data suggest that photoreceptor-secreted retinoschisin mediates
nonsynaptic interactions between retinal cells.
 |
Materials and Methods
|
|---|
Tissue preparation
The eyes of normal C57BL/6J and rd/rd mice were prepared for
histology either after perfusion as described previously
(Reid et al., 1999
) or
immersionfixation in buffered 4% paraformaldehyde. Eyes without
fixation were used for cell dissociation and nonhistological procedures. The
use of animals in the experiments was in accordance with the guidelines
approved by The Society for Neuroscience.
Cell dissociation
The method described by Ishii et al.
(1997
) was used with minor
modifications to enzymatically dissociate retinal cells. Eyecups were digested
(37°C, 10 or 20 min) in papain (1 mg/ml). After removal of the retinal
pigment epithelium (RPE)/choroid/sclera (R/C/S), retinas were further digested
(37°C, 20 min). Dissociated cells were collected by centrifugation at 80
x g and fixed in buffered 4% paraformaldehyde.
In situ hybridization
The detection of mouse retinoschisin gene (Xlrs1) expression by
using digoxigenin (DIG)-tagged sense- and antisense-cRNA probes (bp
16984488 of Xlrs1) was performed as described previously
(Reid et al., 1999
) on
cryosections of eyecups (10 or 16 µm thick). The final alkaline phosphatase
reaction was performed for 2 hr or for 10.5 hr to enhance detection of low
levels of mRNA.
Immunostaining of retinal sections and cells
Antibodies. RS2437 (a generous gift from Dr. D. Trump,
Cambridge Institute for Medical Research, Cambridge, UK), an affinity-purified
rabbit polyclonal antibody, was raised against a synthetic peptide
corresponding to amino acid residues 2437 of retinoschisin (aa
2437) (Grayson et al.,
2000
). UW55 (kindly provided by Dr. John Saari, University of
Washington, Seattle, WA), a rabbit polyclonal antibody, was raised against a
Müller cell protein, cellular retinaldehyde-binding protein (CRALBP)
(Eisenfeld et al., 1985
). ROB
(115A10; a kind gift of Dr. Shinobu C. Fujita, Mitsubishi Kasei Institute of
Life Sciences, Machida, Japan), a mouse monoclonal antibody, recognizes a cell
surface protein of bipolar cells (Onoda
and Fujita, 1987
; Haverkamp
and Wässle, 2000
). All secondary antibodies were purchased
from Jackson ImmunoResearch (West Grove, PA), if not noted otherwise.
Immunocytochemistry. The immunodetection of retinoschisin using
RS2437 (1:250) and a biotinavidinperoxidase-based method
was performed as described previously
(Grayson et al., 2000
).
RS2437 preabsorbed with synthetic peptide aa 2437 (0.2
µg/µl) for 3 hr (25°C) was used for control staining.
Indirect immunofluorescence. Methanol-permeabilized (-80°C, 3
min) and nonpermeabilized retinal cells immunoreacted with RS2437
(1:250) and UW55 (1:1000) in 1% normal rabbit serum at 4°C, overnight,
were visualized after a 2 hr incubation at 25°C with indocarbocyanine
(Cy3)-conjugated donkey anti-rabbit IgG (1:200) in 1% normal donkey serum.
RS2437 preabsorbed with aa 2437 (0.1 µg/µl) was used as a
control. For ROB staining, proteinase K-permeabilized or nonpermeabilized
cells were incubated in ROB (1:100 in normal donkey serum/bovine serum
albumin, 4°C, overnight) and visualized with a fluorescein isothiocyanate
(FITC)-conjugated donkey anti-mouse IgG (1:200).
In sequential immunostaining experiments (to avoid the influence of
bleed-through on simultaneous double labeling), retinoschisin-immunopositive
cells were further stained for other proteins. Permeabilized Müller cells
were stained with ROB and later with UW55 (25°C, 3.5 hr) without
additional permeabilization. Nonpermeabilized, retinoschisin-positive cells
were incubated with either ROB or UW55 (1:500). The UW55-treated cells were
then permeabilized with 0.5% Triton X-100, stained with ROB, and incubated
again with UW55 (1:500). Each staining was performed only after
immunofluorescence images of the previous staining had been acquired.
FITC-conjugated donkey IgG was used to visualize the UW55-positive and
ROB-positive cells.
The pattern of retinoschisin immunofluorescence was compared with those of
FM 143 (Molecular Probes, Eugene, OR)-labeled cell membranes
(Whalley et al., 1995
) and
7-amino-4-chloromethylcoumarin (CellTrack Blue CMAC, Molecular Probes)-stained
cytosols (Muñoz-Barroso et al.,
1998
). Enzymatically dissociated cells were washed with DMEM,
incubated with 8 µM CMAC for 15 min at 37°C, and then
incubated with 3 µM FM 143 for 15 min at 37°C. After
fixation in 4% paraformaldehyde, the labeled cells were smeared onto glass
slides, immunoreacted with RS2437 (1:1000, 4°C, overnight), and
labeled with Alexa Fluor 488-conjugated goat anti-rabbit IgG (Molecular
Probes). The cell images were acquired with the aid of a Leica DM IRBE
microscope equipped with a Leica TCS-SP confocal component.
Quantification of immunofluorescence. Retinoschisin
immunofluorescence images were acquired from randomly picked photoreceptor,
bipolar, and Müller cells enzymatically dissociated from retinas of two
mice. One single confocal optical section was recorded across the center of
each cell, under identical settings, using a Zeiss LSM 10 confocal microscope.
The structure of interest was selected by outlining it with the Lasso tool,
and, without any image modification, the averaged fluorescence intensity per
pixel (FI) of the outlined structure was measured on a scale of 0255
using the luminosity channel of the histogram function in Adobe Photo Shop.
The background fluorescence intensity (BI) was acquired from an adjacent blank
area. The FI of each structure was converted into the relative fluorescence
intensity (RI), defined as: RI = (FI - BI) x 100/BI. The average of all
the RIs for each structure of the cell stained with RS2437 preabsorbed
with aa 2437 was used as the standard (S) for that structure. The
relative level of retinoschisin immunofluorescence (RL) for each structure of
each cell was obtained as: RL = (RI - S) x 100/S. The RLs were analyzed
separately for each cell type by three-way factorial ANOVA, using antibody
treatment, permeabilization procedure, and structures of the cell as the three
analytical factors. Tukey HSD multiple comparison was used for the post
hoc analyses.
Single-cell RT-PCR
Retinal cells were mechanically dissociated by lightly chopping flattened
retinas in PBS with a razor blade according to Sampath et al.
(1998
). Individual retinal
cells were drawn into separate micropipettes with the aid of an inverted
microscope. The isolated cells were then subjected to RT-PCR as described by
Kumazaki et al. (1994
) using
rTth DNA polymerase (PerkinElmer Life Sciences, Branchburg, NJ) with
some modifications. Each RT reaction product was divided for further PCR
detection of specific cDNAs in the presence of appropriate primers. Primers
GGTACCAGAAAGCATGCAA (exon 3) and GCTCCATCCGGATGGCAATT (exon 6) were used for
Xlrs1 mRNA; primers CTGAGAAGGATGCCCGCACTG (exon 1) and
CTCACCTGCCGGGCTGAATCT (exon 3) were used for the rod-specific
1-subunit of transducin (RT
); primers
TAGAGTTCAAGTCTGTCATCT (forward) and CTGCTCGTTAGGGAGGTAGTT (reverse) were used
for the cone-specific
2-subunit of transducin
(CT
); and primers CCGCCTCTGCTGGAATGTGT (exon 6) and
CGGCTGAGCTGGACGCCAGTT (exon 7) were used for carbonic anhydrase II
(CAII), yielding fragments of 549, 269, 317, and 150 bp that
identified Xlrs1 mRNA, rod, cone, and Müller cells,
respectively. These first-round PCR products were subjected to Southern blot
analyses or another round of PCR. Gel-purified, 32P-labeled probes
generated by RT-PCR of total mouse retinal RNAs using the above primers and
the multiprimer DNA labeling system (Amersham Biosciences, Piscataway, NJ)
were used in Southern blot analyses.
