The Journal of Neuroscience, July 16, 2003, 23(15):6232-6237
Previous Article | Next Article 
BRIEF COMMUNICATION
Tenascin-R as a Repellent Guidance Molecule for Developing Optic Axons in Zebrafish
Catherina G. Becker,
Jörn Schweitzer,
Julia Feldner,
Thomas Becker, and
Melitta Schachner
Zentrum für Molekulare Neurobiologie Hamburg, Universität
Hamburg, D-20246 Hamburg, Germany
 |
Abstract
|
|---|
To investigate the role of tenascin-R in nervous system development, we
studied axon pathfinding in the developing optic system of zebrafish.
Zebrafish tenascin-R has the same domain structure as tenascin-R in amniotes.
Amino acid sequence identity with human tenascin-R is 60%. In 3-d-old larvae,
tenascin-R mRNA is expressed in scattered cells throughout the periventricular
cell layer of the diencephalon and tectum. Tenascin-R immunoreactivity is not
detectable in the optic nerve, optic tract, or tectal optic neuropil but
immediately borders the optic tract caudally. Reducing expression of
tenascin-R in 3-d-old larvae in vivo by injecting morpholinos into
fertilized eggs led to excessive branching of the optic tract in 86% of all
injected larvae compared with 2037% in controls. Branches were almost
exclusively caudal, where tenascin-R immunoreactivity normally borders the
optic tract, suggesting a role for tenascin-R in guiding optic axons in the
ventral diencephalon by a contact-repellent mechanism.
Key words: extracellular matrix; chondroitin sulfate proteoglycans; semaphorin; slit; axon guidance; Danio rerio
 |
Introduction
|
|---|
Growing axons are guided to their targets via positive and negative cues.
The diversity of axon-repellent molecules of the extracellular matrix, which
keep growing axons away from inappropriate territories, is increasingly
recognized (for review, see Dickson,
2002
). The extracellular matrix molecule tenascin-R, which is
expressed by neurons and oligodendrocytes in the adult CNS, has been known for
some time to have axon-repellent properties in vitro (for review, see
Schachner et al., 1994
;
Jones and Jones, 2000
). For
example, neurites of adult retinal explants
(Becker et al., 2000
), dorsal
root ganglion neurons (Taylor et al.,
1993
), and cerebellar neurons
(Pesheva et al., 1993
) are
repelled by a substrate border of tenascin-R in vitro. Here we
describe for the first time a repellent function of tenascin-R in the guidance
of optic axons in vivo.
 |
Materials and Methods
|
|---|
Animals. Adult (body length, >2 cm; age, >4 months)
zebrafish were kept at a 14/10 hr light/dark cycle and were fed dried fish
food and live brine shrimp. Embryos were collected from our breeding colony
and staged in hours after fertilization at standard temperature (28.5°C)
(Kimmel et al., 1995
).
Molecular cloning. To isolate the zebrafish tenascin-R cDNA, we
performed degenerate reverse transcription-PCR with oligonucleotide primer
sequences [P1, 5'-CGTGGAGGTGCAGTGGGA(R)CC(N)TT)-3'; P2,
5'-GGCGGAGATTCCGACTCC(R)TA(Y)TC(N)GT-3')] based on the conserved
fibronectin type III (FN III)-like domains of human, rat, and chicken
tenascin-R using the Consensus-Degenerate Hybrid Oligonucleotide Primer
program (Rose et al., 1998
). A
degenerate 5' oligonucleotide primer [P3,
5'-GCCTTTCGAGTGCCGG(Y)T(N)GA(R)GT(N)AC-3'] and a gene-specific
3' primer (PS3, 5'-CCACTCCACAAACGCAACCGTGT-3') located in
the most 5' end of the cloned tenascin-R fragment were used to clone a
second gene fragment. To clone the complete gene, 5' rapid amplification
of cDNA ends (RACE) and 3' RACE were performed using the appropriate
kits (Invitrogen, Karlsruhe, Germany).
Northern blot analysis. Northern blot analysis of RNA from adult
zebrafish brain has been described previously
(Schweitzer et al., 2003
). An
-32P-labeled tenascin-R cRNA probe, 500 bp in length, was
generated by PCR using adult brain cDNA as template (N1,
5'-GGTGATTGACAGCGACATTA-3'; N2,
5'-GTCCTTGGTAGAGAAAGG-3'). The tenascin-C probe has been described
previously (Weber et al.,
1998
).
