The Journal of Neuroscience, July 30, 2003, 23(17):6856-6865
Previous Article | Next Article 
Brain-Derived Neurotrophic Factor Is Required for the Maintenance of Cortical Dendrites
Jessica A. Gorski,
Steven R. Zeiler,
Susan Tamowski, and
Kevin R. Jones
Department of Molecular, Cellular, and Developmental Biology, University
of Colorado, Boulder, Colorado 80309
 |
Abstract
|
|---|
Brain-derived neurotrophic factor (BDNF) is thought to be involved in
neuronal survival, migration, morphological and biochemical differentiation,
and modulation of synaptic function in the CNS. In the rodent cortex,
postnatal BDNF expression is initially low but subsequently increases to reach
maximal levels around weaning. Thus, BDNF expression peaks at a time when both
structural and functional maturation of cortical circuitry occurs. Although
the function of BDNF has been probed using many approaches, its requirements
during this phase of life have not previously been examined genetically. To
test the in vivo requirements for BDNF during this important phase of
development we generated early-onset forebrain-specific BDNF mutant
mice. Although these mice undergo forebrain-restricted deletion of
BDNF by Cre-mediated recombination during embryogenesis, they are
healthy, and we did not detect the loss of specific cortical excitatory or
inhibitory neurons. However, the neocortex of 5-week-old mice was thinner,
attributable at least partly to neuronal shrinkage. Importantly, although
visual cortical layer 2/3 neurons in the mutants initially developed normal
dendrite structure, dendritic retraction became apparent by 3 weeks of age.
Thus, our observations suggest that cortically expressed BDNF functions to
support the maintenance of cortical neuron size and dendrite structure rather
than the initial development of these features. This is consistent with a role
for BDNF in stabilizing the "survival" of circuitry during the
phase of activity-dependent reorganization of cortical connectivity.
Key words: BDNF; dendrite; cortex; morphology; Cre-lox; neurotrophin; mouse; mutant
 |
Introduction
|
|---|
BDNF, a secreted neurotrophin, regulates aspects of neuronal survival,
migration, morphological and biochemical differentiation, and synaptic
function (Bibel and Barde,
2000
; Huang and Reichardt,
2001
). Binding of BDNF to the receptor tyrosine kinase TrkB
activates signal transduction pathways known to influence neuronal
proliferation, survival, and differentiation
(Miller and Kaplan, 2001
).
TrkB is also activated by neurotrophin (NT)-3 and NT-4/5
(Barbacid, 1994
;
Patapoutian and Reichardt,
2001
). Both BDNF and TrkB are widely expressed in neocortical
neurons. BDNF is expressed at low levels in the rodent cortex during prenatal
development, expression rises dramatically during the postnatal period, and
BDNF is the most abundant neurotrophin in both the adult rodent and human
cortex (Maisonpierre et al.,
1990
; Timmusk et al.,
1994
; Webster et al.,
2002
). The striking and necessary actions of neurotrophic factors
in promoting the survival and differentiation of peripheral nervous system
neurons have driven intensive studies of the functions of BDNF and TrkB
signaling in the cortex.
In vitro studies have demonstrated that BDNF has
survival-promoting activity on cortical neurons through a calcium-dependent
mechanism (Finkbeiner, 2000
)
and potent enhancement of inhibitory interneuron differentiation
(Marty et al., 1997
). In
addition, BDNF and TrkB signaling can influence cortical dendrite growth. In
cultured slice preparations, BDNF caused enhanced arborization of layer II/III
and IV neurons (Horch et al.,
1999
; Niblock et al.,
2000
), but a loss of dendritic complexity in layer VI
(McAllister et al., 1995
). In
addition to these influences on the survival and differentiation of cortical
neurons, BDNF and TrkB signaling are known to modulate synaptic strength, and
BDNF expression and secretion is regulated by neural activity, suggesting
possible functions in the plasticity and homeostasis of cortical circuitry
(Poo, 2001
).
Studies of null BDNF and TrkB mutant mice have suggested
relatively subtle BDNF requirements in the survival of most cortical neurons,
but have indicated functions in the migration and differentiation these cells
(Klein et al., 1993
;
Ernfors et al., 1994
;
Jones et al., 1994
;
Alcantara et al., 1997
;
Silos-Santiago et al., 1997
;
Gates et al., 2000
;
Polleux et al., 2002
).
However, interpretation of the phenotype of these null mutants during the
postnatal period is complicated by their poor health. Circumventing these
difficulties, analysis of late-onset (
3-4 weeks of age)
forebrain-restricted TrkB mutant mice suggested that some cortical
excitatory neurons are lost after dendritic retraction over a period of
several weeks (Xu et al.,
2000
). In addition, profound deficits in spatial learning were
documented by Minichiello et al.
(1999
) using a different
late-onset TrkB mutant.
Although analysis of prenatal BDNF requirements is feasible using null
mutant mice, and later adult requirements for BDNF have been indirectly probed
using late-onset TrkB mutants, the initial genetic requirements of
the BDNF-TrkB signaling system in the cortex during the period when BDNF
expression rises dramatically have not been examined. To test these
requirements specifically, we generated early-onset forebrain-restricted BDNF
mutant mice. Notably, we were unable to detect specific cortical neuron
losses, and layer II/III pyramidal neurons initially developed normal soma
size and basal dendritic tree complexity. However, these cells subsequently
shrank in size and lost dendritic complexity at
3 weeks of age, when BDNF
expression normally rises dramatically in the cortex, indicating that the
onset of BDNF expression is necessary for the maintenance of dendritic
structure.
 |
Materials and Methods
|
|---|
Generation of the BDNFlox targeting construct. The
5' lox site was inserted into a DraIII site in the 5'
untranslated region (UTR), 14 bp downstream of the exon V splice acceptor site
and 18 bp upstream of the initiation codon
(Hohn et al., 1990
). The
3' lox site was inserted into a BssHII site in the 3'
UTR1kb3' of the stop codon, downstream of the first of the two
polyadenylation signals (Timmusk et al.,
1993
). A Simian Virus 40 (SV40)-polyadenylation trimer
(Maxwell et al., 1989
) was
inserted upstream of the lox site and an Escherichia coli lacZ gene
was inserted immediately 3' to the lox site, followed by Flp recombinase
target (FRT)-flanked phosphoglycerate phosphoglycarate kinase (PGK) neomycin
cassette (Gorski et al.,
2002
). The resulting genomic sequence containing the 5' lox
site, beginning with the DraIII site and ending with the
DraIII 3' half-site was:
CACCAGGTGATAACTTCGTATAGCATACATTATACGAAGTTATATAACCAGGTG. The 3' lox site,
ending with the start codon of the lacZ gene:
ATAACTTCGTATAGCATACATTATACGAAGTTATCCGCCACCATG.
Isolation of mouse strain. The linearized targeting construct was
electroporated into D3 embryonic stem cells
(Doetschman et al., 1985
) and
screened for homologous recombinants using the polymerase chain reaction. The
primers used were P1: ACACACACTTGAGAAGGGGG (MBDSA9) and P2:
CTCTTCTCACCTGGTTATATAACTTCT (Fig. 1
A). Targeted clones were identified and expanded and the
genomic structure of the mutated BDNF gene was confirmed by DNA blot analysis.
DNA for both PCR and DNA blot analysis was prepared as described previously
(Laird et al., 1991
).
Correctly targeted clones were injected into blastocysts, and mice carrying
the mutation were derived using standard methods.

View larger version (30K):
[in this window]
[in a new window]
|
Figure 1. Generation of forebrain-restricted BDNF mutant mice. A, Diagram of
the BDNFlox allele. Exon V, the BDNF coding exon, is shown
schematically at the top [open bar, 5'-UTR; shaded bar, pro region (a
portion of the BDNF procursor protein removed by proteolytic processing);
filled bar, mature hormone region], flanked by lox sites (filled triangles),
and followed by lacZ (hatched bar), an SV40 intron-polyA (open bar), and an
FRT-flanked PGK neomycin (open bar with triangles). Location of the splice
acceptor (SA) is denoted by a narrow. B, Diagram of the
BDNFlox allele after Cre-mediated recombination.
BDNF-coding sequences in exon V are excised and lacZ is brought downstream of
the splice acceptor site and under control of BDNF promoters. C,
X-gal stained 10 µm coronal section through
Emx1IREScre; BDNFlox/+
brain. D, X-gal stained 10 µm coronal section through
BDNFlacZ/+ brain. E, Growth of
wild-type (WT), Emx1IREScre;
BDNFlox/+,
BDNFneo/+ heterozygous (Hz), and
Emx-BDNFKO mice (KO). Emx-BDNFKO mice
weigh significantly less at 3, 4, 5, and 6 weeks of age.