Secretion experiments
Three experiments were performed. In the first, enucleated eyes of 12 adult
mice were used to obtain anterior segment, eyecup, R/C/S, and retina. For each
tissue type, 12 individual samples were pooled and divided into two sets. Each
duplicate was placed in a separate well of a tissue-culture plate, washed, and
incubated with 300 µl of DMEM in a humid-chamber equilibrated with 95%
O2/5% CO2.
In the second experiment, individual retinas of 73- and 139-d-old
rd/rd mice and two normal mice were incubated singly in 200 µl of
DMEM under the conditions stated above.
In the third experiment, we examined retinoschisin secretion from the inner
and outer retinas. Retinas of normal adult mice were flattened on a
polytetrafluoroethylene Biopore membrane (Millipore, Bedford, MA), placed on a
gelatin stage mounted on a vibratome, and embedded onto the stage with 4%
gelatin. A 100-µm-thick retinal section was cut; the 150-µm-thick
section containing the rest of the retina was then removed from the stage.
Both sections were washed and incubated separately in 200 µl of DMEM under
the same conditions as before.
At the end of
22.5, 27, and 37 hr incubation at 25°C for the
first, second, and third set of experiments, respectively, the medium and
tissue from each well were collected for Western blot analyses.
Western blot analyses Sample preparation.
Tissues were homogenized as described previously
(Reid et al., 1997
). After
centrifugation at 1000 x g (10 min, 4°C), the supernatant
was used in Western blots or processed further for cellular fractionation. The
cytosolic fraction was obtained by collecting the supernatant after 1 hr
centrifugation at 100,000 x g (4°C). The pelleted membrane
was lysed in 10 mM Tris, pH 7.4, 1 mM EDTA, with the
protease inhibitors initially used, homogenized, and further pelleted at
100,000 x g (4°C).
Immunoblotting. Protein (10 µg) from tissue homogenate [protein
concentration determined by the method of Peterson
(1977
)] was denatured in 2%
SDS in Tris, pH 6.8, 0.01% bromophenol blue, 10% glycerol, with or without 50
mM dithiothreitol (DTT), and then separated by SDS-PAGE on
420% gradient gels. Culture media collected from each well of the
tissue culture plate from the secretion experiments described above was
filtered (Millipore Ultrafree-MC filter with 0.1 or 0.2 µm pore size).
Twenty microliters from each well were incubated with SDS- and DTT-containing
buffer before SDS-PAGE.
Proteins in gels were electroblotted onto polyvinylidene difluoride
membranes. The membranes were incubated with one of the following antibodies:
RS2437 (1:500), anti-rod rhodopsin (1:1000), and antiinterphotoreceptor
retinoid-binding protein (IRBP) (1:10,000; a gift from Dr. D. Bok, University
of California Los Angeles) and processed for an alkaline phosphatase-based
enhanced chemiluminescence detection (DuoLux) following the protocol
recommended by the vendor (Vector Laboratories, Burlingame, CA).
 |
Results
|
|---|
Distribution of retinoschisin mRNA and protein during postnatal
development of normal mouse retina
The mismatched distribution of retinoschisin mRNA and protein in the adult
mouse retina that we described previously
(Reid et al., 1999
;
Grayson et al., 2000
) may not
occur during development. Therefore, retinoschisin in the adult inner retina
could be the remainder of protein produced earlier. To test this hypothesis
and determine the time course of appearance and location of retinoschisin mRNA
in mouse retina, experiments were performed using in situ
hybridization. Retinoschisin mRNA signals were detected in retinal sections
reacted with the antisense probe at all ages except postnatal day (P) 3,
whereas no signal was found in any section reacted with the sense probe
(Fig. 1A).
Retinoschisin mRNA was not detected at P3 even after a prolonged reaction
(10.5 hr), but a weak signal in the outer neuroblastic zone at the scleral
margin was revealed in the P5 retina. Stronger mRNA expression with a
sclera-to-vitreous gradient of intensity across the outer nuclear layer (ONL)
that stopped before the outer plexiform layer (OPL) was observed from P6 to
P14, with a dramatic increase in intensity between P6 and P7
(Fig. 1A). The signal
in the inner half of the ONL became more apparent at P14, especially after a
prolonged reaction, and was most prominent at P21
(Fig. 1A). In the
adult retina (P82), retinoschisin mRNA was present in the entire ONL, but it
was concentrated mainly in the inner segment of the photoreceptors. No mRNA
signal was detected in the inner retina at any age even after a 10.5 hr
reaction. The time course of retinoschisin mRNA appearance and its
distribution are consistent with our reported Northern blot results
(Reid et al., 1999
).

View larger version (134K):
[in this window]
[in a new window]
|
Figure 1. Distribution of retinoschisin mRNA and protein in normal (A) and
rd/rd mouse (B) retinas. A, Retinoschisin mRNA was
detected with a digoxigenin-labeled antisense-cRNA probe (AS) and visualized
by the purple reaction product of the alkaline phosphatase reaction; no
staining was observed with sense-cRNA probe (S) used as control. Retinoschisin
was detected by immunohistochemistry (IHC); the brown peroxidase-reaction
product was observed after immunoreaction with an affinity-purified polyclonal
antibody against amino acid residues 2437 of retinoschisin (aa
2437). This antibody was preabsorbed with aa 2437 and used as
control (PA). NBZ, Neuroblastic zone; IPL, inner plexiform layer; G/N,
ganglion cell and nerve fiber layers; RPE, retinal pigment epithelium; ONL,
outer nuclear layer; OPL, outer plexiform layer; INL, inner nuclear layer; C,
choroid; OS, outer segment of photoreceptors; IS, inner segment of
photoreceptors. Retinoschisin mRNA and protein were not detected in the retina
of normal mice at P3 but were found at a very low level at P5. A mismatched
mRNA and protein localization started on P7 and persisted into adulthood
(P82). Retinoschisin mRNA was in the outer retina throughout postnatal
development (outer NBZ on P5; ONL on P6 and P7/8; IS and ONL on P14, 21, and
82). In contrast, retinoschisin (Protein) was initially in the outer retina
(outer NBZ on P5 and ONL on P6) and then appeared in the inner retina.
Immunopositive cell bodies in the INL (double arrowheads) started appearing at
P8 and showed increased intensity as the retina matured. By P21, retinoschisin
was abundant in all layers. Both mRNA and protein were most concentrated in
the area corresponding to the photoreceptor inner segments (*).
Visualization of the mRNA was achieved with a 2 hr alkaline phosphatase
reaction (P7/8, 14, and 21) or 10.5 hr (P3, 5, 6, and 82, and the left
micrograph in the AS column for P14). B, At P73 and P139, most
photoreceptors had degenerated in the rd/rd retinas, and
retinoschisin mRNA was not detected even after 10.5 hr of reaction. Faint
retinoschisin staining was present in the INL, the IPL, and the G/N. The
micrograph strips at the far right of the mRNA and protein panels for each age
are high-contrast bright-field micrographs taken from the same section as the
adjacent micrographs. High-contrast micrographs were also taken from a portion
of the sections in the AS panel at P3, the IHC panel at P3, and the AS panel
at P5. Scale bar: for all micrographs, 50 µm.
|
|
Retinoschisin immunoreactivity was found at all examined ages when retinal
sections were treated with the RS2437 antibody except for P3, but it
was not observed when the antibody was preabsorbed with the aa 2437
peptide against which it had been raised
(Fig. 1A). The brown
immunoreaction product was noticeable at P5 in the sclerad third of the
neuroblastic zone with the highest intensity at the scleral margin, and it
spread farther inward at P6. By P7, retinoschisin had occupied the entire ONL,
the inner plexiform layer (IPL) and the nerve fiber layer (NFL), and at P8 it
became very clear in the inner nuclear layer (INL). At P14, after eye opening,
retinoschisin was seen all over the retina but was concentrated mostly in the
area of the photoreceptor inner segments
(Fig. 1A). A similar
pattern was also found in the P21 and adult retinas, with staining of the OPL
and the INL increasing with age. These results are consistent with our
previous findings in adult mouse and human retinas
(Grayson et al., 2000
);
furthermore, detection of retinoschisin in the plexiform layers has also been
confirmed by Molday et al.
