The Journal of Neuroscience, July 23, 2003, 23(16):6460-6469
Previous Article | Next Article 
Contribution of TWIK-Related Acid-Sensitive K+ Channel 1 (TASK1) and TASK3 Channels to the Control of Activity Modes in Thalamocortical Neurons
Sven G. Meuth, *
Thomas Budde, *
Tatyana Kanyshkova,
Tilman Broicher,
Thomas Munsch, and
Hans-Christian Pape
Institute of Physiology, Otto-von-Guericke-Universität, D-39120
Magdeburg, Germany
 |
Abstract
|
|---|
The thalamocortical network is characterized by rhythmic burst activity
during natural sleep and tonic single-spike activity during wakefulness. The
change between these two activity modes is partially governed by transmitters
acting on leak K+ currents in the thalamus, although the nature of
the constituting ion channels is not yet known. In the present study, the
contribution of members of the two-pore domain K+ channel family to
the leak current was investigated using whole-cell patch-clamp techniques and
molecular biological techniques. RT-PCR and in situ hybridization
revealed the expression of TWIK-related acid-sensitive K+ channel 1 (TASK 1) and TASK3 channels in the rat dLGN.
Voltage-clamp recordings of thalamocortical relay neurons in slice
preparations demonstrated the existence of a current component sensitive to
the TASK channel blocker bupivacaine, which reversed at the presumed
K+ equilibrium potential, showed outward rectification, and
contributed
40% to the standing outward current at depolarized values of
the membrane potential (-28 mV). The pharmacological profile was indicative of
TASK channels, in that the current was sensitive to changes in extracellular
pH, reduced by muscarine and increased by halothane, and these effects were
occluded by a near-maximal action of bupivacaine. Pharmacological manipulation
of this current under current-clamp conditions resulted in a shift between
burst and tonic firing modes. It is concluded that TASK1 and TASK3 channels
contribute to the muscarine- and halothane-sensitive conductance in
thalamocortical relay neurons, thereby contributing to the change in the
activity mode of thalamocortical networks observed during the sleep-wake cycle
and on application of inhalational anesthetics.
Key words: whole-cell patch clamp; RT-PCR; in situ hybridization; thalamic activity mode; anesthetics; muscarinic receptor; sleep-wake cycle
 |
Introduction
|
|---|
The thalamocortical neuronal network is characterized by two fundamentally
different states of activity (for review, see
Sherman and Guillery, 1996
;
Steriade, 1997
): whereas
low-frequency (<15 Hz) oscillatory activity occurs during natural sleep,
deep anesthesia, and epileptic seizures, high-frequency oscillatory activity
in the gamma range and tonic activity prevail during wakefulness. On the
cellular level, slow oscillatory activity is associated with rhythmic bursts
of action potentials in thalamocortical relay neurons, whereas tonic activity
is associated with sequences of single-action potentials. The latter is
thought to underlie the faithful transfer of sensory information from the
periphery to the cortex (Sherman and
Guillery, 2001
). The switch between the two states of thalamic
activity is accompanied by a depolarizing shift of the membrane potential of
thalamocortical relay neurons and governed by the release of neurotransmitters
from thalamic terminals of the ascending brainstem system during wakeup (for
review, see McCormick, 1992b): ACh, noradrenalin, and 5-HT are released during
increased activity of neurons whose cell bodies are located in brainstem
cholinergic nuclei, the locus coeruleus, and the raphe nuclei, respectively.
One crucial step leading to depolarization of thalamocortical relay neurons is
the decrease of a leak K+ conductance (IKL), for
instance, on activation of muscarinic (mACh) and
-adrenergic receptors
(McCormick and Prince, 1987
,
1988
). In addition,
inhalational anesthetics hyperpolarize the membrane potential and decrease the
excitability of thalamocortical neurons through a conductance shunt by rising
a IKL (Ries and Puil,
1999a
,b
).
Until now, the molecular nature of the channels underlying the IKL
in thalamocortical neurons is unknown.
IKL are crucial in stabilizing the resting potential in most
neurons. With the discovery of a novel family of two-pore domain (2P)
K+ channels, molecular correlates of K+ background
conductances have been identified in various types of cells (for review, see
Goldstein et al., 2001
). Their
name relates to the membrane topology of the channel subunits:
two-pore-forming P domains, flanked by four transmembrane regions, are
arranged in tandem. Functionally, most 2P K+ channels give rise to
time- and voltage-independent K+ background currents. Channel
activity is regulated in a complex way by various stimuli (e.g., temperature,
pH, phospholipids, anesthetics). Some family members are further inhibited by
G-protein-mediated signaling cascades. On the basis of their sensitivity to
extracellular pH and sequence homology, pH-dependent 2P K+ channels
are classified as acidosis inhibited (TWIK-related acid-sensitive K+ channel 1 (TASK1), TASK3, TASK5) and alkalosis
activated (TASK2, TASK4/TWIK-related acid-sensitive K+ channel 1 (TALK1), TALK2)
(Brown, 2000
;
Karschin et al., 2001
;
Lesage, 2003
). In three
neuronal cell types of the mammalian CNS, the transmitter-sensitive resting
current has been narrowed down to the species of TASK1 channels
(Millar et al., 2000
;
Talley et al., 2000
) and, in
addition, TASK3 channels (Han et al.,
2002
; Washburn et al.,
2002
).
The present study combines molecular biological and electrophysiological
techniques to investigate the possible contribution of TASK channels to
K+ background current in thalamocortical relay neurons in the dLGN,
the major thalamic station of the primary visual pathway.
 |
Materials and Methods
|
|---|
Preparation. Rats (postnatal days 12-20) were anesthetized with
halothane and decapitated. A block of tissue containing the thalamus was
removed and placed in ice-cold saline containing (mM): sucrose,
200; PIPES, 20; KCl, 2.5; NaH2PO4, 1.25;
MgSO4, 10; CaCl2, 0.5; dextrose, 10; pH 7.35, with NaOH.
Thalamic slices were prepared as coronal sections on a vibratome. Before
recording, slices were kept submerged in standard ACSF containing
(mM): NaCl, 125; KCl, 2.5; NaH2PO4, 1.25;
NaHCO3, 24; MgSO4, 2; CaCl2, 2; dextrose, 10;
pH adjusted to 7.35 by bubbling with a mixture of 95% O2 and 5%
CO2.
Whole-cell patch clamp. Recordings were performed on
thalamocortical relay neurons of the dLGN at room temperature. Slices were
recorded in a solution containing: NaCl, 120; KCl, 2.5;
NaH2PO4, 1.25; HEPES, 30; MgSO4, 2;
CaCl2, 2; dextrose, 10; pH 7.2 or 6.4 was adjusted with HCl.
Individual cells were visually identified by infrared differential
interference contrast video-microscopy
(Dodt and Zieglgänsberger,
1990
). Membrane currents were measured with pipettes pulled from
borosilicate glass (GC150T-10; Clark Electromedical Instruments, Pangbourne,
UK), connected to an EPC-10 amplifier (HEKA Elektronik, Lamprecht, Germany),
and filled with (in mM): K-gluconate, 95; K3-citrate,
20; NaCl, 10; HEPES, 10; MgCl2, 1; Ca Cl2, 0.5; BAPTA,
1; Mg-ATP, 3; and Na-GTP, 0.5. The internal solution was set to a pH of 7.25
with KOH and an osmolarity of 295 mOsm/kg.
Some experiments were performed in nominal Na+-free external and
internal solutions of the following composition (mM): (1) external
solution: N-methyl-D-glucamine (NMDG)-Cl, 100; KCl, 2.5; KH2PO4, 1.25; HEPES,
30; MgSO4, 3.5; Ca Cl2, 0.5; dextrose, 10; TEA-Cl, 20;
4-AP, 6; pH 7.2 or 6.4 was adjusted with HCl; (2) internal solution:
K-gluconate, 95; K3-citrate, 20; NMDGCl, 10; HEPES, 10;
MgCl2, 1; Ca Cl2, 0.5; BAPTA, 1; Mg-ATP, 3. The internal
solution was set to a pH of 7.25 with KOH and an osmolarity of 295
mOsm/kg.
For current-clamp experiments, a pipette solution containing 5
mM EGTA and 0.5 mM CaCl2 was used. Typical
electrode resistance was 2-3 M
, with an access resistance in the range
of 5-15 M
. Series resistance compensation of >40% was routinely
used. Voltage-clamp experiments were governed by Pulse software (HEKA
Elektronik) operating on an IBM-compatible personal computer. A liquid
junction potential of 8 ± 1 mV (n = 6) was measured and taken
into account according to Neher (1992).
For recordings of high-voltage-activated Ca2+
(Meuth et al., 2002
) and fast
transient Na+ currents (Budde
and White, 1998
) in acutely isolated neurons, isolation procedures
and recording conditions were used as described previously.