*p < 0.05. F, Tibia bone length measured for
5-week-old mice (n >10 mice per genotype). No significant
differences were detected between genotypes. G, BDNF protein
quantitated by ELISA, expressed as nanograms of BDNF protein per gram of wet
tissue, in extracts of brain structures from 5-week-old mice (n = 3
mice per genotype). BDNF was not detected (nd) in the visual cortex and
hippocampus of Emx-BDNFKO mice. visc, Visual cortex; hipp,
hippocampus; thal, thalamus; mid/hind, midbrain/hindbrain.
|
|
Genetics and genotyping. All animal procedures were conducted in
accord with U.S. Public Health Service guidelines and with the approval of the
University of Colorado Institutional Animal Care and Use Committee. Two
BDNFlox strains were isolated from independent embryonic stem cell
clones, and the structure of the targeted locus was confirmed by DNA blot
analysis (Fig. 1 B).
To eliminate the PGK-neomycin selectable marker, BDNFlox
mice were mated to the FLP-4917 Flp recombinase-expressing transgenic strain
(Dymecki, 1996
). Anatomical
analyses were performed on mice backcrossed to C57BL/6J for 3-10 generations
from litters culled between postnatal day 7 (P7) and P14 to five or fewer
pups.
BDNF protein ELISA. BDNF protein was quantitated using the BDNF
Emax ImmunoAssay System (Promega, Madison, WI). Tissue was
dissected and weighed and protein was extracted and quantitated following the
manufacturer's protocol, except for a change in lysis buffer (to 50 m
M Tris-HCl, 0.6 M NaCl, 0.2% Triton X-100, 1% BSA, 0.1
M benzothonion chloride, 1 m M benzamidine, 0.1 m
M PMSF, pH 7.4). All samples from an individual animal were run in
triplicate, and the resulting quantities were averaged.
Determination of cortical layer thickness. Mice were heavily
sedated by the intraperitoneal injection of 14 µl/g avertin (0.025 gm 2,2,2
tribromoethylalcohol, 0.025 ml tertamyl alcohol in PBS) and transcardially
perfused with 4% paraformaldehyde in 0.1 M phosphate buffer, pH
7.4. The brains were either cryoprotected overnight in 22% sucrose in 0.1
M phosphate buffer and sectioned coronally at 40 µm on a
cryostat (Leica, Nussloch, Germany) or postfixed for over 12 hr and sectioned
at 50 µm with a vibrating microtome (Leica). Sections were collected into
PBS, washed in 0.5 M Tris, pH 7.5, mounted on slides (Superfrost;
Fisher Scientific, Pittsburgh, PA), and counterstained with cresyl violet,
(0.2% cresyl violet, 0.5% acetic acid, 0.01 M sodium acetate, and
0.02 M sodium hydroxide) and coverslipped with Permount (Fisher
Scientific). Primary somatosensory and visual cortices [identified as per
Franklin and Paxinos (1997
)
and Antonini et al. (1999
)]
were identified at six positions, 100 µm apart, along the rostrocaudal
axis. Layer boundaries were traced using a camera lucida drawing tube, the
thicknesses of layers II-VI measured at three locations along the
medial-lateral axis on each section, and these values were averaged. There
were no significant differences in the values obtained for the more rostral
sections compared with the more caudal sections within an animal (p
> 0.05, t test), so data from all six sections per animal were
averaged, giving a mean layer thickness for somatosensory or visual cortex in
that animal. One-way ANOVA with a Tukey post hoc test was used to
determine statistical significance between genotypes.
Neuron counts and density determination. Alternating 50 and 500
µm vibratome sections were prepared as above. A block
2 mm by 2 mm of
the primary visual cortex was dissected from the 500 µm sections, embedded
in JB4 plastic resin (Electron Microscopy Sciences, Fort Washington, PA), and
sectioned coronally at 3 µm with a glass knife. Sections were collected
into water, mounted, and counterstained with cresyl violet. Layers were
identified, outlined, and measured in the 50 µm cresyl violet-stained
sections of primary visual cortex. Although the overall thickness of the
cortex varied across the set of 500 µm sections from an animal, the
fractional layer contributions did not vary significantly. Thus, cortical
layer boundaries were defined as percentages of total cortex thickness, which
were used to draw layer boundaries onto the 3 µm sections. Neurons (cells
with a darkly stained cytoplasm and a large, distinct, and more lightly
stained nucleus with a nucleolus) were counted in a 215 µm wide strip of
cortex from pictures taken at 630x magnification, cortical area was
measured using software (Openlab, Coventry, England), and the density of
neurons was calculated. One-way ANOVA with a Tukey post hoc test was
used to determine statistical significance.
Diolistics. Diolistics was performed as described in Gan et al.
(2000
) with slight
modification. The lipophilic dyes DiI and DiO (Molecular Probes, Eugene, OR)
were dissolved in methylene chloride to a final concentration of 0.06 mg/µl
in 50 µl. The solubilized dyes and 25 mg of tungsten beads were sonicated
in a water bath sonicator to dryness, then 1.5 ml of water was added and the
beads were sonicated for 5 min. Approximately 75 cm of Gold Coat tubing
(Bio-Rad, Hercules, CA) was coated with 3 ml of DiI/DiO tungsten slurry.
Coronal sections (200 µm) were prepared as described above on a vibrating
microtome. Eight to 12 visual cortical slices were shot using this tubing in a
gene gun (Bio-Rad) at 70-80 psi, through a 3 µm pore size and 8.0 x
105 pores/cm2 density filter (Falcon cell culture
inserts, catalog number 3096; Becton Dickinson, Mountain View, CA). The slices
were then placed in PBS, incubated in the dark at room temperature overnight,
then at 4°C overnight in 4% paraformaldehyde in 0.1 M sodium
phosphate, pH 7.4, washed in 100 m M Tris, pH 7.4 and mounted onto
Superfrost/Plus microscope slides (Fisher Scientific) using ProLong Antifade
mounting media (Molecular Probes). Fluorescence images (1000x
magnification) were taken at 0.5 µm intervals through the entire visible
extent of each cell analyzed using a Zeiss (Oberkochen, Germany) Axioplan
deconvolution microscope with attached Hamamatsu (Bridgewater, NJ) C4742-95
digital camera. The number of primary dendrites, branches per primary
dendrites, and soma area were analyzed with the investigator unaware of the
genotype using the Open Lab software suite (Improvision, Coventry, UK).
Biocytin analysis of dendritic complexity. Layer II/III neurons
were retrogradely filled as described previously
(Xu et al., 2000
). Vibratome
sections (75 µm) were processed for peroxidase staining. Endogenous
peroxidases were quenched by 30 min incubation in 10% methanol and 3%
H2O2 in PBS. Sections were then rinsed five times in PBS
and incubated for 2-5 hr in 0.4% vectastain solution A and B (Vector
Laboratories, Burlingame, CA) and 0.0075% Triton X-100 in PBS, rinsed three
times in PBS, incubated for 5 min. in 0.1% glutaraldehyde in PBS, then rinsed
three times in PBS and allowed to develop for 2-5 min. in 0.014% cobalt
chloride, 0.014% nickel chloride, and 0.003% H2O2 0.05%
diaminobenzidine in PBS. Sections were mounted on slides, dehydrated, and
coverslipped as described above.
Cells were reconstructed and drawn using a camera lucida drawing tube at
400x magnification, and a modified Sholl analysis
(Sholl, 1953
) was used.
Concentric circles in 20 µm diameter increments were drawn around the
center of the reconstructed soma, and the number of dendrites crossing each
circle was counted. In addition, the number of primary, secondary, tertiary,
and higher-order dendrites, dendrite branch points and end points were
counted. Soma sizes were measured using NIH Image software. One-way ANOVA with
a Tukey post hoc test was used to determine statistical
significance.
Cell counts using immunocytochemical markers. Cryostat (40 µm)
or vibratome (50 µm) sections, prepared as described above, were collected
into PBS, incubated in block (Tris-buffered saline, 0.4% Triton X-100, 1%
glycine, 1% bovine serum albumin, and 1% normal goat serum) for 4 hr at room
temperature, and then incubated in primary antibody for 2 d at 4°C.