(2001
) and Weber et al.
(2002
).
In the adult mouse, the retinoschisin-immunoreactive product outlined the
inner segment of the photoreceptors and appeared most intense immediately
adjacent to the outer segment (Fig.
2a). The product formed patches around cell bodies in the
INL, decorated the processes in the IPL
(Fig. 2b), and was
associated with structures that emulated the end feet of Müller cells in
the NFL (Fig. 2c).

View larger version (123K):
[in this window]
[in a new window]
|
Figure 2. Retinoschisin in the adult retina. a, Retinoschisin-immunolabeling
surrounds the inner segment of the photoreceptors (arrowheads) and is
concentrated in the area adjacent to where the inner segment joins the outer
segment (double arrowheads). b, Immunohistochemical reaction products
in the inner retina appear around cell bodies (arrows) in the INL, processes
in the INL and IPL (arrowheads), and in the nerve fiber layer (*).
c, The immunoreaction products are also associated with the end feet
of Müller cells (arrowheads) in the nerve fiber layer. Scale bar: a,
b, 20 µm; c, 13 µm. See
Figure 1 for abbreviations.
|
|
Distribution of mRNA and protein in the degenerating retinas of
rd/rd mice
rd/rd mice are affected with an inherited retinal degeneration
characterized by the rapid loss of photoreceptor cells during early postnatal
life. Therefore, we did not observe a photoreceptor layer in retinas of P73
and P139 rd/rd mice. Consistently, we did not detect retinoschisin
mRNA by in situ hybridization in these retinas even after 10.5 hr of
alkaline phosphatase reaction (Fig.
1B). This prolonged reaction did reveal, however,
retinoschisin mRNA in P5 and P6 normal retinas
(Fig. 1A) that have a
transcript level barely detectable on Northern blots
(Reid et al., 1999
). Faint
immunostaining of retinoschisin could still be found in patches of the
remaining retina of the 73-d-old rd/rd mouse
(Fig. 1B). These
patches became less frequent and very faint but were still seen in the
rd/rd INL at P139, consistent with the results of Molday et al.
(2001
).
RT-PCR detection of Xlrs1 expression
Because the distal processes of Müller cells extend across the ONL,
the Xlrs1 mRNA seen by in situ hybridization in this layer
could be present not only in photoreceptors but also in Müller cell
processes. To test this possibility, we amplified retinoschisin mRNA from
individual retinal cells using RT-PCR (Fig.
3). The identity of each cell was unequivocally determined by the
expression of cell-specific genes. Xlrs1 mRNA was detected in several
individual cells expressing either RT
(nine rod cells) or
CT
(six cone cells) but not in cells expressing the
Müller cell marker CAII (eight cells); the RT-PCR results of
three cells from each cell type are shown in
Figure 3. Multiple retinal
cells were collected in a single micropipette as the positive control
(Fig. 3, PC). After subjecting
these cells to RT-PCR, the expression of all four genes was observed
(Fig. 3). Cells that had no
structural resemblance to photoreceptor and Müller cells were isolated as
negative controls (Fig. 3, NC);
no expression was found in them for any of the four genes
(Fig. 3).
Retinoschisin in the retina and cultured ocular tissues
Similar to our previous results
(Grayson et al., 2000
), two
protein bands from retinal homogenates treated with the disulfide-reducing
agent DTT were recognized on Western blots by the antibody RS2437
against retinoschisin. These proteins had apparent molecular masses of 27 kDa
(slightly higher than the mass predicted from the deduced amino acid sequence
of retinoschisin) and 65 kDa (Fig.
4A, first lane of H in the left panel). In the absence of
DTT, the 65 kDa band and smears of higher molecular mass were detected, but
not the 27 kDa band (Fig.
4A, second lane of H in the left panel). After cellular
fractionation, the 65 kDa protein was found in the nonreduced cytosol fraction
(C) but not in the nonreduced membrane preparation (M), whereas the smear was
present predominantly in the nonreduced membrane fraction
(Fig. 4A). When the
membrane preparation was incubated at room temperature for 1 hr with DTT, only
the 27 kDa protein was labeled by the RS2437 antibody; in contrast,
treatment of the cytosol with DTT did not change the 65 kDa protein
(Fig. 4B, left panel).
The antibody no longer labeled the 65 and 27 kDa proteins after it had been
preabsorbed with the synthetic peptide aa 2437 (data not shown). These
data imply that retinoschisin aggregates as multimers or complexes with other
proteins of the membrane and that it forms a nonreducible aggregate in the
cytosol. However, the possibility that the antibody recognizes another protein
migrating at 65 kDa cannot be ruled out.

View larger version (60K):
[in this window]
[in a new window]
|
Figure 4. Retinoschisin in normal mouse retinal extracts and its secretion from
different ocular tissues analyzed by Western blots. Proteins from all samples
were subjected to SDS-PAGE. Western blots were labeled with the RS2437
antibody. A, Left panel, Retinoschisin from a mouse retinal
homogenate(H), with or without the addition of DTT, and nonreduced membrane
(M) and cytosol (C) fractions (see Materials and Methods). Right panel,
Proteins from cultured eye tissues incubated with DTT. AS, Anterior segment;
E, eyecup; R/C/S, retinal pigment epithelium/choroid/sclera; R, retina.
B, Left panel, Retinal cellular fractions treated with DTT. Right
panel, Retinal homogenate used as reference and the culture media of ocular
tissues in A after treatment with DTT. C, Left panel,
Cultured adult rd/rd retinas, containing only the inner layers, and
normal retina (top panel); culture media of above samples (bottom panel).
Right panel, Microdissected inner and outer layers of normal retinas (top
panel) and their culture media (bottom panel). The 27 kDa protein was observed
only under reducing conditions in retinal samples and their culture media (see
Results for details). IRBP, a predominately cytosolic protein, was used as a
positive control for secretion and rod rhodopsin (RR), an intrinsic membrane
protein, was used as a negative control. RS2437 antibody also labeled a
65 kDa protein present in the retinal cytosol. DM, DMEM culture medium; RS,
retinoschisin; I, inner retina; O, outer retina.
|
|
Western blot analyses showed that the 27 kDa retinoschisin was present in
the cultured retinas and eyecups, whereas the 65 kDa protein was detected at a
low level not only in those tissues but also in cultured anterior segments,
including mainly corneas, irises, and ciliary bodies
(Fig. 4A, right
panel). At least two other proteins with molecular masses >65 kDa were
observed in the lanes containing homogenates of the cultured anterior segments
and in lanes of the R/C/S homogenates (Fig.
4A, right panel). These data indicate either that
retinoschisin forms complexes in these tissues or that the antibody recognizes
in them other proteins with similar molecular masses. Retinoschisin that is
reducible to the monomeric form seems to be present only in the retina.
Secretion of retinoschisin
Both the 27 and 65 kDa proteins labeled by RS2437 were found in the
culture media of the eyecup and the retina but not of the anterior segment and
the R/C/S (Fig. 4B). A
photoreceptor secreted protein, IRBP, was also detected in these media;
however, rod rhodopsin, a photoreceptor membrane protein, was not
(Fig. 4B). These
results indicate that the presence of retinoschisin in the media is not the
consequence of its association with membrane debris loosened during
incubation. From the data in Figure 4,
A and B, we can conclude that cells from
cultured retinas and eyecups secrete retinoschisin.
As shown in Figure
4C, both the 27 and 65 kDa proteins were present in the
inner and outer retina of normal mice. They were also found in the 73- and
139-d-old rd/rd retinas, consistent with the immunohistochemical data
(Fig. 1). The monomeric
retinoschisin was present in the culture medium of outer retinas. In contrast,
no retinoschisin was detected in the culture media of inner retinas or
rd/rd retinas (Fig.
4C). Because the outer retinas have mainly photoreceptor
cells, these data indicate that retinoschisin is secreted by photoreceptor
cells and not by the inner retinal cells.