All results were presented as mean ± SEM. Substance effects were
tested for statistical significance using the nonparametric Mann-Whitney test
(Graph Pad Prism software; Graph Pad, San Diego, CA). Where applicable
(because of a sufficient number of observations, a Gaussian distribution could
be demonstrated for the amplitude of the standing outward current, the effect
of extracellular acidification, and the effect of bupivacaine), the parametric
t test was used (Origin software). Differences were considered
statistically significant if p < 0.05.
Drugs. Bupivacaine and muscarine were obtained from Sigma
(Deisenhofen, Germany), prepared as stock solutions in distilled water, and
added to the perfusion medium. Halothane was administered by perfusion. One
percent of fluothane (Zeneca, Plankstadt, Germany) was added to the
extracellular solution at room temperature, followed by 1-min sonication. For
comparison of halothane concentrations used in situ with those used
for anesthesia in vivo, the study by Ries and Puil
(1999a
) offers some
considerations.
In situ hybridization. Long-Evans rats (18-21 d old) were
sacrificed as described previously, and complete brains were frozen in
-50°C isopentane. Cryostat coronal sections of 14 µm thickness were cut
at the level of the dLGN, thaw-mounted onto silane-coated slide glasses, and
air dried.
Digoxigenin-labeled antisense and sense riboprobes were generated by in
vitro transcription from vectors containing cDNA of rat TASK1 channels
(corresponding to bp 574-1242) and TASK3 channels (bp 502-1431). In
situ hybridization was performed as described previously
(Stork et al., 2000
) with
minor modifications. In brief, sections were washed in 3x PBS for 5 min
after fixation in 4% paraformaldehyde, acetylated, and prehybridized for 2 hr
at 55°C. The prehybridization solution consisted of 50% formamide,
5x SSC, 1x Denhardt's solution, 0.5 mg/ml yeast tRNA, and 1.0
mg/ml total yeast RNA. For hybridization, sections were exposed to 50%
formamide, 1x Denhardt's solution, 0.1 mg/ml yeast tRNA, 0.1 mg/ml total
yeast RNA, 10% Dextran sulfate, 0.125% SDS, 10 mM Tris-HCl, pH 7.5,
1 mM EDTA, and 300 mM NaCl. Digoxigenin-labeled RNA
probes were added (with a final concentration of 20 ng/ml prehybridization
buffer), and sections were incubated at 55°C for 16-18 hr. For all steps,
RNase-free solutions and sterile 6-well plates were used. After hybridization,
sections were subjected to washes of increasing stringency including 2x
SSC at room temperature (once for 15 min), 50% formamide/2x SSC at
70°C (twice for 60 min), 2x 50% formamide/0.2x SSC at 70°C
(twice for 60 min), and 0.1x SSC at 70°C (once for 60 min). Labeled
cells were detected with an anti-digoxigenin antibody tagged with alkaline
phosphatase (Roche Molecular Biochemicals, Mannheim, Germany). Staining was
performed using 4-nitro blue tetrazolium chloride and
5-bromo-4-chloro-3-indolyl phosphate as substrates (Roche Molecular
Biochemicals).
Specificity of the hybridization reaction was verified by substituting
labeled sense probes for the antisense probes. No labeling was observed under
these conditions. The density of positively labeled cells was determined using
the NeuroLucida system.
RT-PCR assays. Poly(A) mRNA was prepared
from freshly dissected tissue by extraction with Trizol reagent according to
the manufacturer's instructions (Oligotex; Qiagen GmbH, Hilden, Germany).
First-strand cDNA was primed with oligo(dT) from 0.5-1 µg of mRNA and
synthesized using the SuperScript II enzyme (Gibco BRL Life Technologies,
Karlsruhe, Germany) at 42°C for 50 min. The cDNAs from different tissues
were amplified with 0.75 U of HotStarTag polymerase (Qiagen GmbH), 1.5
mM MgCl2, and 0.2 mM of each dNTP in 30
reaction mixture using 50 pmol of forward and reverse specific oligonucleotide
primers. For amplification of TASK templates, the initial cDNA concentration
(1 ng) was 10 times higher as for the other cDNA species. Amplification
protocols included 35 cycles of 95°C for 1 min, Tann for 1 min,
and 72°C for 1 min after predenaturation at 95°C for 15 min. The
annealing temperature Tann was calculated for every primer pair
from G/C and A/T content of the primers used in each reaction. Normalization
of cDNAs was done using primers specific for the housekeeping genes
-actin and glyceraldehyde-3-phosphate dehydrogenase (GAPDH). The
following primers were used:
-actin (nt 253-1080; accession no.
NM_031144
[GenBank]
), forward ATTTGGCACCACACTTTCTACAAT, reverse CTGCTTGCTGATCCACATCTGC;
GAPDH (nt 561-1012; accession no. AB017801
[GenBank]
), forward ACCACAGTCCATGCCATCAC,
reverse TCCACCACCCTGTTGCTGTA; Kir 3.4 (nt 358-888; accession no. X83584
[GenBank]
),
forward CACGTGGGTGACCAAGAGTG, reverse CTGCTCCAGTTGAGCACGAG; Kir 3.3 (nt
522-1058; accession no. L77929
[GenBank]
), forward CACCTGGAGGACACCGCGTG, reverse
GTCGTCCCTCTCGAGGGCGC; Kir 3.2 (nt 121-390; accession no. X83583
[GenBank]
), forward
GACCTGCCAAGACACATCAGCC, reverse CGAGGGGTCCTCTATGTGGTCCA; Kir 3.1 (nt 124-436;
accession no. U01141
[GenBank]
), forward TCGTCCAGCGGTTCGGGCTTGCAG, reverse
GAGTGTAGTTGCCGACATGGGC; Kir 2.3 (nt 623-952; accession no. X87635
[GenBank]
), forward
CAGGCCCACGTGCCCAGGCGGA, reverse TACATGCATGATACACGGTTTG; mAChR2 (nt 1133-1501;
accession no. J03025
[GenBank]
), forward CAAGACCCAGTATCTCCAAGTCTG, reverse
CGACGACCCAACTAGTTCTACAGT; mAChR3 (nt 854-1414; accession no. M16407
[GenBank]
), forward
ACAGAAGCGGAGGCAGAAAACTTT, reverse CTTGAAGGACAGAGGTAGAGTAGC; TASK1 (nt 220-735;
accession no. AB048823
[GenBank]
), forward CACCGTCATCACCACAATCG, reverse
TGCTCTGCATCACGCTTCTC; TASK2 (nt 330-959; accession no. AF259395
[GenBank]
), forward
TGGGCGCCTCTTCTGTGTCTTCTA, reverse TCCCCTCCCCCACTTGTTTTCATT; TASK3 (nt 188-602;
accession no. AF192366
[GenBank]
), forward ATGAGATGCGCGAGGAGGAGAAAC, reverse
ACGAGGCCCATGCAAGAAAAGAAG; TASK5 (nt 137-700; accession no. AF294353
[GenBank]
), forward
GAGCCTGGGCGAGCGTCTGAAC, reverse CGGGCCCGGAGTCTGTCTGG.
 |
Results
|
|---|
Expression of TASK channels, inward rectifier K+ channels,
and mACh receptor subtypes
Using a RT-PCR assay of rat dLGN tissue, PCR fragments from TASK1 and TASK3
were detected in significant amounts in the dLGN, whereas only faint bands
were seen for TASK2 (Fig.
1A). For TASK5, no PCR product was detected in the dLGN,
whereas cerebellar cDNA used as positive control
(Karschin et al., 2001
)
revealed a clear expression signal (Fig.
1B). The expression of TASK4 in dLGN could not be tested,
because of the lack of a complete rat mRNA sequence.

View larger version (37K):
[in this window]
[in a new window]
|
Figure 1. RT-PCR analysis of different rat brain regions. A, Expression of
TASK1-3 and Kir2.3 channels in dLGN. B, Expression of TASK5 channels
in dLGN and cerebellum. C, Expression of Kir3.1-3.4 channels and ACh receptors (m2-m3AchR) in dLGN. The sizes of the DNA
marker bands are indicated in the left margin. When H2O and brain
mRNA not subjected to reverse transcription were used as negative controls
instead of cDNA, no PCR bands could be detected because of the lack of
adequate substrates for the DNA polymerase (data not shown).
|
|
An analysis of inward rectifier K+ (Kir) channel expression in
dLGN revealed the presence of Kir2.3 (Fig.
1A) and all four members of the Kir3 family (Kir3.1-3.4;
Fig. 1C), although the
signal for Kir3.4 was very faint. In addition, PCR products for
m2ACh and m3ACh receptors were detected
(Fig. 1C). These data
demonstrate the presence of Kir channels sensitive to changes in extracellular
pH (Kir2.3) and modulated via mACh receptors (Kir3 family).
In situ hybridization techniques using digoxigenin-labeled
antisense RNA probes revealed a dense distribution of cells expressing TASK1
(Fig. 2A) and TASK3
(Fig. 2B) in the dLGN.