Primary antibodies specific for
-galactosidase (1:1000, ICN
Pharmaceuticals, Auroria, OH; or 1:2000, from C. Yee and T. Finger, University
of Colorado Health Sciences Center, Denver, CO), NeuN (1:1000, Molecular
Probes), Calretinin (1:1000), Calbindin (1:200), GABA (1:500, Sigma, St Louis,
MO), NPY (1:1000, Incstar, Minneapolis, MN), S100 (1:500, DAKO, Glostrup,
Denmark), SCIP (1:100, a gift from Dr. G. Lemke, Salk Institute, San Diego,
CA) and ER81 (1:500, a kind gift from Dr. T. M. Jessell, Columbia University,
New York, NY).
Sections were washed three times in TBST (Tris-buffered saline, 0.4% Triton
X-100) for 5 min and incubated in Alexa 488 goat anti-mouse IgG antibody
(1:200, Molecular Probes) and Alexa 546 goat anti-rabbit IgG antibody (1:200,
Molecular Probes) for 2 hr at room temperature. Sections were washed twice in
TBST, once in TBS and once in 0.5 M Tris, pH 7.5, before mounting
on Superfrost slides and coverslipped with Fluoro-mount (Fisher Scientific),
or they were incubated in 0.2 M KCl, pH 2, for 2 min, incubated in
0.0001% Bisbenzamide in 0.2 M KCl, pH 2, for 45 sec, washed in 0.2
M KCl, pH 2, for 2 min and then rinsed in 0.5 M Tris, pH
7.5, before coverslipping as above. Images were captured using a microscope
(Leica) running Openlab software (Improvision).
Calbindin- and parvalbumin-positive cells were counted in three strips of
primary visual cortex 1200 µm wide at 100x magnification.
Immunopositive cells were counted across the entire thickness of the cortex,
except for Calbindin, for which only layers IV-VI were counted because
Calbindin is also expressed in pyramidal neurons in layers II/III. Between
five and eight strips per animal of primary visual cortex 335 µm wide, at
100x magnification, were used to count the ratio of GABA, SCIP, and
ER81-positive cells to NeuN-positive cells. Counts were performed blind to the
animal's genotype. One-way ANOVA with a Tukey post hoc test was used
to determine statistical significance.
 |
Results
|
|---|
Generation of early forebrain-restricted BDNF mutant mice
To enable the generation of tissue-specific BDNF mutant mice using the
Cre-site-specific DNA recombinase, lox sites were inserted into exon V, the
BDNF protein-coding exon. A trimerized polyadenylation signal was inserted
upstream of the 3' lox site, and an E. coli lacZ gene was
inserted downstream (Fig.
1A). Cre-mediated recombination deletes the
polyadenylation signals, allowing lacZ transcription and translation
in place of BDNF (Fig.
1B). Mice homozygous for BDNFlox
(BDNFlox/lox) are viable and fertile, and in 5-week-old
BDNFlox/lox mice BDNF protein concentration in visual
cortex and hippocampus was not significantly different from wild-type
(n = 4 mice/genotype, p > 0.05).
To produce forebrain-restricted BDNF mutant mice,
BDNFlox/+ mice were mated to
Emx1IREScre/+;
BDNFneo/+ mice.
Emx1IREScre/+ mice, heterozygous for the
Emx1IREScre allele, express Cre recombinase by embryonic day 10.5
in the precursors of cortical and hippocampal excitatory neurons and glia,
causing recombination between lox sites, without expression in most
subcortical structures and peripheral tissues
(Gorski et al., 2002
).
Forebrain-specific mutant mice have the genotype
Emx1IREScre/+; BDNFneo/lox
(referred to hereafter as Emx-BDNFKO). Control genotypes
used included mice referred to as wild-type (including true wild-type,
Emx1IREScre/+, and
BDNFlox/+ genotypes) and heterozygotes
(including BDNFneo/+ and
BDNFneo/lox).
Extent and specificity of the early forebrain-restricted
BDNF mutation
Although we previously characterized the timing, tissue, and cell-type
specificity of Emx1IREScre-mediated recombination using
Cre-dependent reporter mouse strains
(Gorski et al., 2002
), we
wanted to determine directly its activity on the BDNFlox
allele. Spatial and temporal specificity of recombination was characterized by
X-gal staining of brains from Emx1IREScre/+;
BDNFlox/+ mice at 2, 3, and 5 weeks of age.
Recombination was extensive in the neocortex, hippocampus, and amygdala and
was scarce to undetectable in other CNS regions. The onset and extent of
-Gal expression in the neocortex and hippocampus of
Emx1IREScre/+;
BDNFlox/+ mice was both qualitatively
(Fig. 1C,D) and
quantitatively (data not shown) indistinguishable from age-matched
BDNFlacZ/+ mice indicating that
EmxIREScre/+ causes essentially complete
deletion of the BDNF coding sequences in neocortex and hippocampus before the
onset of BDNF expression.
To further determine the efficacy of the Emx-BDNFKO
mutation, BDNF protein from the brains of 5-week-old mice was quantified. BDNF
protein was undetectable in the visual cortex and hippocampus of
Emx-BDNFKO mice (Fig.
1G) (n = 3 mice/genotype, p <
0.001). Although BDNF protein in thalamus and midbrain/hindbrain structures of
Emx-BDNFKO mice was reduced compared with wild-type mice
(p < 0.01), only the cortex and hippocampus were significantly
different compared with heterozygous mice (p < 0.05), indicating
that the subcortical reductions are attributable mostly to the
Emx-BDNFKO mice having one BDNFneo
allele. Thus, these data document an effectively complete loss of BDNF in the
cortex and hippocampus of Emx-BDNFKO mice, and reductions
comparable to those found in heterozygotes in the thalamus and
midbrain/hindbrain.
General characteristics of Emx-BDNFKO mice
Emx-BDNFKO mutant mice often opened their eyes 1 d
later than their littermates, at P15 instead of P14, suggesting that they
mature slightly more slowly than their littermates. At the ages of 3 and 5
weeks Emx-BDNFKO mice weighed less than their littermates
(Fig. 1E). However,
between 2 and 12 weeks, there was not a significant difference in tibia length
between genotypes, indicating that skeletal growth was not affected, and by 8
weeks of age the body weights of wild-type and Emx-BDNFKO
mutant mice were not significantly different
(Fig. 1F). Beyond 16
weeks of age, Emx-BDNFKO mice developed mild obesity (35%
increase in body mass at 16 weeks compared with wild-type, p <
0.05, n = 10). BDNFneo/+ mice
developed more severe obesity and at a younger age, by 8 weeks (80% increase
in body mass at 8 weeks compared with wild-type, p < 0.05,
n = 10) as reported previously
(Lyons et al., 1999
;
Kernie et al., 2000
).
Interestingly, Emx1IREScre;
BDNFlox/+ mice did not become obese, indicating
that, in contrast to widespread BDNF heterozygosity,
forebrain-restricted BDNF heterozygosity is not sufficient to cause
obesity.
Of eight mutants allowed to age, two died between 12 and 14 months, 5
between 14 and 16 months, and 1 at 18 months of age, suggesting a shortening
of lifespan. Emx-BDNFKO mice exhibited poor fecundity;
only two litters were born from 20 matings in which an
Emx-BDNFKO male was paired with a wild-type female or vice
versa (10 matings each way). Emx-BDNFKO males appeared
more aggressive than normal and neither males nor females built normal nests.
Detailed behavioral analysis of Emx-BDNFKO mice has
documented that although abnormalities were not detected in tests for ataxia
and anxiety, there are substantial deficits in spatial and nonspatial learning
(Gorski et al., 2003
).
Cortical volume is reduced but cell losses are not apparent
Despite the behavioral deficits exhibited by Emx-BDNFKO
mice, initial examination of their brains revealed relatively normal
cytoarchitecture. Given the evidence supporting a role for BDNF/TrkB signaling
in the survival, differentiation, and function of cortical neurons, we
analyzed more carefully the cortical anatomy of Emx-BDNFKO
mice. The cortex of 5-week-old Emx-BDNFKO mice was thinner
than in control mice (Fig.
2A-F). Somatosensory cortical thickness was reduced by
12% (p < 0.001, n = 3) and visual cortical thickness was
reduced by 17% (p < 0.001, n = 3). Determination of the
absolute number of neurons in specific cortical regions is impractical, thus,
we quantified neuronal density. A 22% increase in neuron density was found in
layer II/III of Emx-BDNFKO visual cortex compared with
wild-type (Fig. 2C)
(p < 0.01, n = 3), suggesting that thinning of the cortex
is attributable at least partly to shrinkage of neurons. Layers IV-VI showed a
trend toward increased density that was not statistically significant
(Fig. 2G).