Morpholino injections and analysis of the trajectories of optic
axons. Two morpholinos of non-overlapping sequence (morpholino1,
GCACCCCCACATCACAACTCGGGC; morpholino2, CATCAACTCCACAAATAGACCTCTG) binding to
the 5' untranslated region (UTR) of zebrafish tenascin-R mRNA were
purchased from GeneTools (Corvallis, OR). As a specific control, a morpholino
with a sequence similar to morpholino1, in which four bases were mismatched,
was injected (control morpholino, GCtCCgCCACATCACAACaCGcGC). Morpholinos were
diluted to 1 mM in Danieau solution
(Nasevicius and Ekker, 2000
)
and injected into fertilized eggs (0.51 nl/egg).
To label a part of the optic projection, 3-d-old larvae were anesthetized,
fixed in 4% paraformaldehyde overnight, washed, and embedded in low melting
agarose (1%). A glass needle covered with DiI (Molecular Probes, Eugene, OR)
was inserted into the temporal retina for 20 sec. After incubation at room
temperature overnight, the contralateral eye was removed, larvae were whole
mounted on the injected side, and the optic projection was viewed using a
laser scanning microscope (Zeiss, Oberkochen, Germany). DiI was confined to
the temporal half of the retina. Thirty to 40 optical sections (2 µm in
thickness), comprising the entire optic projection in the brain, were examined
(see Fig. 4).

View larger version (78K):
[in this window]
[in a new window]
|
Figure 4. Morpholino treatment leads to excessive caudal branching of the optic tract
in 3-d-old larvae. A, B, Lateral views of confocal image stacks of
the optic tract in whole-mounted brains, after labeling of the temporal retina
with DiI, correspond to the boxed area in the inset in A. The inset
gives the orientation of the brain with the labeled optic projection indicated
in black (tel, telencephalon; ot, optic tract; tec, tectum; eye, contralateral
eye; the ipsilateral eye was removed before mounting); dorsal is up, and
rostral is left. In a control morpholino-treated larva (A, coMO),
axons are found only in arborization field 3 (AF-3) caudal to the optic tract,
whereas in a morpholino1-treated larva (B, MO1), multiple excessive
branches are seen (arrows). C, D, Examples of entire DiI-labeled
optic projections from one set of experiments are shown for control
morpholino- (C) and morpholino1-treated larvae (D). E,
F, The percentages of larvae with excessively branched optic tracts
(E); the mean numbers of excessive axon branches per larva are given
(F) (uninj, uninjected; coMO, control morpholino; MO1, morpholino1,
MO2, morpholino2). Significant differences from controls are indicated by
asterisks (E, Fisher's exact test, p 0.001; F,
MannWhitney U test, p 0.019). Scale bars: (in
B) A, B, 210 µm; (in D) C, D, 210
µm.
|
|
Optic axons enter the brain ventrally through the chiasm (see
Fig. 2 A). Most axons
run tightly fasciculated through the optic tract toward the optic tectum, in
which they arborize superficially in a retinotopic manner (see
Fig. 2 A)
(Stuermer, 1988
). Along the
optic tract, we observed several arborization fields, which are clusters of
thin, beaded and randomly branched fibers as described by Burrill and Easter
(1994
). Most arborization
fields are located medial of the optic tract. In our observations, the fields
were only visible in single optical sections. They were obscured in image
stacks viewed from a lateral perspective. Arborization field 3 of Burrill and
Easter (1994
) is located
75125 µm caudal to the optic tract and is, therefore, visible in
image stacks (see Fig. 4
A).

View larger version (117K):
[in this window]
[in a new window]
|
Figure 2. Tenascin-R immunoreactivity borders the optic projection in 3-d-old larvae.
A, B, Schematic presentations of the optic projection are shown in a
cross-section in A. The optic projection is represented by one
retinal ganglion cell in red with its soma located in the retina (ret) and its
axon entering the diencephalon (di) through the chiasm, where it crosses the
midline and reaches the superficial optic neuropil of the optic tectum
(tectum) through the optic tract (ot). InB, the ventral optic tract
(red) is indicated in a sagittal section (tel, telencephalon; hb, hindbrain).