Positively labeled cells were found in a density of 542 ± 32
cells/mm2 and 729 ± 24 cells/mm2 (n = 6)
for TASK1 and TASK3, respectively. Nissl-stained sections were used to assess
the overall density of neurons. The average cell density in Nissl staining was
808 ± 31 cells/mm2 (n = 6), indicating that 67 and
90% of the cells express TASK1 and TASK3, respectively, thereby providing
evidence for at least partial overlapping expression. Control experiments
using a sense cRNA construct showed no signals (data not shown). Assuming
similar efficiencies of the two antisense RNA probes, TASK3 expression was at
a higher level compared with TASK1, corresponding to the difference in
intensity of RTPCR bands obtained for TASK1 and TASK3 channels
(Fig. 1A).

View larger version (149K):
[in this window]
[in a new window]
|
Figure 2. Expression of TASK channel transcripts in dLGN. In situ
hybridization was performed on sections of the rat brain using
digoxigenin-labeled RNA probes complementary to TASK1 (A) and TASK3
(B). Coronal sections of the thalamus show moderate expression levels
of TASK1 and high levels of TASK3 expression at different magnification. DG,
Dentate gyrus; VB, ventrobasal thalamic complex.
|
|
Pharmacological profile of the leak conductance in thalamocortical
relay neurons
At holding potentials between -58 and -68 mV, thalamocortical relay neurons
displayed a standing outward current with an amplitude of 71 ± 4 pA
(n = 10) (cf. Budde et al.,
1997
). In a first experimental step, a pharmacological profile of
this current was obtained by application of ions (H+,
Ba2+) known to block TASK channels. Lowering the
extracellular pH from 7.2 to 6.4 and further application of
Ba2+(150 µM) resulted in a two-stage
reduction of the outward current (data not shown). In addition, when
bupivacaine (20 µM) was added to the control recording solution,
the standing outward current was greatly reduced, revealing current amplitudes
of 29 ± 3 pA (n = 7; data not shown).
To increase outward current amplitudes, recordings were obtained at more
depolarized values of the membrane potential. At -28 mV, the standing outward
current averaged 348 ± 11 pA (n = 89). Stepping the membrane
potential from -28 to -68 mV for a duration of 500 msec every 20 sec resulted
in a step-wise decrease in membrane outward current
(Fig. 3A, inset),
indicating the presence of channels with fast gating properties. Changing the
external pH from 7.2 to 6.4 induced a decrease of the current at -28 mV by 41
± 3% (n = 4; Fig.
3A). The addition of Ba2+ (150
µM; Fig.
3A) lead to an additional decrease by 47 ± 5% of
the remaining current (n = 4), respectively. These drug effects were
statistically significant with respect to the previous recording condition
(p < 0.004). The opposite experimental approach with applying
Ba2+ (150 µM;
Fig. 3B) before
lowering the external pH resulted in a significant (p < 0.0001)
decrease in the standing outward current amplitude by 49 ± 4%
(n = 4). Thereafter, external acidification had no significant
(p = 0.49) effect on the current amplitude. The current-voltage
(I-V) relationship of the Ba2+-sensitive
current during extracellular acidification was obtained by ramping the
membrane potential in 800 msec from -30 mV to -120 mV
(Fig. 3C). The data
were obtained by subtraction of the currents obtained in the presence of
Ba2+ at pH 6.4 (Fig.
3C, inset, gray trace, 2) from those recorded at pH 6.4
(Fig. 3C, inset, black
trace, 1). The I-V relationship was characterized by an inward
rectification and a reversal potential of -102 ± 2 mV (n = 3;
Fig. 3C), i.e., close
to the expected K+ equilibrium potential (EK = -104
mV).

View larger version (25K):
[in this window]
[in a new window]
|
Figure 3. Effects of Ba2+ and extracellular acidification on
the standing outward current in thalamocortical relay neurons. A, B,
Amplitude of the net outward current plotted against time in one relay neuron
recorded under voltage-clamp conditions at -28 mV (black data points). Periods
of extracellular acidification, pH 6.4, and application of
Ba2+ (150 µM) are indicated by horizontal
lines. Insets, Original traces of membrane responses to a voltage step from a
holding potential of -28 mV to -68 mV for 500 msec under control conditions
(1) and application of drugs (A: 2 = pH 6.4, 3 = pH 6.4,
Ba2+; B: 2 = Ba2+, 3 =
Ba2+, pH 6.4). In B, current traces recorded in
Ba2+ and Ba2+ at pH 6.4 are
indistinguishable. C, I-V relationship of the
Ba2+-sensitive current obtained by graphical subtraction
of ramp currents during Ba2+ action at pH 6.4 from
currents recorded at pH 6.4 (see term near trace). Inset, Currents evoked by
ramping the membrane from -30 mV to -120 mV over 800 msec at pH 6.4 (black
trace) and application of Ba2+ at pH 6.4 (gray trace).
Scale bars in the insets: A, B, 200 msec/100 pA; C, 100
msec/500 pA.
|
|
These results demonstrate the presence of a pH-sensitive component that can
be blocked by Ba2+, which is indicative of TASK
channels, and are in agreement with the contribution of inward rectifier
channels to the standing outward current in thalamocortical neurons.
Outward current indicative of TASK channels
In a next experimental step, the possible contribution of TASK channels to
the standing outward current was tested by analyzing the pH-sensitive
component in more detail. Throughout the experiments, ZD 7288 was present to
eliminate possible contamination by pH-sensitive Ih channels
(Munsch and Pape, 1999
).
Changing the external pH from 7.2 to 6.4 significantly (p <
0.0001) reduced the outward current at -28 mV by 40 ± 2% (n =
35; Fig. 4A). This
effect was fully reversible (Fig.
4B) and in some cells was accompanied by a positive
overshoot of the current beyond control value (data not shown).
Current-voltage relationships were obtained by ramping the membrane potential
in 800 msec from -30 mV to -120 mV (Fig.
4C). The rate of hyperpolarization (0.11 mV/ms) was
sufficiently slow to allow the outward current to reach steady state at each
potential (cf. Watkins and Mathie,
1996
; Millar et al.,
2000
). The I-V relationship obtained by subtracting
currents evoked in solutions at pH 6.4
(Fig. 4C, gray trace)
from those at pH 7.2 (Fig.
4C, black trace) revealed a reversal potential close to
EK (Vrev = -103 ± 2 mV; n = 3) and
outward rectification (Fig.
4D).

View larger version (29K):
[in this window]
[in a new window]
|
Figure 4. Analysis of the pH-sensitive current component. A, Original traces
of membrane responses to a voltage step from a holding potential of -28 mV to
-68 mV for 500 msec at pH 7.2 and pH 6.4 (as indicated near traces).
B, Plot of the current amplitude at -28 mV against time (period of
extracellular acidification indicated by horizontal bar). C, Currents
evoked by ramping the membrane potential from -30 mV to -120 mV over 800 msec
at pH 7.2 (black trace) and pH 6.4 (gray trace). D, I-V relationship
of the pH-sensitive current obtained by graphical subtraction of ramp currents
recorded at pH 6.4 from pH 7.2 (see term near trace).
|
|
In the following, the local anesthetic bupivacaine, which is known to block
TASK channels, was used (Leonoudakis et
al., 1998
; Kindler et al.,
1999
; Brown, 2000
;
Goldstein et al., 2001
;
Meadows and Randall, 2001
).
During application of bupivacaine at different concentrations, the standing
outward current at -28 mV was significantly (p < 0.03) reduced by
12 ± 4% (5 µM, n = 3; data not shown), 38
± 3% (20 µM, n = 29;
Fig. 5A), and 28
± 4% (50 µM, n = 5; data not shown). These
effects were only partially reversible
(Fig. 5A) and not
significantly (p = 0.06) different between 20 and 50
µM. For comparison, the effect of bupivacaine (20
µM) was tested on the fast transient outward K+
current (cf. Budde et al.,
1992
) in the slice preparation, as well as fast Na+
currents (cf. Budde and White,
1998
) and high-voltage-activated Ca2+
currents (cf. Meuth et al.,
2002
) after acute isolation. The reduction of the transient
K+ currents (9 ± 2%; n = 6), Na+
currents (11 ± 4%; n = 3), and Ca2+
currents (6 ± 2%; n = 5) were significantly (p <
0.005) smaller as compared with the standing outward current (data not shown).
These data indicate a maximal blocking effect of bupivacaine on the standing
outward current, together with minor effects on other currents, at a
concentration of 20 µM, and, thus, bupivacaine at this
concentration was used in the following. It is notable that, in three of 18
cells, application of bupivacaine resulted in a
10% increase in the
outward current at -28 mV. These cells were not included for analysis.