Retinoschisin in dissociated retinal cells
The findings described above(1) localization of retinoschisin mRNA
in photoreceptors (suggesting synthesis of the corresponding protein in these
cells), (2) undetectable retinoschisin mRNA but presence of the protein in the
inner retina, and (3) retinoschisin secretion presumably from photoreceptor
cellsindicate that retinoschisin may be taken up by bipolar and
Müller cells, or both, and transported by them to the vitreal border of
the inner retina. Moreover, the secreted retinoschisin could also participate
through its FA58C motif in adhesion/cellcell interactions between the
different retinal cells. For these reasons we examined the presence of
retinoschisin inside and outside photoreceptor, bipolar, and Müller cells
by immunostaining dissociated cells that had or had not been permeabilized
with methanol. This treatment has been shown to remove some proteins localized
to the cell surface [i.e., the lectin peanut agglutinin
(Verdier et al., 2000
)] and to
allow the detection of intracellular proteins
(Reid and Daw, 1995
;
Schipper et al., 1999
).
Consistent with these observations, we found that immunofluorescent staining
of the cell-surface protein ROB was substantially reduced by methanol
permeabilization (data not shown) and that intracellular CRALBP could be
detected after methanol treatment. Therefore, this is a useful procedure to
determine the localization of retinoschisin inside or outside different
retinal cells.
Dissociated photoreceptor cells could be recognized by their small cell
bodies (
5 µm diameter), each connected by a thin filament (the myoid)
to the inner segment and the long, cylindrical outer segment
(Fig. 5j,l). Without
permeabilization, retinoschisin immunoreactivity was associated with the cell
bodies and covered nearly the entire inner and outer segments of photoreceptor
cells (Fig. 5k,l).
After methanol permeabilization, the immunoreactivity became associated mainly
with the inner/outer segment junction and much less with the cell body
(Fig. 5i,j). This is
similar to the pattern found in retinal sections
(Fig. 2a) and
consistent with the in situ results showing abundant retinoschisin
mRNA in the inner segments (Fig.
1, P82). The levels of retinoschisin immunofluorescence associated
with photoreceptor cells with or without methanol permeabilization were
compared after normalization to "control" levels (obtained by
using antibody preabsorbed with the peptide against which it was generated).
Only levels significantly above (indicated by asterisks) the control level (0)
were considered immunopositive (Fig.
6). ANOVA of immunofluorescence levels showed that retinoschisin
was associated with photoreceptor cells (F(1,248) =
63.505; p < 0.001), regardless of which structure of the cell was
examined (F(1,248) = 0.160; p = 0.690), but that
this association was affected by the permeabilization procedure used
(permeabilization factor: F(1,248) = 7.558, p
< 0.01; interaction between permeabilization and antibody treatment:
F(1,248) = 7.561, p < 0.01). A significantly
higher than the control level of retinoschisin was found associated with
nonpermeabilized cells at the soma (p < 0.001) and
innerouter segment region (p < 0.001), indicating
localization of retinoschisin outside the cell bodies and the
innerouter segments (Figs.
5k,6A).
Methanol permeabilization significantly reduced (by 60%; p < 0.05)
the level of retinoschisin at the soma, and this level was no longer different
from that of the control (p = 0.166)
(Fig. 6A). Although
methanol changed the staining pattern of the innerouter segment, it did
not significantly affect the level of retinoschisin at this region (p
= 0.347), which remained significantly above the control (p <
0.01). Taken together, these observations demonstrate that methanol removes
extracellular retinoschisin associated with photoreceptor cells mainly around
the soma and the entire innerouter segment but that retinoschisin is
also located inside the inner segment.

View larger version (75K):
[in this window]
[in a new window]
|
Figure 5. Retinoschisin in photoreceptor cells and marker-identified bipolar and
Müller cells. The bipolar cell shown (a) was recognized by the
ROB antibody when permeabilized with proteinase K (b); bipolar cells
were not immunopositive for the Müller cell protein CRALBP (c,
d). Müller cells were identified by an antibody against CRALBP after
Triton X-100 permeabilization (e, f) and were not labeled by ROB
(g, h). Cells in a and b and g and
h were immunostained at the same time and so were cells in c
and d and e and f. The retinoschisin antibody (RS)
labeled photoreceptor cells that were either permeabilized with methanol
(i, j) or not permeabilized (k, l). Bipolar cells
(mo) and Müller cells
(ps and tx) that had been
immunostained for retinoschisin were subjected to sequential immunostainings,
and the image acquisition after each staining was completed before the next
round of staining. The nonpermeabilized bipolar cell in m was also
labeled by the ROB antibody (n). The methanol-permeabilized
Müller cell in p was not labeled by ROB (q) but was
labeled by the antibody against CRALBP (r). The nonpermeabilized
Müller cell in t was not labeled by the antibody against the
intracellular protein CRALBP (u). After Triton X-100
permeabilization, this Müller cell was not positive for ROB (v),
but it was labeled by the CRALBP antibody (w). a, c, e, g, j, l,
o, s, and x were taken with bright field under high contrast.
b and h, d and f, q and r, and
uw were acquired with the same exposure time. dd,
Dendrite; sm, soma; ax, axon; dp, distal process; pp, proximal process; ef,
end foot; os, outer segment; is, inner segment; my, myoid; nl, nucleus. Scale
bar, 25 µm.
|
|

View larger version (30K):
[in this window]
[in a new window]
|
Figure 6. Relative levels of retinoschisin immunofluorescence in nonpermeabilized and
methanol-permeabilized photoreceptor (A), bipolar (B),
bipolar, and Müller (C) cells. Immunofluorescent images of
retinal cells were analyzed from confocal optical sections recorded under
identical conditions. The relative level of retinoschisin immunofluorescence
represents the percentage difference from the control. The immunofluorescence
of the control was obtained using the anti-retinoschisin antibody preabsorbed
with the peptide used to generate it. A lack of difference between the
antibody staining of the sample and the control was given a value of 0 for the
relative retinoschisin immunofluorescence. Bars represent the averaged
relative retinoschisin immunofluorescence ± the corresponding SEM for
the number of observations performed (indicated in the bar). Gray bars
represent nonpermeabilized cells; black bars represent methanol-permeabilized
cells. Statistical comparisons between cells treated with retinoschisin
antibody and the peptide preabsorbed antibody are indicated with asterisks
only for those that are at a significant p level: *p <
0.5; **p < 0.01; ***p < 0.005;
****p < 0.0001. The relative level of retinoschisin
immunofluorescence is higher without than with permeabilization for the soma
of photoreceptor cells (p < 0.05) and the soma (p <
0.001) and dendrite (p < 0.001) of bipolar cells. The level was
significantly higher after permeabilization at the distal process of
Müller cells (p < 0.05).
|
|
ROB-positive bipolar cells all had a thin, smooth axon and tufted,
crown-shaped dendrites (Figs.
5a,b) and did not immunoreact with an antibody against
CRALBP, a Müller cell marker (Fig.
5c,d). CRALBP-positive Müller cells had two
relatively thick, craggy processes extending out in opposite directions; the
end of the proximal process formed the enlarged end foot
(Fig. 5e,f,r,s,w,x).
Müller cells were not labeled by the ROB antibody
(Fig. 5g,h,q,v).
Because the ROB antibody recognizes a cell surface antigen
(Onoda and Fujita, 1987
), both
nonpermeabilized (Fig.
5n) and proteinase K-permeabilized bipolar cells
(Fig. 5b) were
immunolabeled by this antibody. In contrast, the CRALBP antibody labeled
either Triton X-100 (Fig.
5f,w) or methanolpermeabilized Müller cells
(Fig. 5r) but did not
immunostain nonpermeabilized Müller cells
(Fig. 5u). This
pattern of staining agrees with CRALBP being an intracellular protein
(Eisenfeld et al., 1985
).
To examine the association of retinoschisin with bipolar and Müller
cells, we performed sequential immunostaining of these cells with antibodies
against retinoschisin, ROB, and CRALBP. The anti-retinoschisin antibody
labeled nonpermeabilized cells that exhibited morphological characteristics of
bipolar cells (Fig.
5m,o), and the same cells were also labeled by the ROB
antibody (Fig. 5n).