Cell-dense areas are depicted in gray. Red lines in dorsal views of whole
heads indicate approximate levels of sectioning. C, D, A
cross-section through a head at the level of the optic chiasm as indicated in
A, double immunolabeled for optic axons (C, green) and
tenascin-R (D, red), is shown. Optic axons are labeled from the optic
fiber layer of the retina (arrow in C) through the chiasm (asterisk
in C) into the ventral diencephalon. Tenascin-R immunoreactivity is
present in the retinal outer plexiform layer (arrows in D) and the
brain. Arrowheads in D indicate nonspecific fluorescence of the lens
and cartilage. E, In a cross-section through the tectum,
corresponding to the boxed area in the inset, tenascin-R immunoreactivity is
found primarily in deep fiber layers. The asterisk indicates the superficial
optic neuropil that is low in tenascin-R immunoreactivity. The arrow indicates
the epidermis overlaying the tectum. FH, A higher
magnification of the section shown in C and D corresponds to
the boxed area in the inset ofF. The optic tract is indicated by
opposing arrows, showing that tenascin-R (G) directly borders optic
axons (F) medially. In H, signals are merged.
IK, In a double-labeled sagittal section through the brain
(oriented as in the boxed area in B), the ventral optic tract is
indicated by an arrow. Tenascin-R immunoreactivity (J) directly
borders optic axons (I) caudally but not rostrally. In K,
signals are merged. Arrows in IK point to the ventral optic
tract. Scale bars: E,50 µm; (in K) C, D, 100
µm and FK, 33 µm.
|
|
We scored the number of axonal branches that grew horizontally away from
the optic tract for >135 µm, either "overshooting"
arborization field 3 or growing parallel to it. These branches were defined as
excessive, because they were not associated with any arborization field. The
branches may contain one or several axons, which cannot be resolved in the
confocal images. Larvae were scored as showing excessively branched optic
tracts only when their labeled tract contained more than one branch longer
than 135 µm. This is a conservative measure to ensure that one branch
growing to arborization field 3 is not mistaken for being excessive. In the
tectum, we analyzed whether axons were located in retinotopically
inappropriate caudal positions and whether they grew from their normal
superficial position into deeper layers in confocal images. To depict at low
magnification the entire projection with thin axon branches leaving it,
composite drawings of individual confocal images from a computer screen (see
Fig. 4C,D) were
used.
Western blot analysis. Western blot analysis using a rabbit
polyclonal antibody to the epidermal growth factor (EGF)-like repeats and the
N-terminal cysteine-rich region of mouse tenascin-R (anti-EGF-L)
(Xiao et al., 1998
), which
specifically reacts with tenascin-R of zebrafish (see Results), was done as
described previously (Becker et al.,
2000
). For immunoblots of morpholino-treated larvae, detergent
lysates of five heads of 3-d-old larvae were pooled for each lane and
separated on an 8% polyacrylamide gel. Stripping and reprobing of blots with
an antibody to tubulin (6-11B-1; Sigma, Deisenhofen, Germany) indicated that
equal amounts of protein were loaded.
In situ hybridization. Digoxigenin-labeled RNA sense and antisense
probes for tenascin-R mRNA were generated from a 700 bp fragment located
within the FN III-like domains or a 3.2 kb C-terminal fragment containing the
3' UTR using the Megascript kit (Ambion, Huntingdon, UK). Nonradioactive
detection of mRNAs in tissue sections (14 µm in thickness) was performed as
described previously (Becker et al.,
2000
). Both antisense probes showed identical results. Sense
probes, developed in parallel under the same conditions, did not show any
labeling (see Fig.
3F).