View larger version (33K):
[in this window]
[in a new window]
|
Figure 5. Current components sensitive to application of bupivacaine (20
µM) and changes in pH during action of bupivacaine. A, C,
D, Plot of current amplitude at -28 mV against time (drug application
indicated by horizontal bar). Insets, Original traces of membrane responses to
a voltage step from a holding potential of -28 mV to -68 mV for 500 msec under
control conditions (con, 1) and lowering pH and/or application of drugs (as
indicated near traces; C: 2 = bupivacaine, 3 = bupivacaine, pH 6.4).
In C, current traces recorded in bupivacaine (bupi) at pH 7.2 and pH
6.4 are indistinguishable. B, I-V relationship of the
bupivacaine-sensitive current obtained by graphical subtraction of currents
during drug action from control currents (see term near trace). Inset,
Currents evoked by ramping the membrane from -30 mV to -120 mV over 800 msec
under control conditions (black trace) and in the presence of bupivacaine
(gray trace). Scale bars in the insets: A, 200 msec/200 pA;
B, 100 msec/300 pA; C, 100 msec/150 pA.
|
|
Current-voltage relationships of bupivacaine-sensitive currents
(Fig. 5B) were
obtained by ramp protocols and graphical subtraction of the currents obtained
during bupivacaine (Fig.
5B, inset, gray trace) from those under control
conditions (Fig. 5B,
inset, black trace). The I-V relationship revealed a reversal
potential of -103 ± 1mV (n = 9;
Fig. 5B), i.e., close
to the expected K+ equilibrium potential (EK = -104 mV),
outward rectification, and was, thus, very similar to the pH-sensitive ramp
currents. Next, the effect of external acidification was tested during
bupivacaine action (Fig.
5C). After administration of bupivacaine, the outward
current was significantly reduced by 45 ± 2% as before (n = 7;
Fig. 5C). After a
steady-state effect of bupivacaine had been reached, lowering the pH from 7.2
to 6.4 did not result in an additional reduction, but in a small,
statistically not significant (p = 0.37) increase in outward current
amplitude by 4 ± 1% (n = 7;
Fig. 5C). This effect
most likely reflected the pH dependency of bupivacaine block of TASK channels
(Kindler et al., 1999
), as
indicated by the similar outward rectification and reversal potential of the
bupivacaine-sensitive ramp currents obtained under control conditions and the
pH-sensitive ramp currents in the presence of bupivacaine (data not
shown).
Next, the effects of extracellular acidification and bupivacaine were
compared in individual cells. As before, changing the pH from 7.2 to 6.4
resulted in a significant (p < 0.008) reduction of the standing
outward current at -28 mV by 27 ± 3% (n = 5;
Fig. 5D). After
recovery of the pH effect, the addition of bupivacaine (20 µM)
again significantly (p < 0.01) reduced the outward current by 28
± 6% (n = 5; Fig.
5D). The magnitude of current reduction induced by
acidification and bupivacaine were not significantly (p < 0.95)
different. Taken together, these data indicate that acidification and
bupivacaine block the same current component. Furthermore, TASK channels
contribute to the leak K+ outward current in thalamocortical
neurons and constitute the substrates of its pH sensitivity.
Halothane-sensitive currents
Another feature of TASK channels is their sensitivity to inhalational
anesthetics (Patel et al.,
1999
). Indeed, the addition of 1% halothane to the external
recording solution for 3 min resulted in a significant (p <
0.0001) and reversible increase (64 ± 3%; n = 6) in outward
current amplitude at -28 mV (Fig.
6A, filled squares). Halothane-sensitive ramp currents
were obtained by subtracting currents recorded in the absence of halothane
from those recorded in the presence of the anesthetic. The I-V
relationship revealed a rather linear current-voltage relationship with some
outward rectification at voltages positive to about -45 mV (data not shown).
The reversal potential of -68 ± 4mV (n = 3) was positive to
the expected reversal potential for K+ currents (EK =
-104 mV), indicating the contribution of a mixture of ions (data not shown).
In external solutions with the pH set to 6.4, the halothane-induced increase
of the current was 42 ± 2% (n = 4;
Fig. 6A, open circles)
and, thus, significantly (p < 0.006) smaller compared with that at
pH 7.2, and the reversal potential was shifted to -49 ± 2 mV (data not
shown; n = 3). This finding is in agreement with the assumption that
a K+ current is no longer part of the halothane-sensitive
component. To further determine the ionic nature of the halothane-sensitive
current, hyperpolarizing voltage ramps were applied in an external solution
containing TEA (20 mM), 4-AP (6 mM), TTX (1
µM), and ZD 7288 (100 µM). In addition,
Na+ was removed from the external and internal recording solutions,
and extracellular Ca2+ was reduced to 0.5 mM.
Under these conditions, the halothane-sensitive current revealed outward
rectification and a reversal potential of -92 ± 1 mV
(Fig. 6B, black trace;
n = 3), which was close to the expected reversal potential for
K+ currents (EK = -94 mV). With the external pH set to
6.4, the halothane effect was nearly completely blocked
(Fig. 6A, open
squares; B, gray trace; n = 3). These data indicate that the
halothane-sensitive current is carried by current through TASK channels and as
yet uncharacterized Na+ and/or Ca2+
channels.

View larger version (24K):
[in this window]
[in a new window]
|
Figure 6. Current components sensitive to application of halothane. A, Plot
of current amplitude at -28 mV against time during halothane application
(indicated by horizontal bar) at pH 7.2 (filled squares), at pH 6.4 (open
circles), and at pH 6.4 during isolation of K+ currents (open
squares; see below). Inset, Examples of current responses evoked by stepping
the membrane from -28 mV to -68 mV for 500 msec under control conditions and
during action of halothane (as indicated near trace). The scale bars represent
100 msec and 200 pA. B, I-V relationship of halothane-sensitive
currents evoked by ramping the membrane from -30 mV to -120 mV over 800 msec
at pH 7.2 (black trace) and pH 6.4 (gray trace). Currents were obtained by
subtracting ramp currents in the absence of halothane from those in its
presence (see term near traces). Recordings were performed during the presence
of TEA (20 mM), 4-AP (6 mM), TTX (1 µM),
and ZD 7288 (100 µM), removal of Na+ from the
external and internal recording solutions, and reduction of extracellular
Ca2+ to 0.5 mM. To achieve a reversible
effect, halothane (1%) was applied for 3 min.
|
|
mACh receptor-mediated responses
The block of a K+ leak conductance is of important functional
significance for the change of thalamic activity modes induced by activation
of mACh receptors (McCormick, 1992a). To link this leak conductance to TASK
channels, the effects of bupivacaine and extracellular acidification on
responses to ACh and muscarine were tested in thalamocortical relay neurons.
Application of ACh (50 µM) or muscarine (50 µM)
significantly (p < 0.0001) reduced the outward current at -28 mV
by 35 ± 3% (n = 3; data not shown) and 34 ± 4%
(n = 14; Fig.
7A,B), respectively. It should be noted here that in two
of 16 cells that were tested, application of muscarine resulted in an
10%
increase in the current amplitude. These cells were not included for analysis.
Muscarine-sensitive ramp currents were obtained by subtracting currents
recorded in the presence of muscarine (Fig.
8B, gray trace) from those under control conditions
(Fig. 8B, black trace)
and yielded an I-V relationship exhibiting both inward and outward
rectification, and a reversal potential at the expected K+
equilibrium potential (Erev = -104 ± 3 mV; n = 4;
Fig. 8A, filled
squares). Next, bupivacaine was used to block TASK channels. In the presence
of bupivacaine, application of muscarine resulted in a small but significant
(p < 0.002) decrease in the outward current at -28 mV by 4
± 9% (n = 12; data not shown). The I-V relationship
of the muscarine-sensitive current was constructed by subtracting the ramp
currents in the presence of the drug (Fig.
8C, gray trace) from those in the absence of the drug
(Fig. 8C, black trace)
and revealed an inwardly rectifying K+ current (Erev =
-104 ± 2 mV; n = 5; Fig. 8
A, gray squares). In addition, extracellular
acidification was used to block TASK channels. As for bupivacaine, the
construction of the muscarine-sensitive I-V relationship from ramp
protocols (Fig. 8 D)
revealed an inwardly rectifying current that reversed (Erev = -103
± 2 mV; n = 3; Fig. 8
A, open circles) close to the expected EK of
-104 mV.

View larger version (39K):
[in this window]
[in a new window]
|
Figure 7. Current components sensitive to application of muscarine (50
µM) during absence/presence of bupivacaine (20 µM)
and at pH 7.2/pH 6.4. A, Original traces of membrane responses to a
voltage step from a holding potential of -28 mV to -68 mV for 500 msec under
control conditions (con) and application of muscarine (as indicated near
traces). B, Plot of current amplitude at -28 mV against time (drug
application indicated by horizontal bar). C, D, I-V relationship of
the drug-sensitive current obtained by graphical subtraction of currents
during drug action from control currents. Currents were evoked by ramping the
membrane from -30 mV to -120 mV over 800 msec. Note that muscarine blocks an
inwardly and outwardly rectifying current under control conditions (black
traces) and an inwardly rectifying current in bupivacaine (C; gray
trace) and at pH 6.4 (D; gray traces) in individual cells.
|
|

View larger version (32K):
[in this window]
[in a new window]
|
Figure 8. Mean muscarine-sensitive (50 µM) ramp currents under
different recording conditions. A, Mean I-V relationship of
the muscarine-sensitive current under control conditions (filled squares), in
the presence of bupivacaine (open squares), and at pH 6.4 (open circles).