Quantitative analyses were performed on bipolar cells immunostained only for
retinoschisin. These analyses showed that retinoschisin was associated with
them (ANOVA; F(1,393) = 47.068; p < 0.001)
regardless of which region of the cell was examined
(F(1,393) = 0.670; p = 0.512), but this
association was dependent on the permeabilization procedure (permeabilization
effect: ANOVA; F(1,393) = 25.728, p < 0.001;
interaction with antibody treatment: ANOVA; F(1,393) =
25.726, p < 0.001). Post hoc analyses revealed that
retinoschisin was associated with the soma (p < 0.001), axon
(p < 0.05), and dendrites (p < 0.001) of only
nonpermeabilized bipolar cells (Fig.
6B). Permeabilization significantly reduced retinoschisin
immunofluorescence by 8697% at the soma and dendrites (p <
0.001 for both), and the levels of retinoschisin were no longer above the
control levels at all three regions of the bipolar cell
(Fig. 6B). These
results show that retinoschisin is located mainly outside the bipolar cells
and is removable by methanol. We corroborated this localization and the effect
of methanol by triple labeling dissociated bipolar cells and confocal
microscopy analysis. The retinoschisin immunostaining pattern of
nonpermeabilized bipolar cells was nearly identical to that obtained by
labeling cell plasma membranes with FM 143 but was different from
cytosol labeling with CMAC (Fig.
7). In agreement with our quantitative analyses, methanol
permeabilization abolished the retinoschisin immunoreactivity of bipolar cells
(Fig. 7).

View larger version (99K):
[in this window]
[in a new window]
|
Figure 7. Confocal images of triple-labeled bipolar and Müller cells.
Enzymatically dissociated retinal cells were incubated with culture medium
containing 7-amino-4-chloromethylcoumarin (CMAC) for 15 min at 37°C to
stain cytosol and then under the same conditions with FM 143-containing
medium to label cell membranes. The labeled cells were fixed in
paraformaldehyde and smeared onto glass slides. Immunostaining for
retinoschisin was performed immediately before or after permeabilization with
methanol. The antigen was visualized with Alexa Fluor 488-conjugated secondary
antibody. The retinoschisin immunostaining (RS) pattern of nonpermeabilized
bipolar cells was nearly identical to the cell plasma membrane labeling with
FM 143 but was different from the cytosol labeling with CMAC. Methanol
permeabilization abolished retinoschisin immunoreactivity of bipolar cells but
not the FM 143 and CMAC stainings. These results show that
retinoschisin is localized outside bipolar cells. The antibody against
retinoschisin immunolabeled nonpermeabilized Müller cells. This staining
pattern was nearly identical to that obtained with FM 143 and persisted
after methanol permeabilization, indicating that retinoschisin is associated
with the plasma membrane of Müller cells. Scale bar, 25 µm.
|
|
Sequential immunostaining demonstrated that cells with characteristics of
Müller cells (Fig.
5e,f) were immunopositive for retinoschisin with or
without methanol permeabilization (Fig.
5p,t). The same cells were also immunopositive for CRALBP
(Fig. 5r,w) but not
for ROB antibodies (Fig.
5q,v). ANOVA of immunofluorescence levels showed a
significant effect of antibody (F(1,652) = 236.433;
p < 0.001) but no permeabilization effect
(F(1,652) = 1.533; p = 0.216) and no difference
between regions of the cell (F(1,652) = 0.451; p
= 0.717), indicating that retinoschisin is associated with all structures of
Müller cells regardless of permeabilization. Post hoc analyses
revealed that permeabilization had no effect on the level of retinoschisin at
the soma, the proximal process, and the end foot, but resulted in an increase
in the retinoschisin level at the distal process (p < 0.05)
(Fig. 6C). Triple
labeling and confocal microscopy analyses were also used to corroborate the
localization of retinoschisin and the effect of methanol permeabilization on
Müller cells. Retinoschisin immunolabeling of either the nonpermeabilized
or the methanolpermeabilized cells was nearly identical to the FM 143
staining of cell membranes but different from the CMAC staining of the cytosol
(Fig. 7). Staining of
nonpermeabilized cells showed extracellular localization of retinoschisin.
Similar levels of retinoschisin before and after methanol permeabilization
suggest that retinoschisin may be resistant to removal from the cell surface,
as it occurs with membrane-associated proteins, e.g., glutamate receptors
(Reid et al., 1995
).
Alternatively, methanol removal of retinoschisin from outside Müller
cells may allow the detection of retinoschisin associated with the inner
domain of the cell membrane. Either of these two possibilities leads to the
conclusion that retinoschisin is associated with the cell membrane of
Müller cells. In addition, the increased retinoschisin level in the
distal processes after permeabilization indicates an intracellular
localization of retinoschisin in Müller cells.
 |
Discussion
|
|---|
Retinoschisin and its mRNA are distributed differently in the mouse retina
throughout postnatal life: the mRNA required for protein synthesis resides in
the outer retina, where the photoreceptor cells and distal processes of
Müller cells are located, whereas retinoschisin is in all retinal layers.
More precisely, we demonstrated in single-cell RT-PCR experiments that
retinoschisin mRNA is located only in cone and rod cells but not in
Müller cells. Thus, de novo synthesis of retinoschisin does not
occur in Müller cell processes. The localization of retinoschisin in
photoreceptors is consistent with the results of studies showing that the gene
encoding this protein is regulated by Crx
(Livesey et al., 2000
), a
transcription factor that is crucial for photoreceptor differentiation
(Chen et al., 1997
;
Furukawa et al., 1997
). The
lack of detectable retinoschisin mRNA in the inner retina supports the notion
of retinoschisin being secreted into these retinal layers, an idea already
inferred by the presence of a secretory leader peptide in its amino acid
sequence (Sauer et al., 1997
;
Reid et al., 1999
) and
confirmed by our detection of retinoschisin in the medium of cultured
photoreceptor-containing outer retina (Fig.
4).
To corroborate the site of retinoschisin synthesis, we measured the levels
of its mRNA in retinas of rd/rd mice at different times during
postnatal development. We found that at 4 weeks of age, the rodless
rd/rd retina has less mRNA than that of the age-matched normal
retina. As cones degenerate, there is a progressive decrease in retinoschisin
mRNA that becomes undetectable by 810 postnatal weeks on Northern blots
(Reid et al., 1999
) (confirmed
by Molday et al., 2001
) or by
in situ hybridization (Fig.
1). In contrast, retinoschisin is present in retinas of 8- to
10-week-old rd/rd mice (Fig.
1B) (Molday et al.,
2001
), although its level is lower than normal, and it declines
further in the next 10 weeks as cones continue to degenerate
(Fig. 1B). These
results substantiate the fact that retinoschisin is made in the photoreceptor
cells. The cone cells that remain in 8-week-old rd/rd retinas
(LaVail et al., 1997
) may have
been the source of retinoschisin mRNA that was amplified by RT-PCR and gave a
weak signal in the study of Molday et al.
(2001
).
Immunostaining of retinal sections showed clearly that retinoschisin is in
the inner and outer retina (Figs.
1,
2)
(Grayson et al., 2000
;
Molday et al., 2001
;
Weber et al., 2002
),
predominantly associated with photoreceptor inner segments, also present in
the ONL, the INL, and the plexiform layers, and patchy in the NFL (Figs.
1,
2)
(Grayson et al., 2000
).
Recently, Molday et al. (2001
)
reported that retinoschisin is present in bipolar but not Müller cells.
We have confirmed the association of retinoschisin with the surface of bipolar
cells (Figs. 6,
7). However, we also have found
retinoschisin-immunopositive Müller cell end feet along the inner
limiting membrane (Fig.
2b,c) and have observed immunoreactivity for
retinoschisin in dissociated Müller cells (Figs.
5,
6,
7). In fact, the patchy
staining of retinoschisin along the inner limiting membrane is also apparent
in Figures 3B,
4A, and
6E of Molday et al.