View larger version (91K):
[in this window]
[in a new window]
|
Figure 3. Effect of morpholinos on tenascin-R immunoreactivity and tenascin-R mRNA
expression in 3-d-old larvae. Cross-sections including the diencephalon (di),
tectum (tec), and part of the retina (ret) correspond to the boxed area in the
inset in F. AD, Arrows depict deep tectal fiber layers, and
arrowheads indicate the outer plexiform layer of the retina. In uninjected
(A, uninj.) and control morpholino-injected (B, coMO)
larvae, tenascin-R immunoreactivity is most intense in the outer plexiform
layer of the retina and high in deep fiber layers of the tectum and
diencephalon. Injection of morpholino1 (C, MO1) more strongly reduces
immunoreactivity than morpholino2 (D, MO2). E, F, Tenascin-R
mRNA is detected by in situ hybridization in scattered cells
throughout the periventricular cell layer of the brain (asterisk) and in a row
of cells in the retina (arrowhead in E) but not after incubation with
a sense RNA probe (F). Arrows in E and F indicate
the retinal pigment epithelium and pigment cells in the epidermis, which
always appear black. Scale bar (in F): AF, 100
µm.
|
|
Immunohistochemistry. Immunolabeling of cryosections, 14 µm in
thickness, of fresh frozen larvae was performed as described previously
(Becker et al., 2000
). To
reveal optic axons, we used the mouse monoclonal linc antibody (Developmental
Studies Hybridoma Bank, Iowa City, IA)
(Steen et al., 1989
) to a
neurofilament-associated antigen. This antibody labels optic axons in
zebrafish, as deduced from comparison with axonal tracing. Other long axon
fascicles, such as the posterior commissure, were also labeled by the
antibody. Because these fascicles were remote from the optic projection, they
could not be confused with the latter. For double immunohistochemistry, the
anti-EGF-L and the linc antibody were applied simultaneously and detected with
the appropriate Cy2- or Cy3-coupled secondary antibodies (Dianova, Hamburg,
Germany).
To semiquantitatively assess expression of tenascin-R in sections of
morpholino-injected animals, photomicrographs were taken with a digital camera
mounted on a fluorescence microscope (Zeiss) using the same exposure times.
Intensity profiles of tectal fiber layers were analyzed using the Zeiss LSM510
software. Fluorescence intensity values were averaged for three larvae (two
sections per larva) per treatment. Maximal intensities in deep tectal fiber
layers of uninjected animals were defined as 100%. Fluorescence intensity in
adjacent unlabeled fiber layers was defined as baseline and subtracted from
the measurements.
 |
Results
|
|---|
Cloning and expression of tenascin-R in zebrafish
The complete open reading frame of tenascin-R encodes a deduced protein of
1351 amino acids (Genbank accession number AY286489
[GenBank]
). The start codon was
predicted from the presence of stop codons preceding the N-terminal end of the
deduced protein and of a signal peptide at the N terminus. The domain
structure of zebrafish tenascin-R comprising a cysteine-rich domain, 4.5 EGF
repeats, 9 FN III-like domains, and 1 fibrinogen globe at the C terminus, is
identical to that of homologs in other vertebrates
(Jones and Jones, 2000
). The
amino acid sequence of zebrafish tenascin-R is
60% identical to those of
tenascin-R in chicken, human, and rat
(http://www.ncbi.nlm.nih.gov/BLAST).
A transcript of 11 kb, which is similar in length to the 12 kb tenascin-R
transcript found in adult mouse brain tissue
(Weber et al., 1999
), was
found in adult zebrafish brain by Northern blot analysis. Reprobing the blot
with a probe to tenascin-C indicated a size of 7 kb for the transcript
(Weber et al., 1998
),
suggesting specificity of the tenascin-R signal
(Fig. 1A).

View larger version (30K):
[in this window]
[in a new window]
|
Figure 1. Tenascin-R mRNA and protein are expressed in zebrafish. A,
Northern blot analysis of total RNA isolated from adult zebrafish brains
yielded a band at 11 kb (lane 1). A probe to tenascin-C labeled a band at 7 kb
(lane 2). Lengths of transcripts are indicated on the left; positions of
molecular markers are indicated on the right. B, Western blot
analysis using anti-EGF-L antibody on detergent lysates of heads of 3-d-old
larvae, separated on the same gel, indicate reduction of immunoreactivity by
morpholino1 and morpholino2 but not by control morpholino. Reprobing of the
blot with an antibody to tubulin is depicted in the bottom row. Molecular
weights of tenascin-R and tubulin are indicated on the right.
|
|
Western blot analysis with anti-EGF-L revealed characteristic double bands
at
160 and 170 kDa for tenascin-R (160 and 180 in mice)
(Bartsch et al., 1993
) in
detergent lysates from heads of 3-d-old larvae
(Fig. 1B) and adult
brains (data not shown). Injecting 1 mM morpholino1 or morpholino2
against tenascin-R into fertilized eggs reduced protein labeling to
undetectable (morpholino1) or lower levels (morpholino2) compared with control
morpholino-injected or uninjected larvae. We conclude that the anti-EGF-L
antibody recognizes the two tenascin-R isoforms in zebrafish and that
tenascin-R mRNA and protein are present in the CNS of zebrafish.