View larger version (104K):
[in this window]
[in a new window]
|
Figure 2. Cortical thinning in Emx-BDNFKO mice. Cresyl
violet-stained 50 µm coronal sections of visual (A-C) and
somatosensory (D-F) cortices from 5-week-old WT, Hz, and KO
mice. Cortical thickness is reduced in KO mice, but the cytoarchitecture
appears generally normal and barrels are apparent in somatosensory cortex
(D-F). G, Neuronal density in visual cortex of
5-week-old mice (n = 3 mice per genotype). Neurons are distributed
more densely in layer II/III of KO mice (p < 0.05).
|
|
Late-onset forebrain-restricted TrkB mutant mice were reported to
lose some excitatory neurons in layer V, between 6 and 10 weeks of age,
several weeks after the loss of TrkB (Xu
et al., 2000
). The lost neurons included subsets of neurons
expressing ER81, an ETS family transcription factor
(Lin et al., 1998
), and SCIP,
a POU domain transcription factor (Monuki
et al., 1989
). We counted these cells in 5-week-old mice but found
no significant difference in the ratio of ER81+/NeuN+ or SCIP+/NeuN+ cells
between Emx-BDNFKO mice and control genotypes
(Fig. 3A-F)
(n = 3 mice per genotype). Thus, we did not detect a requirement for
BDNF in the differentiation or survival of SCIP or ER81-expressing layer V
excitatory neurons through 5 weeks of age.

View larger version (39K):
[in this window]
[in a new window]
|
Figure 3. Absence of detectable neuronal or glial losses at 5 weeks of age.
A-F, (20 µm) of layer V of primary visual cortex processed for
ER81 (A, C, E) or SCIP (B, D, F) immunocytochemistry.
G-I, Coronal sections primary visual cortex sections (10 µm)
processed for S100 and NeuN immunoreactivity. Quantitation of ER81 and
SCIP-positive layer V neurons relative to NeuN-positive cells (J),
ratio of S-100-positive astrocytes to NeuN-positive neurons (K), and
the ratio of total cells to NeuN-labeled neurons (L) revealed no
differences between the genotypes (p > 0.05, n = 3 mice
per genotype).
|
|
To test whether cortically produced BDNF is involved in promoting the
migration, chemical differentiation, and/or survival of cortical inhibitory
interneurons, we examined the distribution of GABA-, calbindin-, parvalbumin-,
neuropeptide Y (NPY) and calretinin-expressing cells in the somatosensory and
visual cortices of 3- and 5-week-old mice. No differences in the qualitative
pattern of immunostaining (Fig.
4A), or in the number of GABA-, calbindin-, or
parvalbumin-expressing cells were detected between genotypes
(Fig. 4B,C). Thus, as
determined using these methods, BDNF was not required for the migration,
proliferation, survival, and biochemical differentiation of most cortical
inhibitory interneurons through 5 weeks of age.

View larger version (66K):
[in this window]
[in a new window]
|
Figure 4. Apparently normal biochemical differentiation of cortical inhibitory
neurons. A, Coronal sections (40 µm) of primary visual cortex from
3-week-old mice processed for parvalbumin, calbindin, NPY, and calretinin
immunoreactivity revealed no gross differences in expression pattern.
B, Quantification of calbindin- and parvalbumin-positive neurons from
primary visual cortex of 2-, 3-, and 5-week-old WT and KO mice revealed no
differences between the genotypes (p > 0.05, n = 3 mice
per genotype). C, The ratio of GABA+/NeuN+
neurons is not significantly different at 5 weeks of age (p >
0.05, n = 3 mice per genotype).
|
|
The cortex is highly populated with astrocytes and oligoden-drocytes, and
these cells are known to express the truncated TrkB receptor
(Frisen et al., 1993
) as well
as the full-length TrkB receptor after injury
(McKeon et al., 1997
), and
they have been reported to respond to BDNF
(Roback et al., 1995
). To
determine whether a disruption of the proportion of glia to neurons
contributed to the cortical thinning, we counted non-neuronal cells in the
visual and somatosensory cortex. There was no significant difference in the
ratio of 4',6'-diamidino-2-phenylindole-positive nuclei or
S-100-positive astrocytes to NeuN-positive neurons
(Fig. 3G-I,K,L),
suggesting that Emx-BDNFKO mice have neither lost
significant glial populations nor undergone extensive gliosis. Taken together,
these data support the hypothesis that cortically produced BDNF is not
required for survival of the majority of neurons or glia in the cortex to 5
weeks of age. The absence of detected cell losses and the observed increase in
neuronal density suggested that shrinkage of cortical neurons could cause
cortical thinning in Emx-BDNFKO mice.
BDNF is required for the maintenance of neuronal morphology
Reduced neuron soma size or reduced extent of dendritic arborization could
contribute to cortical thinning. Because layer II/III had significantly
increased neuron density at 5 weeks of age
(Fig. 2C), we studied
layer II/III neurons. At 5 weeks of age, the soma area was reduced by 29 and
24% in Emx-BDNFKO mice compared with wild-type and
heterozygotes, respectively (p < 0.001). This result indicated
that soma shrinkage contributed to cortical thinning, but did not discriminate
between two possibilities; either a failure in the initial development of soma
size or the development of normal soma size followed by contraction. To
distinguish between these possibilities, we analyzed soma size at two younger
ages. At 2 weeks of age the neuron soma area was not significantly different
between the genotypes (p > 0.7)
(Fig. 5A-C), but at 3
weeks of age there was a 28 and 22% decrease in soma area in
Emx-BDNFKO mice compared with wild-type and heterozygous
mice, respectively (p < 0.001 and p < 0.05,
respectively). Between 2 and 5 weeks of age, the soma size did not change
significantly in the wild-type and heterozygous mice. Notably, the soma area
shrank between 2 and 3 weeks of age in Emx-BDNFKO mice
(p < 0.001), and again between 3 and 5 weeks (p <
0.05) in these animals. Thus, BDNF is not required for layer II/III pyramidal
neuron somas to grow to their full size, but is necessary for the maintenance
of soma size between 14 and 35 d of age.

View larger version (51K):
[in this window]
[in a new window]
|
Figure 5. BDNF is required for the maintenance of layer II/III pyramidal neuron
morphology. Examples of DiI labeled visual cortical layer II/III pyramidal
neurons from 2-week-old (A-C) and 5-week-old (D-F) mice and
biocytin-filled and camera lucida-reconstructed layer II/III visual cortical
pyramidal neurons from 5-week-old mice (G-I). J, Soma area
of layer II/III neurons at 2, 3, and 5 weeks of age (n = 3 mice per
genotype, 15 cells per mouse). K, Number of primary dendrites from
2-, 3-, and 5-week-old mice. *p < 0.05;
**p < 0.01; n = 3 mice per genotype, 15 cells
per mouse. L, Number of branch points per primary dendrites for 2-
and 5-week-old mice (n = 3 mice per genotype, 15 cells per mouse).
M, Number of branches per dendrite order for 2- and 5-week-old mice.
*p < 0.05; **p < 0.01;
n = 3 mice per genotype, 15 cells per mouse. H, Modified
Sholl analysis of layer II/III pyramidal neurons from 5-week-old mice.
*p < 0.05; **p < 0.01;
n = 3 mice per genotype, 7 cells per mouse. Data in J-L were
obtained from neurons visualized through diolistic labeling, with the
exception that biocytin-filled and camera lucida-reconstructed neurons were
used for some of the 5-week-old animals for comparison (-b). Data in
M and N were obtained from biocytin-filled and camera
lucida-reconstructed neurons. O, Soma areas measured from calbindin
(calb) and parvalbumin (parv)-positive cortical neurons from 3-week-old mice
revealed a significant difference between Emx-BDNFKO and control
genotypes. **p < 0.01; ***p <
0.01; n = 3 mice per genotype, 55-75 cells per mouse. P-R,
BDNF expression during postnatal cortical development as detected by X-gal
staining of 40 µm sections from BDNFlacZ/+ mice.
Postnatal ages are indicated at the bottom.
|
|
Next, we analyzed the number of primary dendrites, which increases rapidly
during the first two postnatal weeks in rats to beyond the adult level before
declining slightly (Miller,
1988
). At 5 weeks, the number of primary dendrites was reduced, by
36% (p < 0.001) compared with wild-type mice and 25% (p
< 0.001) compared with heterozygotes
(Fig. 5D-I, K). To
distinguish between possible BDNF requirements for the development or
maintenance of dendrite number, we analyzed younger animals. At 2 weeks of age
there was no difference between the genotypes
(Fig. 5A-C,K), but at
3 weeks the number of primary dendrites was reduced by 19% (p <
0.05) compared with wild-type. Importantly, the number of primary dendrites in
Emx-BDNFKO mice was significantly reduced between 2 weeks
of age and both 3 and 5 weeks of age (p < 0.01), indicating that
some primary dendrites formed in Emx-BDNFKO mice but were
subsequently lost, as opposed to a lack of dendrite growth per se. Thus, BDNF
is required in a similar time frame beginning after 2 weeks of age for
maintenance of both soma size and primary basal dendrite number in layer
II/III of the visual cortex.