I-V relationships were obtained by graphical subtraction of currents
during muscarine action from control currents and determining current
amplitudes in 2.5 mV intervals. B-D, Currents evoked by ramping the
membrane from -30 mV to -120 mV over 800 msec in the presence (gray traces)
and absence (black traces) of muscarine (20 µM) as indicated
near the current traces.
|
|
To further strengthen these results, the effect of muscarine was tested in
individual cells under different recording conditions. In six thalamocortical
neurons, the muscarine-sensitive I-V relationship revealed inward and
outward rectification with a reversal at -104 ± 1 mV (n = 6;
Fig. 7C,D, black
traces) as before. After recovery from the first muscarine application,
muscarine was tested a second time in the presence of bupivacaine and at pH
6.4, respectively. For both recording conditions, the muscarine-sensitive
I-V relationship was inwardly rectifying and reversed close to
EK (muscarine in bupivacaine: Erev = -105 ± 1 mV,
n = 3; muscarine at pH 6.4: Erev = -103 ± 1 mV,
n = 3). These data indicate that activation of mACh receptors results
in an inhibition of TASK as well as inwardly rectifying Kir type channels.
Regulation of firing patterns
The possible functional significance of modulation of TASK channels for
firing patterns of thalamocortical relay neurons was analyzed under
current-clamp conditions. Recordings were obtained at slightly hyperpolarized
values of the membrane potential from rest (-73 mV ± 1 mV, n =
12 vs -71 ± 1 mV, n = 24) using DC injection. Under these
conditions, depolarizing current steps elicited typical burst responses with
two to five action potentials riding on top of a low threshold
Ca2+ spike (Fig.
9A,B,D). A frequency analysis including the first two
action potentials of a burst response revealed an intra-burst frequency of 148
± 7 Hz (n = 12). The addition of bupivacaine (20
µM) resulted in a depolarization of the membrane to -42 ±
3 mV, accompanied by a change in firing mode from burst to tonic generation of
action potentials (Fig.
9A; n = 3). The frequency of tonic action
potential firing as derived from the first two spikes was 38 ± 9 Hz.
Similar results were obtained on changes of the extracellular pH from 7.2 to
6.4 in the presence of ZD 7288 (100 µM; membrane potential, -52
± 3 mV; firing frequency, 32 ± 10 Hz; n = 6;
Fig. 9B) and
application of muscarine (50 µM; membrane potential, -49
± 2 mV; firing frequency, 37 ± 4 Hz; n = 3;
Fig. 9D). All effects
were reversible. The effect of halothane was tested at slightly depolarized
values of the membrane potential (61 ± 2 mV; n = 4) using DC
injection. Depolarizing current pulses consistently elicited tonic action
potential firing (Fig.
9C). The application of halothane (1%) induced a
hyperpolarizing shift of the membrane potential to -68 ± 1 mV
(n = 4). This hyperpolarization was accompanied by a change in firing
pattern from tonic to low-threshold Ca2+ spikes
(Fig. 9C). The
Ca2+ spike typically triggered a single-action potential
rather than a burst of action potential, most likely because of a decrease in
input resistance and inhibition of T-type Ca2+ currents
associated with the action of halothane
(Takenoshita and Steinbach,
1991
; Ries and Puil,
1999a
). Indeed, during prolonged action of halothane, a purely
passive response of the cells to the same depolarizing current injection was
observed (data not shown).

View larger version (16K):
[in this window]
[in a new window]
|
Figure 9. Effects of bupivacaine (A), lowering of extracellular pH from 7.2
to 6.4 (B), halothane (C), and muscarine (D) on the
firing mode of thalamocortical relay neurons. Cells were recorded under
whole-cell current-clamp conditions and were challenged using a 100-200 pA
depolarizing current pulse (300 msec duration). From hyperpolarized potentials
(indicated near traces), depolarizing pulses induced robust burst firing
(A, B, D, left panel). Application of bupivacaine (20
µM; A), extracellular acidification in the presence of
ZD7288 (B), and application of muscarine (50 µM;
D) result in a depolarizing shift of the membrane potential and
generation of tonic trains of action potentials in response to the same
depolarizing current pulse. Application of halothane (1%; C) at -61
mV results in a hyperpolarization and replacement of tonic firing by a
low-threshold action potential triggering one spike.
|
|
 |
Discussion
|
|---|
Contribution of TASK channels to the leak conductance in
thalamocortical neurons
A significant proportion of the leak current in thalamocortical neurons at
membrane potentials close to rest (approximately -65 mV) or at more positive
values (approximately -30 mV) seems to be carried by TASK channels, as
indicated by the sensitivity to bupivacaine at 20 µM, which has
been used to block TASK channels in various types of cells
(Leonoudakis et al., 1998
;
Brown, 2000
;
Buckler et al., 2000
;
Lesage and Lazdunski, 2000
;
Goldstein et al., 2001
;
Meadows and Randall, 2001
).
This conclusion is supported by the overall pharmacological profile of this
current component, i.e., sensitivity to extracellular acidification, increase
and decrease on application of halothane and stimulation of mACh receptors
(Patel et al., 1999
;
Millar et al., 2000
),
respectively. Furthermore, the isolated bupivacaine-sensitive current reversed
at the presumed K+ equilibrium potential and displayed outward
rectification, resembling that of TASK currents in whole-cell recordings
(Rajan et al., 2000
). One
point of consideration relates to Kir-type channels, which contribute to leak
K+ conductances in various types of cells
(Hille, 2001
). In this
respect, Kir2.3 channels and members of the Kir3 family are of special
interest, because these channels are blocked by lowering the extracellular pH
(Coetzee et al., 1999
;
Brown, 2000
), are activated by
ACh receptor stimulation
(Ruppersberg, 2000
), and are
expressed in the dLGN (present study). In thalamocortical relay neurons, most
of the pH-sensitive K+ current seems to be carried through TASK
channels, as indicated by the occlusion of the effects of extracellular
acidification (in ZD 7288) by a near-maximal effect of bupivacaine. In support
of this is the finding that the isolated pH-sensitive current displayed
outward rectification similar to that of the bupivacaine-sensitive current in
dLGN neurons and that of TASK currents in other types of cells
(Buckler et al., 2000
).
Ba2+ blocks Kir-type as well as TASK channels, and the
Ba2+-sensitive current component of thalamocortical
relay neurons recorded in the present study is carried by both TASK and Kir
channels. This conclusion is supported by the finding that a
Ba2+-sensitive K+ conductance is existing in
thalamocortical neurons (McCormick and
Prince, 1987
; Williams et al.,
1997
) and by the observation made during the present study that
there is a Ba2+-sensitive inwardly rectifying current in
acidic extracellular solutions, but no pH-sensitive component in
Ba2+-containing solutions.
It is known that bupivacaine blocks Na+
(Brau et al., 1998
),
high-voltage-activated Ca2+
(Liu et al., 2001
), and
voltage-activated potassium channels
(Komai and McDowell, 2001
) in
different neuronal preparations. Therefore, the effect of bupivacaine on these
ion channels was analyzed in thalamocortical relay neurons. It was found that
at a concentration of 20 µM the blocking effect of bupivacaine
on the standing outward current (
40%) was about four times higher as
compared with Na+, Ca2+, and fast transient
K+ currents (
10%). Therefore, it is concluded that depending
on the individual recording conditions and the concentration used, bupivacaine
can act as a marker of currents through TASK channels. In the present study,
this view is supported by two major arguments. First, the isolated
bupivacaine-sensitive current is reversed at the presumed K+
equilibrium potential, indicating that a contamination could only arise from
other K+ currents. One important voltage-dependent K+
current that is active below threshold and can, thus, influence thalamic
activity modes is a fast transient outward current
(Huguenard et al., 1991
;
Budde et al., 1992
). However,
the reduction of this current is significantly lower compared with the
standing outward current (see above). Second, extracellular acidification and
bupivacaine block current components exhibiting very similar properties with
respect to reversal, waveform, and amplitude, indicating an effect on the same
current component.