Tenascin-R borders the developing optic projection
Optic fibers first establish retinotopic innervation of the tectum at 3 d
of development (Fig.
2A,B) (Stuermer,
1988
). To analyze the relationship between tenascin-R and optic
axons, we simultaneously labeled optic axons with the linc antibody and
tenascin-R with the anti-EGF-L antibody at 35 d of development
(Fig. 2CK). In
the retina, the outer plexiform layer was conspicuously labeled for
tenascin-R. This evolutionarily conserved pattern of protein labeling and of
corresponding mRNA expression in the adjacent inner nuclear layer, most likely
corresponding to horizontal cells (see below), lays separate from the optic
fiber layer (Bartsch et al.,
1993
). Its functional significance is unknown. We used it here as
a control for the specificity of tenascin-R mRNA and protein detection. The
linc-immunoreactive retinal optic fiber layer, the optic nerve (data not
shown), and tract were tenascin-R immunonegative
(Fig. 2C,D,FK).
In cross-sections through the diencephalon, tenascin-R immunoreactivity
borders the chiasm and optic tract medially
(Fig. 2FH). In
sagittal sections, tenascin-R immunoreactivity can be seen to border the tract
also caudally but not rostrally, where the diencephalic periventricular cell
layer is located (Fig.
2IK) (Wilson
et al., 1990
). Thus, tenascin-R could prevent optic axons from
leaving the optic tract in a mediocaudal direction. In the tectum, deep fiber
layers were more strongly labeled than the superficial optic neuropil
(Fig. 2E). This may
prevent optic axons from invading deeper tectal layers.
Tenascin-R mRNA was intensely labeled in one band of cells located at the
outer margin of the inner nuclear layer of the retina, which is consistent
with the location of horizontal cells, at 35 d of development
(Fig. 3E,F). Synthesis
of tenascin-R in these cells could lead to deposition of this secreted
extracellular matrix molecule via axonal cell surface receptors in the
adjacent outer plexiform layer (Fig.
3A,B). No tenascin-R mRNA was detectable in the optic
nerve or tract, but it was found in scattered cells in the periventricular
cell layer throughout the diencephalon and tectum
(Fig. 3E,F). This mRNA
expression could be related to the widespread immunoreactivity in deep fiber
layers of the diencephalon and tectum.
Reducing tenascin-R expression increases caudal branching of the
optic tract
To see whether morpholino treatment reduces tenascin-R immunoreactivity in
the brain, relative fluorescence intensities in the deep tectal fiber layer
were analyzed in 3-d-old larvae (see Materials and Methods). Morpholino1
reduced the intensity of immunolabeling in the brain to 9 ± 2.3% (SEM)
of that in uninjected controls (100 ± 5.8%). Morpholino2 reduced
labeling to 28 ± 7.8%, whereas control morpholino had no effect (99
± 6.0%). This confirms results from Western blots, which indicated that
morpholino1 was more efficient than morpholino2. Morpholino treatment also
reduced labeling in the retinal outer plexiform layer
(Fig. 3AD). In
5-d-old larvae injected with morpholino1, immunoreactivity was increased again
(data not shown).
We labeled optic axons from the temporal retina with DiI to detect an
effect of the lack of tenascin-R on their projection pattern. Axons were
strongly fasciculated in the ventral optic tract, branched into the optic
radiation in the dorsal diencephalon, and terminated in the retinotopically
appropriate rostral tectum in uninjected and control morpholino-injected
3-d-old larvae (Fig.
4A,C). Axons were consistently observed to branch off the
strongly fasciculated ventral part of the optic tract caudally to form
arborization field 3 of Burrill and Easter
(1994
) (see Materials and
Methods) in confocal image stacks (Fig.