Several reports have described BDNF influences on the branching of cortical
dendrites. Thus, we analyzed basal dendrite branching in layer II/III. At 2
weeks of age there was no difference in the number of branch points per
primary dendrite between the genotypes, but by 5 weeks of age there was a 29%
reduction compared with wild-type and a 34% reduction compared with
heterozygotes (p < 0.05) (Fig.
5L). Analysis of branch points per dendrite order
revealed significant differences between genotypes (main effect for genotype
F(2,9) = 29.03, p < 0.0001)
(Fig. 5i), with intermediate to
distal dendrites most affected. Modified Sholl analysis revealed a decrease in
basal dendritic arbor complexity at 40 µm and greater distances from the
neuron soma (Fig. 5O)
(p < 0.001), also indicating that distal dendritic branching is
more severely affected than proximal branching. In combination, these data
revealed that cortical BDNF is not required for the initial elaboration of
layer II/III neuron basal dendrites, but is required for the maintenance of
the dendritic tree.
As described above, we did not detect cortical BDNF requirements for the
survival or biochemical differentiation of specific excitatory and inhibitory
neurons, but found that cortical BDNF is required for the maintenance of the
size of layer II/III excitatory neurons. We were curious whether there might
be a similar requirement of BDNF for maintenance of interneuron size. We
measured the soma area of cortical inhibitory neurons and found that at 3
weeks of age the soma area of calbindin-positive neurons from layers IV-VI was
reduced by 20% (p < 0.001) compared with both wild-type and
heterozygous littermates (Fig.
5i). The soma of parvalbumin-positive neurons was reduced by
10% (p < 0.01) (Fig.
5P). Thus, in addition to excitatory neurons, some
inhibitory neurons require cortically produced BDNF for normal morphology by 3
weeks of age. Importantly, the timing of these BDNF requirements correlates
well with the timing of the onset of substantial BDNF expression in visual
cortex as determined using the lacZ marker present in
BDNFlacZ/+ mice
(Fig. 5P-R).
 |
Discussion
|
|---|
Lack of a detected requirement for neuronal survival
Several reports have indicated that BDNF/TrkB signaling supports the
survival of cortical neurons in vitro and in vivo
(Ghosh et al., 1994
;
Alcantara et al., 1997
;
Ohgoh et al., 1998
;
Araki et al., 2000
;
Xu et al., 2000
;
Catapano et al., 2001
). Our
counts of specific neuronal subpopulations and ratios of neurons to
non-neuronal cells revealed no effect of a loss of cortical BDNF. This result
is notably distinct from the analysis of late-onset forebrain-restricted
TrkB mutant mice, with reported losses of ER81- and SCIP-expressing
cortical neurons (Xu et al.,
2000
). The loss of TrkB is expected to lead to a more severe
phenotype than the loss of BDNF, because in addition to BDNF, both NT-4/5 and
NT-3 can activate TrkB (Barbacid,
1994
; Patapoutian and
Reichardt, 2001
). Increased expression of alternate TrkB ligands
might compensate for the loss of BDNF. Indeed, we found that NT-3 protein
levels were significantly elevated in the cortex and hippocampus of 5-week-old
Emx-BDNFKO mice (approximately twofold between
Emx-BDNFKO mice and
BDNFlox/+, p < 0.05, n = 3
mice per genotype), supporting this hypothesis. Also, developmental
compensations might occur in Emx-BDNFKO mice that do not
occur in the in vitro experiments or after adult-onset deletion of
TrkB. Regardless, our data suggest that BDNF is not necessary for the
survival of most cortical neurons during the first 5 weeks of life in the
mouse.
Interneuron differentiation
In vitro and in vivo studies have suggested that BDNF may
influence the maturation of GABAergic inhibitory interneurons
(Marty et al., 1997
). P15-P20
BDNF null mutant mice had reduced expression of NPY, parvalbumin, and
calbindin in the cortex and hippocampus
(Jones et al., 1994
), and mice
overexpressing BDNF under control of the
CaMKII (
subunit
calcium calmodulin kinase II) promoter had precocious expression of the
inhibitory neuron markers glutamic acid decarboxylase (GAD65) and parvalbumin
(Huang et al., 1999
). Thus, we
were surprised that cortical BDNF, although sufficient to enhance
differentiated properties of inhibitory neurons, was not necessary for their
biochemical maturation, as assayed using immunocytochemistry for GABA,
parvalbumin, and calbindin. Perhaps subcortical afferents still expressing
BDNF in Emx-BDNFKO mice including cholinergic afferents
from the basal forebrain (Beaulieu and
Somogyi, 1991
), dopaminergic afferents from the midbrain
(Sesack et al., 1995
), or
noradrenergic afferents from the brainstem
(Paspalas and Papadopoulos,
1999
) provide a source for the differentiation of
interneurons.
BDNF is required for maintenance of neuronal morphology
Our results support the hypothesis that BDNF expression in the developing
forebrain is necessary for the maintenance of the anatomical characteristics
of cortical neurons, both soma size and dendritic structure. Neuronal soma
size has been correlated with both advancing neuronal development and
increased neural activity. The molecular regulation of soma size is not well
understood. Signaling through Ras G-protein and Akt protein kinase has been
shown to affect cell size in multiple organisms and cell types, including
murine cortical neurons (Heumann et al.,
2000
; Kozma and Thomas,
2002
) and Ras and Akt are regulated by TrkB signaling
(Miller and Kaplan, 2001
),
suggesting that reduced signaling through Ras and Akt could lead to neuronal
soma shrinkage in the absence of BDNF.
The processes of initial dendrite formation and branching occurred normally
in the absence of cortical BDNF through the first two postnatal weeks. Thus,
any influence of the low levels of BDNF present in the visual cortex before 2
weeks of age on layer II/III pyramidal neuron development is limited. However,
when BDNF expression normally rises dramatically in the cortex between 2 and 3
weeks of age (Timmusk et al.,
1994
) (Fig.
5L), a requirement for the sustenance of neuronal size
and dendritic complexity became apparent. By 3 and 5 weeks of age,
Emx-BDNFKO mice exhibited significant reductions of basal
dendritic complexity in layer II/III pyramidal neurons.
Similarly, in another in vivo study, Xu et al.
(2000
) reported that the loss
of TrkB sometime between 2 and 4 weeks of age leads to reduced layer
II/III cortical neuron soma size and basal dendrite complexity at 6 weeks of
age, indicating an ongoing need for TrkB signaling in the maintenance of these
cells. It is important to note that the timing of mutation is different in our
study and that of Xu et al.
(2000
). In their mice, there
is little loss of TrkB at 2 weeks, but it plateaus at
4 weeks of
age (Xu et al., 2000
). In
contrast, Emx-BDNFKO mice undergo deletion of the BDNF
coding exon in the embryo. It is possible that the similarities in the loss of
cortical neuron dendritic arborization between 2 and 3 weeks in
Emx-BDNFKO mice and 4 and 6 weeks in late-onset
TrkB mutants (Xu et al.,
2000
) indicate that developmental and adult functions of BDNF in
the cortex are essentially identical.
Previous studies of the effects of added BDNF on dendrites in cultured
cortical slices have been interpreted mostly in the context of roles for
BDNF-TrkB signaling in initiating dendrite growth (McAllister et al.,
1995
,
1996
,
1997
;
Horch et al., 1999
;
Niblock et al., 2000
;
Yacoubian and Lo, 2000
).
However, the ability of TrkB-IgG to cause the loss of previously existing
dendrites in layer IV has been reported previously
(McAllister et al., 1997
),
consistent with our finding that BDNF is necessary for dendrite maintenance in
layer II/III in vivo.
Although some of the specific anatomical abnormalities in layer II/III of
Emx-BDNFKO mice are similar to predictions from BDNF
effects on cultured cortical slices, others are different. Similar to our
findings, Niblock et al.
(2000
) found that bath
application of BDNF to rat cortical slices caused increased intermediate basal
dendritic arborization of layer II/III somatosensory pyramidal neurons. In
contrast to our findings, they found no effect on soma size or the number of
basal dendrites. Horch et al.