The leak conductance in thalamocortical neurons at membrane potentials
ranging from rest to approximately -30 mV seems to have strong contributions
of TASK and Kir channels. A TTX-sensitive component, most likely representing
the persistent Na+ current activated at membrane potentials
slightly positive to rest (Parri and
Crunelli, 1998
), a ZD 7288-sensitive component, representing
current through Ih channels
(BoSmith et al., 1993
;
Maccaferri and McBain, 1996
),
and a TEA/4-AP-sensitive component representing current through delayed
rectifier (Huguenard and Prince,
1991
; Budde et al.,
1992
)/slow A-type K+ channels
(McCormick, 1991
) also make
detectable contributions (data not shown). TASK channels contribute
40%
to the leak conductance as deduced from the bupivacaine- and pH-sensitive
components. The contribution of several voltage-dependent ion channels
(persistent Na+ channels, TEA/4-AP-sensitive K+
channels) seem to increase with more positive values of the membrane
potential.
Involvement of different TASK channel subtypes
TASK1 and TASK3, together with the possibly nonfunctional TASK5 subunits,
form a subfamily of 2P K+ channels that are structurally related
and inhibited by acidosis. In addition, a subgroup including TASK2, TASK4
(TALK1), and TALK2 subunits are recognized based on their sequence homology
and more alkaline range of activation (TASK1-5)
(Goldstein et al., 2001
;
Karschin et al., 2001
;
Lesage, 2003
). Whereas TASK1
and TASK3 are significantly expressed in dLGN, no TASK5 expression could be
detected in this visual thalamic nucleus. These results are in agreement with
the recently determined tissue distribution of 2P domain K+
channels in brain, because TASK3 is the major channel species in principal
thalamic relay nuclei, and TASK5 is predominantly associated with the central
auditory pathway (Karschin et al.,
2001
; Talley et al.,
2001
). The uniformly low expression of TASK2 in brain is in
accordance with the barely detectable PCR signal of TASK2 described here.
Because the expression of TASK4 was not assessed in the present study and
bupivacaine is known to block these acid-sensitive channels, a contribution of
TASK4 (and other members of the TALK channel subgroup) cannot be excluded.
However, as judged from the pH dependency of TASK4 channels in oocytes
(Decher et al., 2001
), it is
questionable whether they are open under the conditions of the present study.
Taken together, it seems that TASK1 and TASK3 channels constitute most of the
pH-sensitive K+ conductance, although the contribution of
additional acid-sensing K+ channels
(Han et al., 2002
) cannot be
excluded based on available data.
Contribution of TASK channels to halothane and mACh receptor-mediated
effects
Activation of mACh receptors in thalamocortical neurons inhibited an
outwardly and inwardly rectifying K+ current
(McCormick, 1993
). The finding
that bupivacaine and extracellular acidification were able to largely block
the muscarine effect on the outwardly rectifying, but spared the inwardly
rectifying, component of ramp currents indicates that the outward
rectification is largely carried by current through TASK channels.
Furthermore, application of halothane to thalamocortical relay neurons
resulted in a large increase in outward current amplitude. The reversal of the
halothane-sensitive ramp current was positive to the expected K+
reversal potential, indicating that additional ions contribute. Likely
candidates are Na+ and/or Ca2+ channels, as
indicated by the finding that the halothane-sensitive ramp current showed
clear outward rectification and reversed at the expected K+
equilibrium potential after current through Na+ and
Ca2+ channels had been minimized. Moreover, the current
under these conditions was blocked by extracellular acidification, indicating
mediation by TASK channels. An enhancement of a K+ conductance
(Ries and Puil, 1999b
) and the
depression of postsynaptic potentials
(Sugiyama et al., 1992
) by
halothane in thalamocortical relay neurons has been described previously.
Similar to the present findings, the halothane-sensitive current in the study
by Ries and Puil (1999b
) also
deviated from a pure K+ conductance, in that additional ions with
positive equilibrium potential contributed.
Possible functional implication of TASK channel modulation
The shift from periods of synchronized electroencephalogram (EEG) activity,
such as during slow wave sleep, to the desynchronized EEG pattern of
wakefulness is associated with tonic depolarization of thalamocortical relay
neurons (for review, see Steriade et al.,
1997
; Sherman and Guillery,
2001
). This state-dependent change in activity mode is associated
with an abolition of rhythmic burst activity in thalamocortical relay cells,
enables the faithful transmission of synaptic signals through the thalamus,
and is largely controlled by ascending inputs from the upper brainstem core,
of which cholinergic fibers from the tegmental nuclei comprise an important
part. The release of ACh has been shown to act on both nicotinic and mACh
receptors, which, in the dLGN results in a strong depolarization and shift
from burst to tonic firing patterns in identified X- and Y-cells
(Eysel et al., 1986
;
McCormick and Prince, 1987
;
McCormick, 1992a). Activation of mACh receptors is associated with a slow
depolarization due to a decrease in a leak K+ conductance (for
review, see McCormick, 1992b), and the results of the present study demonstrate
that TASK1/TASK 3 channels are major constituents of this response.
In contrast, activation of the same type of channels by halothane will
strongly disfacilitate conditions of faithful signal transfer in the
thalamocortical system, in that the hyperpolarization in relay neurons shifts
the membrane out of the range of tonic action potential firing. Furthermore,
the shunting effect of the increased K+ conductance on postsynaptic
potentials, Na+/K+ action potentials, and low-threshold
Ca2+ spikes
(Sugiyama et al., 1992
;
Ries and Puil, 1999a
), will
block the transfer of all sensory and motor activity coded as tonic or burst
firing (Fanselow et al., 2001
;
Weyand et al., 2001
),
resulting in analgesia, loss of awareness, and the suppression of motor
activity. The 2P domain K+ channels in thalamocortical relay
neurons, therefore, seem to make an important contribution to the clinical
effects of inhalational anesthetics.
 |
Footnotes
|
|---|
Received Apr. 11, 2003;
revised May. 20, 2003;
accepted May. 30, 2003.
This work was supported by Deutsche Forschungsgemeinschaft (DFG) Grant BU
1019/5-1, Leibniz Program (H.-C. P.). S.G.M. was a member of the
DFG-Graduiertenkolleg "Biological basis of central nervous system
diseases." Part of this work was done in partial fulfillment of a
doctoral thesis by S.G.M. We thank R. Ziegler and A. Jahn for excellent
technical assistance. We also thank Prof. A. Karschin for a kind gift of
in situ hybridization probes for TASK1 and TASK3.
Correspondence should be addressed to Dr. Thomas Budde, Faculty of
Medicine, Institute of Physiology, Otto-von-Guericke Universität,
Leipziger Str.44, D-39120 Magdeburg, Germany. E-mail:
thomas.budde{at}medizin.unimagdeburg.de.
Copyright © 2003 Society for Neuroscience
0270-6474/03/236460-
$15.00/0
* S.G.M. and T.B. contributed equally to this work. 
 |
References
|
|---|
BoSmith RE, Briggs I, Sturgess NC (1993) Inhibitory
actions of ZENECA ZD7288 on whole-cell hyperpolarization activated inward
current (If) in guinea-pig dissociated sinoatrial node cells. Br J
Pharmacol 110:
343-349.[Web of Science][Medline]
Brau ME, Vogel W, Hempelmann G (1998) Fundamental
properties of local anesthetics: half-maximal blocking concentrations for
tonic block of Na+ and K+ channels in peripheral nerve.
Anesth Analg 87:
885-889.[Abstract/Free Full Text]
Brown DA (2000) Neurobiology: the acid test for
resting potassium channels. Curr Biol
10: R456-R459.[Web of Science][Medline]
Buckler KJ, Williams BA, Honore E (2000) An oxygen-,
acid- and anaesthetic-sensitive TASK-like background potassium channel in rat
arterial chemoreceptor cells. J Physiol
525: 135-142.[Abstract/Free Full Text]
Budde T, White JA (1998) The voltage-dependent
conductances of rat neocortical layer I neurons. Eur J Neurosci
10: 2309-2321.[Web of Science][Medline]
Budde T, Mager R, Pape H-C (1992) Different types of
potassium outward current in relay neurons acutely isolated from the rat
lateral geniculate nucleus. Eur J Neurosci
4: 708-722.[Web of Science][Medline]
Budde T, Biella G, Munsch T, Pape H-C (1997) Lack of
regulation by intracellular Ca2+ of the
hyperpolarization-activated cation current in rat thalamic neurons. J.
Physiol (Lond) 503.1:
79-85.[Abstract/Free Full Text]
Coetzee WA, Amarillo Y, Chiu J, Chow A, Lau D, McCormack T, Moreno
H, Nadal MS, Ozaita A, Pountney D, Saganich M, Vega-Saenz de Miera E, Rudy B
(1999) Molecular diversity of K+ channels. Ann
N Y Acad Sci 868:
233-285.[Web of Science][Medline]
Decher N, Maier M, Dittrich W, Gassenhuber J, Bruggemann A, Busch
AE, Steinmeyer K (2001) Characterization of TASK-4, a novel
member of the pH-sensitive, two-pore domain potassium channel family.