4A). Occasionally, one or more branches of the optic
tract, each containing one or more axons, grew caudally away from the optic
tract and beyond arborization field 3 (at least 135 µm away from the main
optic tract). Such branches have not been reported previously in zebrafish
(Burrill and Easter, 1994
). We
defined these as excessive branches (see Materials and Methods). The incidence
of excessive branches was increased in morpholino-injected larvae
(Fig. 4B,D).
We quantified the number of larvae with excessively branched optic tracts,
defined as tracts with at least two excessive branches (see Materials and
Methods). Morpholino1 induced a statistically significant (Fisher's exact
test) increase in the proportion of larvae with excessively branched optic
tracts (86%; 12 of 14 larvae) compared with uninjected (37%; 5 of 14 larvae;
p = 0.001) and control morpholino-injected (20%; 4 of 20 larvae;
p = 0.0006) larvae (Fig.
4E). There was no statistically significant difference
between uninjected and control morpholino-injected larvae (p >
0.05). The proportion of animals with excessively branched tracts was also
slightly increased after injection of morpholino2 (44%; 7 of 16 larvae; not
significant; p > 0.05).
The number of excessive branches per animal was also significantly
increased (MannWhitney U test) after injection of morpholino1
(4.0 ± 1.19 fascicles per larva) compared with uninjected (1.7 ±
0.65 fascicles per larva; p = 0.019) and control morpholino-injected
(1.3 ± 0.51 fascicles per larva; p = 0.001) larvae
(Fig. 4F). Values for
uninjected and control morpholino-injected larvae did not show statistically
significant differences (p > 0.05). Morpholino2 again showed a
tendency toward increased numbers of excessive branches (2.5 ± 0.87
fascicles per larva), but values did not reach statistical significance
(p > 0.05). Notably, almost all excessive branches that exited
from the optic tract along its entire dorsoventral extent grew caudal (52 of
56 branches in morpholino1-injected larvae).
In addition to the optic tract, we analyzed the optic projection from the
optic nerve through the chiasm up to the tectum using confocal microscopy.
Axons in the chiasm always appeared tightly fasciculated. In the tectum,
labeled axons were found in superficial fiber layers confined to the rostral
tectum in morpholino-treated and control larvae
(Fig. 4C,D),
suggesting that growth in the chiasm, as well as layer-specific growth and
retinotopy of optic axons in the tectum, were not influenced by the morpholino
treatment.
 |
Discussion
|
|---|
The conserved domain structure, high degree of amino acid identity, and
conserved mRNA expression pattern in the inner nuclear layer of the retina
strongly suggest that we cloned a zebrafish homolog of tenascin-R. Reducing
expression of tenascin-R using morpholinos increased caudal branching of the
optic tract in 3-d-old larvae. The incidence of larvae with excessively
branched optic tracts was 86% compared with 20 and 37% in control
morpholino-injected and uninjected larvae, respectively. The number of
excessive branches of the optic projection more than doubled in experimental
larvae (4.0 vs 1.31.7 fascicles per larva in controls). The specificity
of this effect is suggested by several observations. Injection of a control
morpholino, in which 4 of 24 bases had been exchanged, did not show a
significant effect on branching. In larvae injected with a second morpholino
(morpholino2) of non-overlapping sequence with the first morpholino
(morpholino1), the proportion of larvae with excessively branched tracts
(44%), as well as the average number of excessive branches, was also increased
(2.5 fascicles per larva). However, the effect was smaller than that of
morpholino1 and did not reach statistical significance. This is probably
because morpholino2 is not as efficient as morpholino1 in reducing protein
expression, as demonstrated by Western blot and immunohistochemistry. The
difference between the two morpholinos suggests a specific, dose-dependent
effect of tenascin-R. Moreover, the pattern of tenascin-R immunoreactivity
correlates with the direction of the additional branches observed. Tenascin-R
borders the optic tract mediocaudally but not rostrally, and excessive
branches were observed almost exclusively in the caudal direction after
reduction of tenascin-R expression. Excessive medial branches were not
observed, suggesting that, in the absence of tenascin-R, axons may follow
unidentified secondary guidance cues caudally. In uninjected control embryos,
excessive caudal branches of the optic projection were occasionally also
observed (1.7 fascicles per larva). In a previous study, these fibers have not
been found after tracing with horseradish peroxidase and analysis by
conventional light microscopy (Burrill and
Easter, 1994
). Tracing with DiI, in combination with the confocal
microscopy used in this study, may be a more sensitive method. Thus, the
border-like expression pattern in the ventral diencephalon and the pathfinding
errors committed by optic axons in vivo after reduction of tenascin-R
expression suggest a repellent guidance function of the molecule for optic
axons in the developing optic tract.