(1999
) found that
overexpression of BDNF in ferret slices led to an increase in the number of
layer II/III basal dendrites, consistent with our observations of a loss of
basal dendrites in the absence of BDNF. In contrast to our findings, they
found reduced distal arborization and no effect of TrkB-IgG on the number of
basal dendrites. The differences between the results of these in
vitro studies and our analysis of the BDNF mutants are likely to reside,
at least in part, in the presence of a different growth factor environment and
more intact neural circuitry in vivo relative to cultured slice
preparations.
The mechanism by which BDNF exerts its stabilizing effect on dendrite
morphology is uncertain. BDNF-TrkB signaling might regulate the stability of
dendrites directly. For example, TrkB signaling could regulate the activity of
members of the Rho family of GTPases, known to modify dendrite number, form,
and stability in a variety of neural types including cortical neurons
(Threadgill et al., 1997
;
Li et al., 2000
;
Nakayama et al., 2000
;
Tashiro et al., 2000
;
Wong et al., 2000
;
Hayashi et al., 2002
;
Luo, 2002
). It is known that
neurite outgrowth stimulated by NGF signaling through the TrkA receptor is
regulated by interactions between Rho and Rac
(Yamaguchi et al., 2001
;
Nusser et al., 2002
). Given
that NGF-TrkA and BDNF-TrkB signaling share many common transduction pathways,
BDNF is likely to modulate dendrite structure and stability in part through
the Rho family of GTPases.
Alternatively, BDNF could influence dendritic structure indirectly through
modulating synaptic activity. The levels and/or patterns of neuronal activity
could be perturbed in the absence of BDNF. Both the development and the
stability of dendritic form is sensitive to neural activity and is influenced
by the process of synaptogenesis (Cline,
2001
; Wong and Ghosh,
2002
). BDNF can directly influence neuronal activity at very short
timescales, acting as a neurotransmitter
(Kafitz et al., 1999
). Over
longer time scales, BDNF can influence cortical synaptic strength and
maturation (Akaneya et al.,
1996
,
1997
;
Takei et al., 1997
;
Huber et al., 1998
;
Rutherford et al., 1998
;
Desai et al., 1999
;
Kinoshita et al., 1999
;
Itami et al., 2000
;
Leslie et al., 2001
). The
necessity of BDNF for maximal long-term potentiation of synaptic strength
(Poo, 2001
) could suggest a
requirement for stabilization of many synapses present in wild-type
animals.
Regardless of whether BDNF directly or indirectly influences dendrite
structure, our results indicate that the essential function for cortical BDNF
is not to support neuronal survival, the classic neurotrophic function, or to
regulate the initial growth of cortical dendritic trees, as suggested by
in vitro studies. Instead, cortical BDNF appears to support the
"survival" of dendritic structure that is generated through
BDNF-independent mechanisms. This requirement for dendrite maintenance occurs
during the period of life when BDNF expression normally rises (between eye
opening and weaning in murine visual cortex). This is particularly intriguing
considered in the context of models of activity-dependent development of
circuitry. In such models, an initially exuberant and relatively nonspecific
set of connections is formed and then subsequently refined through a process
in which connections are selected based upon Hebbian rules
(Katz and Shatz, 1996
). A lack
of BDNF could interfere with the maintenance of many connections by not
allowing their reinforcement. It is apparent from our work that BDNF signaling
is necessary in vivo for the maintenance of cortical neuron
morphology during a key phase of life, during which there is
activity-dependent reorganization of cortical circuitry
(Gordon and Stryker, 1996
).
Elucidation of the molecular mechanisms underlying these actions of BDNF on
cortical dendrites and synapses will likely be fruitful in furthering our
understanding of cortical plasticity.
 |
Footnotes
|
|---|
Received Mar. 25, 2003;
revised Jun. 3, 2003;
accepted Jun. 6, 2003.
This work was supported by a Burroughs-Wellcome New Investigator in
Pharmacology Award and grants from the American Cancer Society, the Colorado
Council for Research and Creative Work, and Muscular Dystrophy Association
(K.R.J.). We thank Chris Bassett, Tom Fuller-Rowel, Decha Sermwittawayong,
Morgan Skurky-Thomas, and Tiffany Talley for technical support; Dr. Susan
Dymecki for the FLP mouse strain; Anirvan Ghosh and Louis Reichardt for
helpful suggestions; Jessica Hanover, Naomi Ruff, and Michael Stryker for
their assistance with the biocytin injection procedures; Drs. Greg Lemke,
Cindy Yee, Tom Finger, and Thomas Jessell for providing anti-SCIP,
-
-galactosidase, and -ER81 antibodies; and Wen-Biao Gan for providing
information before publication.
Correspondence should be addressed to Dr. Kevin R. Jones, 347 UCB,
Department of Molecular, Cellular, and Developmental Biology, University of
Colorado, Boulder, CO 80309. E-mail:
krjones{at}stripe.colorado.edu.
Copyright © 2003 Society for Neuroscience
0270-6474/03/236856-10$15.00/0
 |
References
|
|---|
Akaneya Y, Tsumoto T, Hatanaka H (1996) Brain-derived
neurotrophic factor blocks long-term depression in rat visual cortex. J
Neurophysiol 76:
4198-4201.[Abstract/Free Full Text]
Akaneya Y, Tsumoto T, Kinoshita S, Hatanaka H (1997)
Brain-derived neurotrophic factor enhances long-term potentiation in rat
visual cortex. J Neurosci 17:
6707-6716.[Abstract/Free Full Text]
Alcantara S, Frisen J, del Rio JA, Soriano E, Barbacid M,
Silos-Santiago I (1997) TrkB signaling is required for postnatal
survival of CNS neurons and protects hippocampal and motor neurons from
axotomy-induced cell death. J Neurosci
17: 3623-3633.[Abstract/Free Full Text]
Antonini A, Fagiolini M, Stryker MP (1999) Anatomical
correlates of functional plasticity in mouse visual cortex. J
Neurosci 19:
4388-4406.[Abstract/Free Full Text]
Araki T, Yamada M, Ohnishi H, Sano SI, Hatanaka H
(2000) BIT/SHPS-1 enhances brain-derived neurotrophic
factor-promoted neuronal survival in cultured cerebral cortical neurons.
J Neurochem 75:
1502-1510.[Web of Science][Medline]
Barbacid M (1994) The Trk family of neurotrophin
receptors. J Neurobiol 25:
1386-1403.[Web of Science][Medline]
Beaulieu C, Somogyi P (1991) Enrichment of cholinergic
synaptic terminals on GABAergic neurons and coexistence of immunoreactive GABA
and choline acetyltransferase in the same synaptic terminals in the striate
cortex of the cat. J Comp Neurol 304:
666-680.[Web of Science][Medline]
Bibel M, Barde YA (2000) Neurotrophins: key regulators
of cell fate and cell shape in the vertebrate nervous system. Genes
Dev 14:
2919-2937.[Free Full Text]
Catapano LA, Arnold MW, Perez FA, Macklis JD (2001)
Specific neurotrophic factors support the survival of cortical projection
neurons at distinct stages of development. J Neurosci
21: 8863-8872.[Abstract/Free Full Text]
Cline HT (2001) Dendritic arbor development and
synaptogenesis. Curr Opin Neurobiol 11:
118-126.[Web of Science][Medline]
Desai NS, Rutherford LC, Turrigiano GG (1999) BDNF
regulates the intrinsic excitability of cortical neurons. Learn
Mem 6:
284-291.[Abstract/Free Full Text]
Doetschman TC, Eistetter H, Katz M, Schmidt W, Kemler R
(1985) The in vitro development of blastocyst-derived
embryonic stem cell lines: formation of visceral yolk sac, blood islands and
myocardium. J Embryol Exp Morphol 87:
27-45.[Web of Science][Medline]
Dymecki SM (1996) Flp recombinase promotes
site-specific DNA recombination in embryonic stem cells and transgenic mice.
Proc Natl Acad Sci USA 93:
6191-6196.[Abstract/Free Full Text]
Ernfors P, Lee KF, Jaenisch R (1994) Mice lacking
brain-derived neurotrophic factor develop with sensory deficits.
Nature 368:
147-150.[Medline]
Finkbeiner S (2000) Calcium regulation of the
brain-derived neurotrophic factor gene. Cell Mol Life Sci
57: 394-401.[Web of Science][Medline]
Franklin KBJ, Paxinos G (1997) The mouse brain
in stereotaxic coordinates. San Diego, CA: Academic Press.