FEBS Lett 492:
84-89.[Web of Science][Medline]
Dodt HU, Zieglgänsberger W (1990) Visualizing
unstained neurons in living brain slices by infrared DIC-videomicroscopy.
Brain Res 537:
333-336.[Web of Science][Medline]
Eysel UT, Pape H-C, Van Schayck R (1986) Exitatory and
differential disinhibitory actions of acetylcholine in the lateral geniculate
nucleus of the cat. J Physiol (Lond)
370: 233-254.[Abstract/Free Full Text]
Fanselow EE, Sameshima K, Baccala LA, Nicolelis MA
(2001) Thalamic bursting in rats during different awake
behavioral states. Proc Natl Acad Sci USA
98: 15330-15335.[Abstract/Free Full Text]
Goldstein SA, Bockenhauer D, O'Kelly I, Zilberberg N
(2001) Potassium leak channels and the KCNK family of
two-P-domain subunits. Nat Rev Neurosci
2: 175-184.[Web of Science][Medline]
Han J, Truell J, Gnatenco C, Kim D (2002)
Characterization of four types of background potassium channels in rat
cerebellar granule neurons. J Physiol (Lond)
542: 431-444.[Abstract/Free Full Text]
Hille B (2001) Ion channels of excitable
membranes. Sunderland: Sinauer.
Huguenard JR, Prince DA (1991) Slow inactivation of a
TEA-sensitive K current in acutely isolated rat thalamic relay neurons.
J Neurophysiol 66:
1316-1328.[Abstract/Free Full Text]
Huguenard JR, Coulter DA, Prince DA (1991) A fast
transient potassium current in thalamic relay neurons: kinetics of activation
and inactivation. J Neurophysiol 66:
1304-1315.[Abstract/Free Full Text]
Karschin C, Wischmeyer E, Preisig-Muller R, Rajan S, Derst C,
Grzeschik KH, Daut J, Karschin A (2001) Expression pattern in
brain of TASK-1, TASK-3, and a tandem pore domain K(+) channel subunit,
TASK-5, associated with the central auditory nervous system. Mol Cell
Neurosci 18:
632-648.[Web of Science][Medline]
Kindler CH, Yost CS, Gray AT (1999) Local anesthetic
inhibition of baseline potassium channels with two pore domains in tandem.
Anesthesiology 90:
1092-1102.[Web of Science][Medline]
Komai H, McDowell TS (2001) Local anesthetic
inhibition of voltage-activated potassium currents in rat dorsal root ganglion
neurons. Anesthesiology 94:
1089-1095.[Web of Science][Medline]
Leonoudakis D, Gray AT, Winegar BD, Kindler CH, Harada M, Taylor
DM, Chavez RA, Forsayeth JR, Yost CS (1998) An open rectifier
potassium channel with two pore domains in tandem cloned from rat cerebellum.
J Neurosci 18:
868-877.[Abstract/Free Full Text]
Lesage F (2003) Pharmacology of neuronal background
potassium channels. Neuropharmacology
44: 1-7.[Web of Science][Medline]
Lesage F, Lazdunski M (2000) Molecular and functional
properties of two-pore-domain potassium channels. Am J Physiol Renal
Physiol 279:
F793-F801.[Abstract/Free Full Text]
Liu BG, Zhuang XL, Li ST, Xu GH, Brull SJ, Zhang JM
(2001) Effects of bupivacaine and ropivacaine on
high-voltage-activated calcium currents of the dorsal horn neurons in newborn
rats. Anesthesiology 95:
139-143.[Web of Science][Medline]
Maccaferri G, McBain CJ (1996) The
hyperpolarization-activated current (Ih) and its contribution to pacemaker
activity in rat CA1 hippocampal stratum oriens-alveus interneurones. J.
Physiol (Lond) 497 1:
119-130.[Abstract/Free Full Text]
McCormick DA (1991) Functional properties of a slowly
inactivating potassium current in guinea pig dorsal lateral geniculate relay
neurons. J Neurophysiol 66:
1176-1189.[Abstract/Free Full Text]
McCormick DA (1992a) Cellular mechanisms underlying
cholinergic and noradrenergic modulation of neuronal firing mode in the cat
and guinea pig dorsal lateral geniculate nucleus. J Neurosci
12: 278-289.[Abstract]
McCormick DA (1992b) Neurotransmitter actions in the
thalamus and cerebral cortex and their role in neuromodulation of
thalamocortical activity. Prog Neurobiol
39: 337-388.[Web of Science][Medline]
McCormick DA (1993) Actions of acetylcholine in the
cerebral cortex and thalamus and implications for function. Prog Brain
Res 98:
303-308.[Web of Science][Medline]
McCormick DA, Prince DA (1987) Actions of
acetylcholine in the guineapig and cat medial and lateral geniculate nuclei,
in vitro. J Physiol (Lond) 392:
147-165.[Abstract/Free Full Text]
McCormick DA, Prince DA (1988) Noradrenergic
modulation of firing pattern in guinea pig and cat thalamic neurons, in
vitro. J Neurophysiol 59:
978-996.[Abstract/Free Full Text]
Meadows HJ, Randall AD (2001) Functional
characterisation of human TASK-3, an acid-sensitive two-pore domain potassium
channel. Neuropharmacology 40:
551-559.[Web of Science][Medline]
Meuth S, Pape H-C, Budde T (2002) Modulation of
Ca2+ currents in rat thalamocortical relay neurons by
activity and phosphorylation. Eur J Neurosci
15: 1603-1614.[Web of Science][Medline]
Millar JA, Barratt L, Southan AP, Page KM, Fyffe RE, Robertson B,
Mathie A (2000) A functional role for the two-pore domain
potassium channel TASK-1 in cerebellar granule neurons. Proc Natl Acad
Sci USA 97:
3614-3618.[Abstract/Free Full Text]
Munsch T, Pape H-C (1999) Modulation of the
hyperpolarization-activated cation current of rat thalamic relay neurones by
intracellular pH. J Physiol (Lond) 519:
493-504.[Abstract/Free Full Text]
Neher E (1992) Correction for liquid junction potentials in patch-clamp experiments. Methods Enzymol 207:123-131.[Web of Science][Medline]
Parri HR, Crunelli V (1998) Sodium current in rat and
cat thalamocortical neurons: role of a noninactivating component in tonic and
burst firing. J Neurosci 18:
854-867.[Abstract/Free Full Text]
Patel AJ, Honore E, Lesage F, Fink M, Romey G, Lazdunski M
(1999) Inhalational anesthetics activate two-pore-domain
background K+ channels. Nat Neurosci 2:
422-426.[Web of Science][Medline]
Rajan S, Wischmeyer E, Xin Liu G, Preisig-Muller R, Daut J,
Karschin A, Derst C (2000) TASK-3, a novel tandem pore domain
acid-sensitive K+ channel. An extracellular histiding as pH sensor. J
Biol Chem 275:
16650-16657.[Abstract/Free Full Text]
Ries CR, Puil E (1999a) Mechanism of anesthesia
revealed by shunting actions of isoflurane on thalamocortical neurons.
J Neurophysiol 81:
1795-1801.[Abstract/Free Full Text]
Ries CR, Puil E (1999b) Ionic mechanism of
isoflurane's actions on thalamocortical neurons. J Neurophysiol
81: 1802-1809.[Abstract/Free Full Text]
Ruppersberg JP (2000) Intracellular regulation of
inward rectifier K+ channels. Pflügers Arch
1-21.
Sherman SM, Guillery RW (1996) Functional organization
of thalamocortical relays. J Neurophysiol
76: 1367-1395.[Abstract/Free Full Text]
Sherman SM, Guillery RW (2001) Exploring the
thalamus. San Diego: Academic.
Steriade M (1997) Synchronized activities of coupled
oscillators in the cerebral cortex and thalamus at different levels of
vigilance. Cereb Cortex 7:
583-604.[Abstract/Free Full Text]
Steriade M, Jones EG, McCormick DA (1997)
Thalamus. Amsterdam: Elsevier.