(2001
) and in
Figure 6b of Weber et
al. (2002
). Permeabilization
with methanol (in our study) instead of Triton X-100
(Molday et al., 2001
) may have
facilitated our detection of Müller cell retinoschisin. There is no
obvious reason to suspect that the antibodies used by the two laboratories
recognized different proteins. Both antibodies were generated against peptides
of nearly identical sequences (Grayson et
al., 2000
; Molday et al.,
2001
), were affinity purified, and bound a membrane-associated
protein of similar molecular mass. Although our antibody also recognized a
cytosolic protein of 65 kDa [not reported by Molday et al.
(2001
)], the labeling of
Müller cells is associated mainly with their plasma membranes, which do
not have the 65 kDa retinoschisin (Figs.
4,
7).
The amino acid sequence of retinoschisin contains the FA58C/discoidin motif
that has been implicated in cellcell interaction and adhesion
(Sauer et al., 1997
;
Reid et al., 1999
). The
detection of retinoschisin on the outside surface of bipolar and Müller
cells lends support to its involvement in these functions. Through
cellcell interactions or adhesion between retinal cells, or both,
retinoschisin may contribute to maintain the integrity of the cytoarchitecture
of the retina.
Both retinoschisin mRNA and protein appear at P5, a time when the inner
segment of the photoreceptors has started to develop
(Olney, 1968
;
Blanks et al., 1974
) and that
coincides with the expression of some phototransduction proteins
(Bowes et al., 1988
;
Szél et al., 1994
). The
OPL seems to impose a boundary for retinoschisin mRNA but not for the protein.
Retinoschisin can be seen spreading inwardly into the IPL and the NFL at P7,
when immature blood vessels (Caley et al.,
1972
) and Müller cell end feet
(Edwards et al., 1990
) first
appear. At the same time, rod bipolar cells and ON-cone bipolar cells are
differentiating, as indicated by the expression of metabotropic glutamate
receptor subtype 6 (a major glutamate receptor of these cells)
(Ueda et al., 1997
). Thus,
retinoschisin appears when retinal cells differentiate and when two nuclear
layers segregate.
Müller, rod, bipolar, and some amacrine cells arise during a late
proliferative phase (Young,
1985
) and together, guided by Müller cells, form radial
columns in the retina (Meller and
Tetzkaff, 1976
; Layer et al.,
1997
; Reese et al.,
1999
). Starting at P4, many cone nuclei are pushed deep into the
ONL, and early-generated rod cells are pushed into the future INL. They need
to migrate back scleradly (Young,
1984
; Rich et al.,
1997
). The idea that Müller cells aid in this migration has
been supported by the finding of displaced photoreceptor cells in
vivo and in culture when Müller cells have been damaged
(Rich et al., 1995
;
Willbold et al., 1995
).
Interestingly, some XLRS retinas have either fewer or no photoreceptor nuclei
in the macula (Manschot, 1972
;
Ando et al., 2000
), lack a well
defined columnar organization in the ONL, or have displaced cone cells in the
inner retina (Yanoff et al.,
1968
; Condon et al.,
1986
). Similarly, Xlrs1 inactivation in mice reduces
photoreceptor cell number and causes photoreceptor cell displacement
(Weber et al., 2002
), as in
the case of Müller cell disruption
(Rich et al., 1995
).
Furthermore, both nuclear layers become poorly segregated, and inner retinal
cells are disorganized (Weber et al.,
2002
). The abnormalities in humans could result from inappropriate
interactions between photoreceptors/neurons and Müller cells mediated by
the defective protein produced by the mutated XLRS1 gene, and in the knock-out
mice from the lack of retinoschisin. A defective CRALBP immunolabeling of
Müller cell end feet is also detected in the knock-out retina, without
schisis in the NFL (Weber et al.,
2002
). The formation of the schisis may be a complicated process,
involving several factors in addition to the participation of retinoschisin in
the adhesion of the NFL to the inner retinal layers. More comprehensive
studies of the effect of knocking out Xlrs1 are required to establish
or rule out Müller cell involvement in XLRS.
Physiological evidence has suggested that the bipolar pathway is defective
in XLRS (Alexander et al.,
2000
; Shinoda et al.,
2001
). Association of retinoschisin with bipolar dendrites is
consistent with its involvement in information processing along the bipolar
pathway and in the development of this pathway. The Xlrs1 knock-out
mice have displaced synaptic layers and severely attenuated synaptic formation
in the IPL (Weber et al.,
2002
). Because retinoschisin appears before the formation of
bipolar cell synapses in the OPL and the IPL
(Olney, 1968
;
Blanks et al., 1974
), it may
guide the bipolar axons and dendrites to establish proper neural connections,
as is the case with another FA58C/discoidin-containing protein, neuropilin
(He and Tessier-Lavigne, 1997
;
Kolodkin et al., 1997
).
Photoreceptors are the last to mature in the chain of cells necessary to
enable transmission of visual information to the brain, but they are the first
to participate in the biochemical cascade conveying light information. Many
events occur from the time of photoreceptor differentiation to the time of eye
opening, and they need to be synchronized in the absence of visual inputs. The
use of extracellular signaling molecules may be a way to achieve this
coordination. The presence of retinoschisin during retinal development and its
association with bipolar and Müller cells seems to place this protein in
the right position at the right time.
In summary, our results suggest that the photoreceptor-secreted
retinoschisin mediates a complicated set of interactions among photoreceptor,
bipolar and Müller cells, and nerve fibers. Possibly, it may participate
in the coordination of retinal development, and through its adhesion
properties it may also be involved in the maintenance of the cytoarchitecture
and normal electrophysiology of the retina.
 |
Footnotes
|
|---|
Received Dec. 30, 2002;
revised Apr. 8, 2003;
accepted Apr. 18, 2003.
This work was supported by National Institutes of Health Grant EY08285.
D.B.F. is a recipient of a Research to Prevent Blindness Senior Investigators
Research Award. We thank Drs. Dorothy Trump, John Saari, Shinobu Fujita, and
Dean Bok for antibodies, Dr. Gabriel Travis for his helpful discussion, and
Dr. Craig Reid for assistance with this manuscript. We also thank Dr.
Alapakkam Sampath for isolation of retinal cells for RT-PCR, Dr. Matthew
Schibler for his assistance in confocal microscopy, and Tawny Saleh for her
assistance in the immunostaining of dissociated cells.
Correspondence should be addressed to Silvia N. M. Reid, Jules Stein Eye
Institute, University of California Los Angeles School of Medicine Center for
the Health Sciences, 100 Stein Plaza, Los Angeles, CA 90095-7008. E-mail:
reiddrs{at}aol.com.
Copyright © 2003 Society for Neuroscience
0270-6474/03/236030-11$15.00/0
 |
References
|
|---|
Alexander KR, Fishman GA, Grover S (2000) Temporal
frequency deficits in the electroretinogram of the cone system in X-linked
retinoschisis. Vision Res 40:
28612868.[Web of Science][Medline]
Ando A, Takahashi K, Sho K, Matsushima M, Okamura A, Uyama M
(2000) Histopathological findings of X-linked retinoschisis with
neovascular glaucoma. Graefe's Arch Clin Exp Ophthalmol
238: 17.[Web of Science][Medline]
Apweiler R, Attwood TK, Bairoch A, Bateman A, Birney E, Biswas M,
Bucher P, Cerutti L, Corpet F, Croning MDR, Durbin R, Falquet L, Fleischmann
W, Gouzy J, Hermjakob H, Hulo N, Jonassen I, Kahn D, Kanapin A, Karavidopoulou
Y, et al. (2001) The InterPro database, an integrated
documentation resource for protein families, domains and functional sites.