Frisen J, Verge VM, Fried K, Risling M, Persson H, Trotter J,
Hokfelt T, Lindholm D (1993) Characterization of glial trkB
receptors: differential response to injury in the central and peripheral
nervous systems. Proc Natl Acad Sci USA
90: 4971-4975.[Abstract/Free Full Text]
Gan WB, Grutzendler J, Wong WT, Wong RO, Lichtman JW
(2000) "Di-Olistic" labeling of the nervous system
using lipophilic dye combinations. Neuron
27: 219-225.[Web of Science][Medline]
Gates MA, Tai CC, Macklis JD (2000) Neocortical
neurons lacking the protein-tyrosine kinase B receptor display abnormal
differentiation and process elongation in vitro and in vivo.
Neuroscience 98:
437-447.[Web of Science][Medline]
Ghosh A, Carnahan J, Greenberg ME (1994) Requirement
for BDNF in activity-dependent survival of cortical neurons.
Science 263:
1618-1623.[Abstract/Free Full Text]
Gordon JA, Stryker MP (1996) Experience-dependent
plasticity of binocular responses in the primary visual cortex of the mouse.
J Neurosci 16:
3274-3286.[Abstract/Free Full Text]
Gorski JA, Talley T, Qiu M, Puelles L, Rubenstein JL, Jones KR
(2002) Cortical excitatory neurons and glia, but not GABAergic
neurons, are produced in the Emx1-expressing lineage. J
Neurosci 22:
6309-6314.[Abstract/Free Full Text]
Gorski JA, Balogh SA, Wehner JM, Jones KR (2003)
Learning deficits in forebrain-restricted BDNF mutant mice.
Neuroscience (in press).
Hayashi K, Ohshima T, Mikoshiba K (2002) Pak1 is
involved in dendrite initiation as a downstream effector of Rac1 in cortical
neurons. Mol Cell Neurosci 20:
579-594.[Web of Science][Medline]
Heumann R, Goemans C, Bartsch D, Lingenhohl K, Waldmeier PC,
Hengerer B, Allegrini PR, Schellander K, Wagner EF, Arendt T, Kamdem RH,
Obst-Pernberg K, Narz F, Wahle P, Berns H (2000) Transgenic
activation of Ras in neurons promotes hypertrophy and protects from
lesion-induced degeneration. J Cell Biol
151: 1537-1548.[Abstract/Free Full Text]
Hohn A, Leibrock J, Bailey K, Barde YA (1990)
Identification and characterization of a novel member of the nerve growth
factor/brain-derived neurotrophic factor family. Nature
344: 339-341.[Medline]
Horch HW, Kruttgen A, Portbury SD, Katz LC (1999)
Destabilization of cortical dendrites and spines by BDNF.
Neuron 23:
353-364.[Web of Science][Medline]
Huang EJ, Reichardt LF (2001) Neurotrophins: roles in
neuronal development and function. Annu Rev Neurosci
24: 677-736.[Web of Science][Medline]
Huang ZJ, Kirkwood A, Pizzorusso T, Porciatti V, Morales B, Bear
MF, Maffei L, Tonegawa S (1999) BDNF regulates the maturation of
inhibition and the critical period of plasticity in mouse visual cortex.
Cell 98:
739-755.[Web of Science][Medline]
Huber KM, Sawtell NB, Bear MF (1998) Brain-derived
neurotrophic factor alters the synaptic modification threshold in visual
cortex. Neuropharmacology 37:
571-579.[Web of Science][Medline]
Itami C, Mizuno K, Kohno T, Nakamura S (2000)
Brain-derived neurotrophic factor requirement for activity-dependent
maturation of glutamatergic synapse in developing mouse somatosensory cortex.
Brain Res 857:
141-150.[Web of Science][Medline]
Jones KR, Farinas I, Backus C, Reichardt LF (1994)
Targeted disruption of the BDNF gene perturbs brain and sensory neuron
development but not motor neuron development. Cell
76: 989-999.[Web of Science][Medline]
Kafitz KW, Rose CR, Thoenen H, Konnerth A (1999)
Neurotrophin-evoked rapid excitation through TrkB receptors.
Nature 401:
918-921.[Medline]
Katz LC, Shatz CJ (1996) Synaptic activity and the
construction of cortical circuits. Science
274: 1133-1138.[Abstract/Free Full Text]
Kernie SG, Liebl DJ, Parada LF (2000) BDNF regulates
eating behavior and locomotor activity in mice. EMBO J
19: 1290-1300.[Web of Science][Medline]
Kinoshita S, Yasuda H, Taniguchi N, Katoh-Semba R, Hatanaka H,
Tsumoto T (1999) Brain-derived neurotrophic factor prevents
low-frequency inputs from inducing long-term depression in the developing
visual cortex. J Neurosci 19:
2122-2130.[Abstract/Free Full Text]
Klein R, Smeyne RJ, Wurst W, Long LK, Auerbach BA, Joyner AL,
Barbacid M (1993) Targeted disruption of the trkB neurotrophin
receptor gene results in nervous system lesions and neonatal death.
Cell 75:
113-122.[Web of Science][Medline]
Kozma SC, Thomas G (2002) Regulation of cell size in
growth, development and human disease: PI3K, PKB and S6K.
Bioessays 24:
65-71.[Web of Science][Medline]
Laird PW, Zijderveld A, Linders K, Rudnicki MA, Jaenisch R, Berns A
(1991) Simplified mammalian DNA isolation procedure.
Nucleic Acids Res 19:
4293.[Free Full Text]
Leslie KR, Nelson SB, Turrigiano GG (2001)
Postsynaptic depolarization scales quantal amplitude in cortical pyramidal
neurons. J Neurosci 21:
RC170.[Abstract/Free Full Text]
Li Z, Van Aelst L, Cline HT (2000) Rho GTPases
regulate distinct aspects of dendritic arbor growth in Xenopus central neurons
in vivo. Nat Neurosci 3:
217-225.[Web of Science][Medline]
Lin JH, Saito T, Anderson DJ, Lance-Jones C, Jessell TM, Arber S
(1998) Functionally related motor neuron pool and muscle sensory
afferent subtypes defined by coordinate ETS gene expression.
Cell 95:
393-407.[Web of Science][Medline]
Luo L (2002) Actin cytoskeleton regulation in neuronal
morphogenesis and structural plasticity. Annu Rev Cell Dev Biol
18: 601-635.[Web of Science][Medline]
Lyons WE, Mamounas LA, Ricaurte GA, Coppola V, Reid SW, Bora SH,
Wihler C, Koliatsos VE, Tessarollo L (1999) Brain-derived
neurotrophic factor-deficient mice develop aggressiveness and hyperphagia in
conjunction with brain serotonergic abnormalities. Proc Natl Acad Sci
USA 96:
15239-15244.[Abstract/Free Full Text]
Maisonpierre PC, Belluscio L, Friedman B, Alderson RF, Wiegand SJ,
Furth ME, Lindsay RM, Yancopoulos GD (1990) NT-3, BDNF, and NGF
in the developing rat nervous system: parallel as well as reciprocal patterns
of expression. Neuron 5:
501-509.[Web of Science][Medline]
Marty S, Berzaghi MdaP, Berninger B (1997)
Neurotrophins and activity-dependent plasticity of cortical interneurons.
Trends Neurosci 20:
198-202.[Web of Science][Medline]
Maxwell IH, Harrison GS, Wood WM, Maxwell F (1989) A
DNA cassette containing a trimerized SV40 polyadenylation signal which
efficiently blocks spurious plasmid-initiated transcription.
Biotechniques 7:
276-280.[Web of Science][Medline]
McAllister AK, Lo DC, Katz LC (1995) Neurotrophins
regulate dendritic growth in developing visual cortex. Neuron
15: 791-803.[Web of Science][Medline]
McAllister AK, Katz LC, Lo DC (1996) Neurotrophin
regulation of cortical dendritic growth requires activity.
Neuron 17:
1057-1064.[Web of Science][Medline]
McAllister AK, Katz LC, Lo DC (1997) Opposing roles
for endogenous BDNF and NT-3 in regulating cortical dendritic growth.
Neuron 18:
767-778.[Web of Science][Medline]
McKeon RJ, Silver J, Large TH (1997) Expression of
full-length trkB receptors by reactive astrocytes after chronic CNS injury.
Exp Neurol 148:
558-567.[Web of Science][Medline]
Miller FD, Kaplan DR (2001) Neurotrophin signalling
pathways regulating neuronal apoptosis. Cell Mol Life Sci
58: 1045-1053.[Web of Science][Medline]
Miller M (1988) Development of projection and local
circuit neurons in neocortex. In: Cerebral cortex (Peters A,
Jones EG, eds), pp 133-175. New York:
Plenum.