Stork O, Welzl H, Wolfer D, Schuster T, Mantei N, Stork S, Hoyer D,
Lipp H, Obata K, Schachner M (2000) Recovery of emotional
behaviour in neural cell adhesion molecule (NCAM) null mutant mice through
transgenic expression of NCAM180. Eur J Neurosci
12: 3291-3306.[Web of Science][Medline]
Sugiyama K, Muteki T, Shimoji K (1992)
Halothane-induced hyperpolarization and depression of postsynaptic potentials
of guinea pig thalamic neurons in vitro. Brain Res
576: 97-103.[Web of Science][Medline]
Takenoshita M, Steinbach JH (1991) Halothane blocks
low-voltage-activated calcium current in rat sensory neurons. J
Neurosci 11:
1404-1412.[Abstract]
Talley EM, Lei Q, Sirois JE, Bayliss DA (2000) TASK-1,
a two-pore domain K+ channel, is modulated by multiple
neurotransmitters in motoneurons. Neuron
25: 399-410.[Web of Science][Medline]
Talley EM, Solorzano G, Lei Q, Kim D, Bayliss DA
(2001) CNS distribution of members of the two-pore-domain (KCNK)
potassium channel family. J Neurosci 21:
7491-7505.[Abstract/Free Full Text]
Washburn CP, Sirois JE, Talley EM, Guyenet PG, Bayliss DA
(2002) Serotonergic raphe neurons express TASK channel
transcripts and a TASK-like pH- and halothane-sensitive K+
conductance. J Neurosci 22:
1256-1265.[Abstract/Free Full Text]
Watkins CS, Mathie A (1996) A non-inactivating
K+ current sensitive to muscarinic receptor activation in rat
cultured cerebellar granule neurons. J Physiol (Lond)
491: 401-412.[Abstract/Free Full Text]
Weyand TG, Boudreaux M, Guido W (2001) Burst and tonic
response modes in thalamic neurons during sleep and wakefulness. J
Neurophysiol 85:
1107-1118.[Abstract/Free Full Text]
Williams SR, Turner JP, Hughes SW, Crunelli V (1997)
On the nature of anomalous rectification in thalamocortical neurones of the
cat ventro-basal thalamus in vitro. J Physiol (Lond)
505: 727-747.[Abstract/Free Full Text]
This article has been cited by other articles:

|
 |

|
 |
 
S. Bittner, S. G. Meuth, K. Gobel, N. Melzer, A. M. Herrmann, O. J. Simon, A. Weishaupt, T. Budde, D. A. Bayliss, M. Bendszus, et al.
TASK1 modulates inflammation and neurodegeneration in autoimmune inflammation of the central nervous system
Brain,
July 1, 2009;
(2009)
awp163v1.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. Zuzarte, K. Heusser, V. Renigunta, G. Schlichthorl, S. Rinne, E. Wischmeyer, J. Daut, B. Schwappach, and R. Preisig-Muller
Intracellular traffic of the K+ channels TASK-1 and TASK-3: role of N- and C-terminal sorting signals and interaction with 14-3-3 proteins
J. Physiol.,
March 1, 2009;
587(5):
929 - 952.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
Z. M. Khaliq and B. P. Bean
Dynamic, Nonlinear Feedback Regulation of Slow Pacemaking by A-Type Potassium Current in Ventral Tegmental Area Neurons
J. Neurosci.,
October 22, 2008;
28(43):
10905 - 10917.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. A. Gonzalez, L. T. Jensen, L. Fugger, and D. Burdakov
Metabolism-Independent Sugar Sensing in Central Orexin Neurons
Diabetes,
October 1, 2008;
57(10):
2569 - 2576.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
R. H. Williams, H. Alexopoulos, L. T. Jensen, L. Fugger, and D. Burdakov
Adaptive sugar sensors in hypothalamic feeding circuits
PNAS,
August 19, 2008;
105(33):
11975 - 11980.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. G. Meuth, S. Bittner, P. Meuth, O. J. Simon, T. Budde, and H. Wiendl
TWIK-related Acid-sensitive K+ Channel 1 (TASK1) and TASK3 Critically Influence T Lymphocyte Effector Functions
J. Biol. Chem.,
May 23, 2008;
283(21):
14559 - 14570.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
H. Toyoda, M. Saito, H. Sato, Y. Dempo, A. Ohashi, T. Hirai, Y. Maeda, T. Kaneko, and Y. Kang
cGMP Activates a pH-Sensitive Leak K+ Current in the Presumed Cholinergic Neuron of Basal Forebrain
J Neurophysiol,
May 1, 2008;
99(5):
2126 - 2133.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
D. K. Mulkey, E. M. Talley, R. L. Stornetta, A. R. Siegel, G. H. West, X. Chen, N. Sen, A. M. Mistry, P. G. Guyenet, and D. A. Bayliss
TASK Channels Determine pH Sensitivity in Select Respiratory Neurons But Do Not Contribute to Central Respiratory Chemosensitivity
J. Neurosci.,
December 19, 2007;
27(51):
14049 - 14058.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C. Putzke, P. J. Hanley, G. Schlichthorl, R. Preisig-Muller, S. Rinne, M. Anetseder, R. Eckenhoff, C. Berkowitz, T. Vassiliou, H. Wulf, et al.
Differential effects of volatile and intravenous anesthetics on the activity of human TASK-1
Am J Physiol Cell Physiol,
October 1, 2007;
293(4):
C1319 - C1326.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S.-W. Ying, F. Jia, S. Y. Abbas, F. Hofmann, A. Ludwig, and P. A. Goldstein
Dendritic HCN2 Channels Constrain Glutamate-Driven Excitability in Reticular Thalamic Neurons
J. Neurosci.,
August 8, 2007;
27(32):
8719 - 8732.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
R. H. Williams, L. T. Jensen, A. Verkhratsky, L. Fugger, and D. Burdakov
Control of hypothalamic orexin neurons by acid and CO2
PNAS,
June 19, 2007;
104(25):
10685 - 10690.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. J. Russo, E. Mugnaini, and M. Martina
Intrinsic properties and mechanisms of spontaneous firing in mouse cerebellar unipolar brush cells
J. Physiol.,
June 1, 2007;
581(2):
709 - 724.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. Mathie
Neuronal two-pore-domain potassium channels and their regulation by G protein-coupled receptors
J. Physiol.,
January 15, 2007;
578(2):
377 - 385.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. Zanzouri, I. Lauritzen, F. Duprat, M. Mazzuca, F. Lesage, M. Lazdunski, and A. Patel
Membrane Potential-regulated Transcription of the Resting K+ Conductance TASK-3 via the Calcineurin Pathway
J. Biol. Chem.,
September 29, 2006;
281(39):
28910 - 28918.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. G. Meuth, T. Kanyshkova, P. Meuth, P. Landgraf, T. Munsch, A. Ludwig, F. Hofmann, H.-C. Pape, and T. Budde
Membrane Resting Potential of Thalamocortical Relay Neurons Is Shaped by the Interaction Among TASK3 and HCN2 Channels
J Neurophysiol,
September 1, 2006;
96(3):
1517 - 1529.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. R. Gibson, A. F. Bartley, and K. M. Huber
Role for the Subthreshold Currents ILeak and IH in the Homeostatic Control of Excitability in Neocortical Somatostatin-Positive Inhibitory Neurons
J Neurophysiol,
July 1, 2006;
96(1):
420 - 432.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A.-M. Linden, M. I. Aller, E. Leppa, O. Vekovischeva, T. Aitta-aho, E. L. Veale, A. Mathie, P. Rosenberg, W. Wisden, and E. R. Korpi
The in Vivo Contributions of TASK-1-Containing Channels to the Actions of Inhalation Anesthetics, the {alpha}2 Adrenergic Sedative Dexmedetomidine, and Cannabinoid Agonists
J. Pharmacol. Exp. Ther.,
May 1, 2006;
317(2):
615 - 626.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
B. Musset, S. G. Meuth, G. X. Liu, C. Derst, S. Wegner, H.-C. Pape, T. Budde, R. Preisig-Muller, and J. Daut
Effects of divalent cations and spermine on the K+ channel TASK-3 and on the outward current in thalamic neurons
J. Physiol.,
May 1, 2006;
572(3):
639 - 657.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. G. Meuth, M. I. Aller, T. Munsch, T. Schuhmacher, T. Seidenbecher, P. Meuth, C. Kleinschnitz, H.-C. Pape, H. Wiendl, W. Wisden, et al.
The Contribution of TWIK-Related Acid-Sensitive K+-Containing Channels to the Function of Dorsal Lateral Geniculate Thalamocortical Relay Neurons
Mol. Pharmacol.,
April 1, 2006;
69(4):
1468 - 1476.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
K. M. Sanders and S. Don Koh
Two-pore-domain potassium channels in smooth muscles: new components of myogenic regulation
J. Physiol.,
January 1, 2006;
570(1):
37 - 43.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
T. Budde, L. Caputi, T. Kanyshkova, R. Staak, C. Abrahamczik, T. Munsch, and H.-C. Pape
Impaired Regulation of Thalamic Pacemaker Channels through an Imbalance of Subunit Expression in Absence Epilepsy
J. Neurosci.,
October 26, 2005;
25(43):
9871 - 9882.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. Taverna, T. Tkatch, A. E. Metz, and M. Martina
Differential Expression of TASK Channels between Horizontal Interneurons and Pyramidal Cells of Rat Hippocampus
J. Neurosci.,
October 5, 2005;
25(40):
9162 - 9170.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C. E Clarke, E. L Veale, P. J Green, H. J Meadows, and A. Mathie
Selective block of the human 2-P domain potassium channel, TASK-3, and the native leak potassium current, IKSO, by zinc
J. Physiol.,
October 1, 2004;
560(1):
51 - 62.
[Abstract]
[Full Text]
[PDF]
|
 |
|