Additional repellent guidance cues probably cooperate with tenascin-R to
confine the optic tract. For example, rostral to the optic tract, in which
tenascin-R is absent, mRNA of the axon-repellent extracellular matrix molecule
slit3 is detectable by in situ hybridization. In addition, mRNA for a
second member of the slit family (slit2) is expressed rostral and caudal to
the tract (Hutson and Chien,
2002
). Indeed, a mutant zebrafish not expressing Robo2, a receptor
for slits, shows misrouting of optic axons in the ventral diencephalon
(Fricke et al., 2001
).
Slit-deficient mice show similar phenotypes
(Plump et al., 2002
).
Repellent semaphorins anterior to the optic tract may also play a role in
guiding optic axons in Xenopus
(Campbell et al., 2001
).
Expression of additional repellent guidance cues or residual expression of
tenascin-R in morpholino-treated larvae could explain why misrouting of optic
axons into deeper tectal layers, which normally contain higher levels of
tenascin-R than the superficial optic neuropil, was not observed. In summary,
our analysis shows that tenascin-R is involved in pathfinding of optic axons
in the optic tract, probably as a contact-repellent guidance molecule.
 |
Footnotes
|
|---|
Received Mar. 31, 2003;
revised May. 13, 2003;
accepted May. 16, 2003.
This work was supported by Deutsche Forschungsgemeinschaft Grant Be1654/3.
We thank Drs. Udo Bartsch, Chi-Bin Chien, and Lara Hutson for helpful
discussions. We are grateful to Laura Sander for correcting the English and
Angelika Nest for excellent fish care.
Correspondence should be addressed to Dr. Catherina G. Becker, Zentrum
für Molekulare Neurobiologie Hamburg, Universität Hamburg,
Martinistrasse 52, D-20246 Hamburg, Germany. E-mail:
tcbecker{at}zmnh.unihamburg.de.
Copyright © 2003 Society for Neuroscience
0270-6474/03/236232-06$15.00/0
 |
References
|
|---|
Bartsch U, Pesheva P, Raff M, Schachner M (1993)
Expression of janusin (J1160/180) in the retina and optic nerve of the
developing and adult mouse. Glia 9:
5769.[Web of Science][Medline]
Becker T, Anliker B, Becker CG, Taylor J, Schachner M, Meyer RL,
Bartsch U (2000) Tenascin-R inhibits regrowth of optic fibers in
vitro and persists in the optic nerve of mice after injury.
Glia 29:
330346.[Web of Science][Medline]
Burrill JD, Easter SS (1994) Development of the
retinofugal projections in the embryonic and larval zebrafish (Brachydanio
rerio). J Comp Neurol 346:
583600.[Web of Science][Medline]
Campbell DS, Regan AG, Lopez JS, Tannahill D, Harris WA, Holt CE
(2001) Semaphorin 3a elicits stage-dependent collapse, turning,
and branching in Xenopus retinal growth cones. J
Neurosci 21:
85388547.[Abstract/Free Full Text]
Dickson BJ (2002) Molecular mechanisms of axon
guidance. Science 298:
19591964.[Abstract/Free Full Text]
Fricke C, Lee JS, Geiger-Rudolph S, Bonhoeffer F, Chien CB
(2001) Astray, a zebrafish roundabout homolog required for
retinal axon guidance. Science 292:
507510.[Abstract/Free Full Text]
Hutson LD, Chien CB (2002) Pathfinding and error
correction by retinal axons: the role of astray/robo2. Neuron
33: 205217.[Web of Science][Medline]
Jones FS, Jones PL (2000) The tenascin family of ECM
glycoproteins: structure, function, and regulation during embryonic
development and tissue remodeling. Dev Dyn
218:
235259.[Web of Science][Medline]
Kimmel CB, Ballard WW, Kimmel SR, Ullmann B, Schilling TF
(1995) Stages of embryonic development of the zebrafish.