Nucleic Acids Res 29:
3740.[Abstract/Free Full Text]
Baumgartner S, Littleton JT, Broadie K, Bhat MA, Harbecke R,
Lengyel JA, Chiquet-Ehrismann R, Prokop A, Bellen HJ (1996) A
Drosophila neurexin is required for septate junction and blood-nerve
barrier formation and function. Cell 87:
10591068.[Web of Science][Medline]
Blanks JC, Adinolfi AM, Lolley RN (1974)
Synaptogenesis in the photoreceptor terminal of the mouse retina. J
Comp Neurol 156:
8194.[Web of Science][Medline]
Bowes C, van Veen T, Farber DB (1988) Opsin, G-protein
and 48-kDa protein in normal and rd mouse retinas: developmental
expression of mRNAs and proteins and light/dark cycling of mRNAs. Exp
Eye Res 47:
369390.[Web of Science][Medline]
Caley DW, Johson C, Liebelt RA (1972) The postnatal
development of the retina in the normal and rodless CBA mouse: a light and
electron microscopic study. Am J Anat
133:
179212.[Web of Science][Medline]
Chen S, Wang OL, Nie Z, Sun H, Lennon G, Copeland NG, Gilbert DJ,
Jenkins NA, Zack DJ (1997) Crx, a novel Otx-like
paired-homeodomain protein, binds to and transactivates photoreceptor
cell-specific genes. Neuron 19:
10171030.[Web of Science][Medline]
Condon GP, Brownstein S, Wang N, Kearns AF, Ewing CC
(1986) Congenital hereditary (juvenile X-linked) retinoschisis:
histopathologic and ultrastructural findings in three eyes. Arch
Ophthalmol 104:
576583.[Abstract/Free Full Text]
Edwards MA, Yamamoto M, Caviness VSJR (1990)
Organization of radial glia related cells in the developing murine CNS. An
analysis based on a new monoclonal antibody marker.
Neuroscience 36:
121144.[Web of Science][Medline]
Einheber S, Zanazzi G, Ching W, Scherer S, Milner TA, Peles E,
Salzer JL (1997) The axonal membrane protein Caspr, a homologue
of neurexin IV, is a component of the septate-like paranodal junctions that
assemble during myelination. J Cell Biol
139:
14951506.[Abstract/Free Full Text]
Eisenfeld AJ, Bunt-Milam AH, Saari JC (1985)
Localization of retinoid-binding proteins in developing rat retina. Exp
Eye Res 41:
299304.[Web of Science][Medline]
Furukawa T, Morrow EM, Cepko CL (1997) Crx, a
novel otx-like homebox gene, shows photoreceptor-specific expression
and regulates photoreceptor differentiation. Cell
91: 531541.[Web of Science][Medline]
George NDL, Yates JRW, Moore AT (1995) X-linked
retinoschisis. Br J Ophthalmol 79:
697702.[Free Full Text]
Gobron S, Monnerie H, Meiniel R, Creveaux I, Lehmann W, Lamalle D,
Dastugue B, Meiniel A (1996) SCO-spondin: a new member of the
thrombosposin family secreted by the subcommissural organ is a candidate in
the modulation of neuronal aggregation. J Cell Sci
109:
10531061.[Abstract]
Grayson C, Reid SNM, Ellis JA, Rutherford A, Sowden JC, Yates JRW,
Farber DB, Trump D (2000) Retinoschisin, the X-linked
retinoschisis protein, is a secreted photoreceptor protein, and is expressed
and secreted by differentiated Weri cells. Human Mol Genet
9:
18731879.[Abstract/Free Full Text]
Haverkamp S, Wässle H (2000) Immunocytochemical
analysis of the mouse retina. J Comp Neurol
424: 123.[Web of Science][Medline]
He Z, Tessier-Lavigne M (1997) Neuropilin is a
receptor for the axonal chemorepellent semaphorin III. Cell
90: 739751.[Web of Science][Medline]
Ishii M, Horio Y, Tada Y, Hibino H, Inanobe A, Ito M, Yamada M,
Botow T, Uchiyama Y, Kurachi Y (1997) Expression and clustered
distribution of an inwardly rectifying potassium channel,
KAB-2/Kir4.1, on mammalian retinal Müller cell membrane: their
regulation by insulin and laminin signals. J Neurosci
17:
77257735.[Abstract/Free Full Text]
Kitsukawa T, Shimizu M, Sanbo M, Hirata T, Taniguchi M, Bekku Y,
Yagi T, Fujisawa H (1997) Neuropilin-semaphorin III/D-mediated
chemorepulsive signals play a crucial role in peripheral nerve projection in
mice. Neuron 19:
9951005.[Web of Science][Medline]
Kolodkin AL, Levengood DV, Rowe EG, Tai YT, Giger RJ, Ginty DD
(1997) Neuropilin is a semaphorin III receptor.
Cell 90:
753762.[Web of Science][Medline]
Kumazaki T, Hamada K, Mitsui Y (1994) Detection of
mRNA expression in a single cell by direct RT-PCR.
Biotechniques 16:
10171019.[Web of Science][Medline]
LaVail MM, Matthes MT, Yasumura D, Steinberg RH (1997)
Variability in rate of cone degeneration in the retinal degeneration
(rd/rd) mouse. Exp Eye Res 65:
4550.[Web of Science][Medline]
Layer PG, Berger J, Kinkl N (1997) Cholinesterases
precede "ON-OFF" channel dichotomy in the embryonic chick retina
before onset of synaptogenesis. Cell Tissue Res
288:
407416.[Web of Science][Medline]
Livesey FJ, Furukawa T, Steffen MA, Church GM, Cepko CL
(2000) Microarray analysis of the transcriptional network
controlled by the photoreceptor homeobox gene Crx. Curr
Biol 10:
301310.[Web of Science][Medline]
Manschot W (1972) Pathology of hereditary juvenile
retinoschisis. Arch Ophthalmol 88:
131138.[Abstract/Free Full Text]
Marín O, Yaron A, Bagri A, Tessier-Lavigne M, Rubenstein JLR
(2001) Sorting of striatal and cortical interneurons regulated by
semaphorinneuropilin interactions. Science
293:
872875.[Abstract/Free Full Text]
Meller K, Tetzkaff W (1976) Scanning electron
microscopic studies on the development of the chick retina. Cell Tissue
Res 170:
145159.[Web of Science][Medline]
Molday LL, Hicks D, Sauer CG, Weber BHF, Molday RS
(2001) Expression of X-linked retinoschisis protein RS1 in
photoreceptor and bipolar cells. Invest Ophthalmol Vis Sci
42: 816825.[Abstract/Free Full Text]
Muñoz-Barroso I, Durell S, Sakaguchi K, Appella E,
Blumenthal R (1998) Dilation of the human immunodeficiency
virus1 envelope glycoprotein fusion pore revealed by the inhibitory
action of a synthetic peptide from gp41. J Cell Biol
140:
315323.[Abstract/Free Full Text]
Olney JW (1968) An electron microscopic study of
synapse formation, receptor outer segment development, and other aspects of
developing mouse retina. Invest Ophthalmol
7: 250268.[Abstract/Free Full Text]
Onoda N, Fujita SC (1987) A monoclonal antibody
specific for a subpopulation of retinal bipolar cells in the frog and other
vertebrates. Brain Res 416:
359363.[Web of Science][Medline]
Peachey NS, Fishman GA, Derlacki DJ, Brigell MG (1987)
Psychophysical and electroretinographic findings in X-linked juvenile
retinoschisis. Arch Ophthalmol 105:
513516.[Abstract/Free Full Text]
Peles E, Nativ M, Lustig M, Grumet M, Schilling J, Martinez R,
Plowman GD, Schlessinger J (1997) Identification of a novel
contactin-associated transmembrane receptor with multiple domains implicated
in protein-protein interactions. EMBO J
16: 978988.[Web of Science][Medline]
Peterson GL (1977) A simplification of the protein
assay method of Lowry et al. which is more generally applicable. Anal
Biochem 83:
346365.[Web of Science][Medline]
Reese BE, Necessary BD, Tam PPL, Faulkner-Jones B, Tan S-S
(1999) Clonal expansion and cell dispersion in the developing
mouse retina. Eur J Neurosci 11:
29652978.[Web of Science][Medline]
Reid SNM, Daw NW (1995) Dark-rearing changes dendritic
microtubule-associated protein 2 (MAP2) but not subplate neurons in cat visual
cortex. J Comp Neurol 359:
3847.[Web of Science][Medline]
Reid SNM, Romano C, Hughes T, Daw NW (1995)
Immunohistochemical study of two phosphoinositide-linked metabotropic
glutamate receptors (mGluR1
and mGluR5) in the cat visual cortex
before, during and after the peak of the critical period for eye specific
connections. J Comp Neurol 355:
470477.[Web of Science][Medline]
Reid SNM, Romano C, Hughes T, Daw NW (1997)
Developmental and sensory-dependent changes of phosphoinositide-linked
metabotropic glutamate receptors. J Comp Neurol
389:
577583.[Web of Science][Medline]
Reid SNM, Akhmedov NB, Piriev NI, Kozak CA, Danciger M, Farber DB
(1999) The mouse X-linked juvenile retinoschisis cDNA: expression
in photoreceptors. Gene 227:
257266.[Web of Science][Medline]
Rich KA, Figueroa SL, Zhan Y, Blanks JC (1995) Effects
of Muller cell disruption on mouse photoreceptor cell development. Exp
Eye Res 61:
235248.[Web of Science][Medline]
Rich KA, Zhan Y, Blanks JC (1997) Migration and
synaptogenesis of cone photoreceptors in the developing mouse retina. J
Comp Neurol 388:
4763.[Web of Science][Medline]
Sampath AP, Matthews HR, Cornwall MC, Fain GL (1998)
Bleached pigment produces a maintained decrease in outer segment Ca
2+ in Salamander rods. J Gen Physiol
111: 5364.[Abstract/Free Full Text]
Sánchez MP, Tapley P, Saini SS, He B, Pulido D, Barbacid M
(1994) Multiple tyrosine proteins in rat hippocampal neurons:
isolation of Ptk-3, a receptor expressed in proliferative zones of the
developing brain. Proc Natl Acad Sci USA
91:
18191823.[Abstract/Free Full Text]
Sauer CG, Gehrig A, Warneke-Wittstock R, Marquardt A, Ewing CC,
Gibson A, Lorenz B, Jurklies B, Weber BHF (1997) Positional
cloning of the gene associated with X-linked juvenile retinoschisis.