Dev Dyn 203:
253310.[Web of Science][Medline]
Nasevicius A, Ekker SC (2000) Effective targeted gene
"knockdown" in zebrafish. Nat Genet
26: 216220.[Web of Science][Medline]
Pesheva P, Gennarini G, Goridis C, Schachner M (1993)
The F3/11 cell adhesion molecule mediates the repulsion of neurons by the
extracellular matrix glycoprotein J1160/180. Neuron
10: 6982.[Web of Science][Medline]
Plump AS, Erskine L, Sabatier C, Brose K, Epstein CJ, Goodman CS,
Mason CA, Tessier-Lavigne M (2002) Slit1 and Slit2 cooperate to
prevent premature midline crossing of retinal axons in the mouse visual
system. Neuron 33:
219232.[Web of Science][Medline]
Rose TM, Schultz ER, Henikoff JG, Pietrokovski S, McCallum CM,
Henikoff S (1998) Consensus-degenerate hybrid oligonucleotide
primers for amplification of distantly related sequences. Nucleic Acids
Res 26:
16281635.[Abstract/Free Full Text]
Schachner M, Taylor J, Bartsch U, Pesheva P (1994) The
perplexing multi-functionality of janusin, a tenascin-related molecule.
Perspect Dev Neurobiol 2:
3341.[Web of Science][Medline]
Schweitzer J, Becker T, Becker CG, Schachner M (2003)
Expression of protein zero is increased in lesioned axon pathways in the
central nervous system of adult zebrafish. Glia
41: 301317.[Web of Science][Medline]
Steen P, Kalghatgi L, Constantine-Paton M (1989)
Monoclonal antibody markers for amphibian oligodendrocytes and neurons.
J Comp Neurol 289:
467480.[Web of Science][Medline]
Stuermer CA (1988) Retinotopic organization of the
developing retinotectal projection in the zebrafish embryo. J
Neurosci 8:
45134530.[Abstract]
Taylor J, Pesheva P, Schachner M (1993) Influence of
janusin and tenascin on growth cone behavior in vitro. J Neurosci
Res 35:
347362.[Web of Science][Medline]
Weber P, Montag D, Schachner M, Bernhardt RR (1998)
Zebrafish tenascin-W, a new member of the tenascin family. J
Neurobiol 35:
116.[Web of Science][Medline]
Weber P, Bartsch U, Rasband MN, Czaniera R, Lang Y, Bluethmann H,
Margolis RU, Levinson SR, Shrager P, Montag D, Schachner M (1999)
Mice deficient for tenascin-R display alterations of the extracellular matrix
and decreased axonal conduction velocities in the CNS. J
Neurosci 19:
42454262.[Abstract/Free Full Text]
Wilson SW, Ross LS, Parrett T, Easter SS Jr (1990) The
development of a simple scaffold of axon tracts in the brain of the embryonic
zebrafish, Brachydanio rerio. Development
108:
121145.[Abstract]
Xiao ZC, Revest JM, Laeng P, Rougon G, Schachner M, Montag D
(1998) Defasciculation of neurites is mediated by tenascin-R and
its neuronal receptor F3/11. J Neurosci Res
52: 390404.[Web of Science][Medline]
This article has been cited by other articles:

|
 |

|
 |
 
I. Apostolova, A. Irintchev, and M. Schachner
Tenascin-R restricts posttraumatic remodeling of motoneuron innervation and functional recovery after spinal cord injury in adult mice.
J. Neurosci.,
July 26, 2006;
26(30):
7849 - 7859.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
T. Xiao, T. Roeser, W. Staub, and H. Baier
A GFP-based genetic screen reveals mutations that disrupt the architecture of the zebrafish retinotectal projection
Development,
July 1, 2005;
132(13):
2955 - 2967.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
F. de Winter, Q. Cui, N. Symons, J. Verhaagen, and A. R. Harvey
Expression of Class-3 Semaphorins and Their Receptors in the Neonatal and Adult Rat Retina
Invest. Ophthalmol. Vis. Sci.,
December 1, 2004;
45(12):
4554 - 4562.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C. G. Becker, B. C. Lieberoth, F. Morellini, J. Feldner, T. Becker, and M. Schachner
L1.1 Is Involved in Spinal Cord Regeneration in Adult Zebrafish
J. Neurosci.,
September 8, 2004;
24(36):
7837 - 7842.
[Abstract]
[Full Text]
[PDF]
|
 |
|