Nat Genet 17:
164170.[Web of Science][Medline]
Schipper RG, Romain N, Otten AA, Tan J, Lange WP, Verhofstad AAJ
(1999) Immunocytochemical detection of ornithine decarboxylase.
J Histochem Cytochem 47:
13951404.[Abstract/Free Full Text]
Shinoda K, Ohde H, Mashima Y, Inoue R, Ishida S, Inoue M, Kawashima
S, Oguchi Y (2001) On- and off-responses of the photopic
electroretinograms in X-linked juvenile retinoschisis. Am J
Ophthalmol 131:
489494.[Web of Science][Medline]
Szél Á, van Veen T, Röhlich P
(1994) Retinal cone differentiation. Nature
370: 336.[Medline]
The Retinoschisis Consortium (1998) Functional
implications of the spectrum of mutations found in 234 cases with
X-linked-juvenile retinoschisis. Human Mol Genet
7:
11851192.[Abstract/Free Full Text]
Ueda Y, Iwakabe H, Masu M, Suzuki M, Nakanishi S
(1997) The mGluR6 5'upstream transgene sequence directs a
cell-specific and developmentally regulated expression in retinal rod and
ON-type cone bipolar cells. J Neurosci
17:
30143023.[Abstract/Free Full Text]
Verdier M, Jayat C, Ratinaud H, Troutaud D (2000)
Optimization of cell permeabilization for multiparametric flow cytometric
analysis with lectin staining. Cytometry
41: 5561.[Web of Science][Medline]
Weber BHF, Schrewe H, Molday LL, Gehrig A, White KL, Seeliger MW,
Jaissle GB, Friedburg C, Tamm E, Molday RS (2002) Inactivation of
the murine X-linked juvenile retinoschisis gene, Rs1h, suggests a role of
retinoschisin in retinal cell layer organization and synaptic structure.
Proc Natl Acad Sci USA 99:
62226227.[Abstract/Free Full Text]
Whalley T, Terasaki M, Cho MS, Vogel SS (1995) Direct
membrane retrieval into large vesicles after exocytosis in sea urchin eggs.
J Cell Biol 131:
11831192.[Abstract/Free Full Text]
Willbold E, Reiniche M, Lance-Jones C, Lagenaur C, Lemmon V, Layer
PG (1995) Müller glia stabilizes cell columns during retinal
development: lateral cell migration but not neuropil growth is inhibited in
mixed chick-quail retinospheroids. Eur J Neurosci
7:
22772284.[Web of Science][Medline]
Yanoff M, Rahn EK, Zimmerman LE (1968) Histopathology
of juvenile retinoschisis. Arch Ophthalmol
79: 4953.[Abstract/Free Full Text]
Young RW (1984) Cell death during differentiation of
the retina in the mouse. J Comp Neurol
229:
362373.[Web of Science][Medline]
Young RW (1985) Cell differentiation in the retina of
the mouse. Anat Rec 212:
199205.[Medline]
This article has been cited by other articles:

|
 |

|
 |
 
L. Shi, K. Jian, M. L. Ko, D. Trump, and G. Y.-P. Ko
Retinoschisin, a New Binding Partner for L-type Voltage-gated Calcium Channels in the Retina
J. Biol. Chem.,
February 6, 2009;
284(6):
3966 - 3975.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
T. Langmann, C. C. L. Lai, K. Weigelt, B. M. Tam, R. Warneke-Wittstock, O. L. Moritz, and B. H. F. Weber
CRX controls retinal expression of the X-linked juvenile retinoschisis (RS1) gene
Nucleic Acids Res.,
November 1, 2008;
36(20):
6523 - 6534.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. L. Ko, Y. Liu, L. Shi, D. Trump, and G. Y.-P. Ko
Circadian Regulation of Retinoschisin in the Chick Retina
Invest. Ophthalmol. Vis. Sci.,
April 1, 2008;
49(4):
1615 - 1621.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
L. L. Molday, W. W. H. Wu, and R. S. Molday
Retinoschisin (RS1), the Protein Encoded by the X-linked Retinoschisis Gene, Is Anchored to the Surface of Retinal Photoreceptor and Bipolar Cells through Its Interactions with a Na/K ATPase-SARM1 Complex
J. Biol. Chem.,
November 9, 2007;
282(45):
32792 - 32801.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. K Sikkink, S. Biswas, N. R A Parry, P. E Stanga, and D. Trump
X-linked retinoschisis: an update
J. Med. Genet.,
April 1, 2007;
44(4):
225 - 232.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C. Vijayasarathy, Y. Takada, Y. Zeng, R. A. Bush, and P. A. Sieving
Retinoschisin Is a Peripheral Membrane Protein with Affinity for Anionic Phospholipids and Affected by Divalent Cations
Invest. Ophthalmol. Vis. Sci.,
March 1, 2007;
48(3):
991 - 1000.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
Y.-B. Lu, K. Franze, G. Seifert, C. Steinhauser, F. Kirchhoff, H. Wolburg, J. Guck, P. Janmey, E.-Q. Wei, J. Kas, et al.
Viscoelastic properties of individual glial cells and neurons in the CNS
PNAS,
November 21, 2006;
103(47):
17759 - 17764.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
W. W. H. Wu, J. P. Wong, J. Kast, and R. S. Molday
RS1, a Discoidin Domain-containing Retinal Cell Adhesion Protein Associated with X-linked Retinoschisis, Exists as a Novel Disulfide-linked Octamer
J. Biol. Chem.,
March 18, 2005;
280(11):
10721 - 10730.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
Y. Zeng, Y. Takada, S. Kjellstrom, K. Hiriyanna, A. Tanikawa, E. Wawrousek, N. Smaoui, R. Caruso, R. A. Bush, and P. A. Sieving
RS-1 Gene Delivery to an Adult Rs1h Knockout Mouse Model Restores ERG b-Wave with Reversal of the Electronegative Waveform of X-Linked Retinoschisis
Invest. Ophthalmol. Vis. Sci.,
September 1, 2004;
45(9):
3279 - 3285.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
Y. Takada, R. N. Fariss, A. Tanikawa, Y. Zeng, D. Carper, R. Bush, and P. A. Sieving
A Retinal Neuronal Developmental Wave of Retinoschisin Expression Begins in Ganglion Cells during Layer Formation
Invest. Ophthalmol. Vis. Sci.,
September 1, 2004;
45(9):
3302 - 3312.
[Abstract]
[Full Text]
[PDF]
|
 |
|