Minichiello L, Korte M, Wolfer D, Kuhn R, Unsicker K, Cestari V,
Rossi-Arnaud C, Lipp HP, Bonhoeffer T, Klein R (1999) Essential
role for TrkB receptors in hippocampus-mediated learning.
Neuron 24:
401-414.[Web of Science][Medline]
Monuki ES, Weinmaster G, Kuhn R, Lemke G (1989) SCIP:
a glial POU domain gene regulated by cyclic AMP. Neuron
3: 783-793.[Web of Science][Medline]
Nakayama AY, Harms MB, Luo L (2000) Small GTPases Rac
and Rho in the maintenance of dendritic spines and branches in hippocampal
pyramidal neurons. J Neurosci 20:
5329-5338.[Abstract/Free Full Text]
Niblock MM, Brunso-Bechtold JK, Riddle DR (2000)
Insulin-like growth factor I stimulates dendritic growth in primary
somatosensory cortex. J Neurosci 20:
4165-4176.[Abstract/Free Full Text]
Nusser N, Gosmanova E, Zheng Y, Tigyi G (2002) Nerve
growth factor signals through TrkA, phosphatidylinositol 3-kinase, and Rac1 to
inactivate RhoA during the initiation of neuronal differentiation of PC12
cells. J Biol Chem 277:
35840-35846.[Abstract/Free Full Text]
Ohgoh M, Kimura M, Ogura H, Katayama K, Nishizawa Y
(1998) Apoptotic cell death of cultured cerebral cortical neurons
induced by withdrawal of astroglial trophic support. Exp Neurol
149: 51-63.[Web of Science][Medline]
Paspalas CD, Papadopoulos GC (1999) Noradrenergic
innervation of peptidergic interneurons in the rat visual cortex. Cereb
Cortex 9:
844-853.[Abstract/Free Full Text]
Patapoutian A, Reichardt LF (2001) Trk receptors:
mediators of neurotrophin action. Curr Opin Neurobiol
11: 272-280.[Web of Science][Medline]
Polleux F, Whitford KL, Dijkhuizen PA, Vitalis T, Ghosh A
(2002) Control of cortical interneuron migration by neurotrophins
and PI3-kinase signaling. Development
129: 3147-3160.[Abstract/Free Full Text]
Poo MM (2001) Neurotrophins as synaptic modulators.
Nat Rev Neurosci 2:
24-32.[Web of Science][Medline]
Roback JD, Marsh HN, Downen M, Palfrey HC, Wainer BH
(1995) BDNF-activated signal transduction in rat cortical glial
cells. Eur J Neurosci 7:
849-862.[Web of Science][Medline]
Rutherford LC, Nelson SB, Turrigiano GG (1998) BDNF
has opposite effects on the quantal amplitude of pyramidal neuron and
interneuron excitatory synapses. Neuron
21: 521-530.[Web of Science][Medline]
Sesack SR, Snyder CL, Lewis DA (1995) Axon terminals
immunolabeled for dopamine or tyrosine hydroxylase synapse on
GABA-immunoreactive dendrites in rat and monkey cortex. J Comp
Neurol 363:
264-280.[Web of Science][Medline]
Sholl DA (1953) Dendritic organization in the neurons
of the visual and motor cortices of the cat. J Anat
87: 387-406.[Web of Science][Medline]
Silos-Santiago I, Fagan AM, Garber M, Fritzsch B, Barbacid M
(1997) Severe sensory deficits but normal CNS development in
newborn mice lacking TrkB and TrkC tyrosine protein kinase receptors.
Eur J Neurosci 9:
2045-2056.[Web of Science][Medline]
Takei N, Sasaoka K, Inoue K, Takahashi M, Endo Y, Hatanaka H
(1997) Brain-derived neurotrophic factor increases the
stimulation-evoked release of glutamate and the levels of
exocytosis-associated proteins in cultured cortical neurons from embryonic
rats. J Neurochem 68:
370-375.[Web of Science][Medline]
Tashiro A, Minden A, Yuste R (2000) Regulation of
dendritic spine morphology by the rho family of small GTPases: antagonistic
roles of Rac and Rho. Cereb Cortex 10:
927-938.[Abstract/Free Full Text]
Threadgill R, Bobb K, Ghosh A (1997) Regulation of
dendritic growth and remodeling by Rho, Rac, and Cdc42. Neuron
19: 625-634.[Web of Science][Medline]
Timmusk T, Palm K, Metsis M, Reintam T, Paalme V, Saarma M, Persson
H (1993) Multiple promoters direct tissue-specific expression of
the rat BDNF gene. Neuron 10:
475-489.[Web of Science][Medline]
Timmusk T, Belluardo N, Persson H, Metsis M (1994)
Developmental regulation of brain-derived neurotrophic factor messenger RNAs
transcribed from different promoters in the rat brain.
Neuroscience 60:
287-291.[Web of Science][Medline]
Webster MJ, Weickert CS, Herman MM, Kleinman JE (2002)
BDNF mRNA expression during postnatal development, maturation and aging of the
human prefrontal cortex. Brain Res Dev Brain Res
139: 139-150.[Medline]
Wong RO, Ghosh A (2002) Activity-dependent regulation
of dendritic growth and patterning. Nat Rev Neurosci
3: 803-812.[Web of Science][Medline]
Wong WT, Faulkner-Jones BE, Sanes JR, Wong RO (2000)
Rapid dendritic remodeling in the developing retina: dependence on
neurotransmission and reciprocal regulation by Rac and Rho. J
Neurosci 20:
5024-5036.[Abstract/Free Full Text]
Xu B, Zang K, Ruff NL, Zhang YA, McConnell SK, Stryker MP,
Reichardt LF (2000) Cortical degeneration in the absence of
neurotrophin signaling: dendritic retraction and neuronal loss after removal
of the receptor TrkB. Neuron 26:
233-245.[Web of Science][Medline]
Yacoubian TA, Lo DC (2000) Truncated and full-length
TrkB receptors regulate distinct modes of dendritic growth. Nat
Neurosci 3:
342-349.[Web of Science][Medline]
Yamaguchi Y, Katoh H, Yasui H, Mori K, Negishi M
(2001) RhoA inhibits the nerve growth factor-induced Rac1
activation through Rho-associated kinase-dependent pathway. J Biol
Chem 276:
18977-18983.[Abstract/Free Full Text]
This article has been cited by other articles:

|
 |

|
 |
 
S. L. Gourley, J. L. Howell, M. Rios, R. J. DiLeone, and J. R. Taylor
Prelimbic cortex bdnf knock-down reduces instrumental responding in extinction
Learn. Mem.,
November 19, 2009;
16(12):
756 - 760.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. Lotfipour, E. Ferguson, G. Leonard, M. Perron, B. Pike, L. Richer, J. R. Seguin, R. Toro, S. Veillette, Z. Pausova, et al.
Orbitofrontal Cortex and Drug Use During Adolescence: Role of Prenatal Exposure to Maternal Smoking and BDNF Genotype
Arch Gen Psychiatry,
November 1, 2009;
66(11):
1244 - 1252.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. E. Greenberg, B. Xu, B. Lu, and B. L. Hempstead
New Insights in the Biology of BDNF Synthesis and Release: Implications in CNS Function
J. Neurosci.,
October 14, 2009;
29(41):
12764 - 12767.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
K. Diederich, S. Sevimli, H. Dorr, E. Kosters, M. Hoppen, L. Lewejohann, R. Klocke, J. Minnerup, S. Knecht, S. Nikol, et al.
The Role of Granulocyte-Colony Stimulating Factor (G-CSF) in the Healthy Brain: A Characterization of G-CSF-Deficient Mice
J. Neurosci.,
September 16, 2009;
29(37):
11572 - 11581.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
L. Ma, G. F. Lopez, and R. F. Krimm
Epithelial-Derived Brain-Derived Neurotrophic Factor Is Required for Gustatory Neuron Targeting during a Critical Developmental Period
J. Neurosci.,
March 18, 2009;
29(11):
3354 - 3364.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
X.-P. Zhou, K.-Y. Wu, B. Liang, X.-Q. Fu, and Z.-G. Luo
TrkB-mediated activation of geranylgeranyltransferase I promotes dendritic morphogenesis
PNAS,
November 4, 2008;
105(44):
17181 - 17186.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
N. Mellios, H.-S. Huang, A. Grigorenko, E. Rogaev, and S. Akbarian
A set of differentially expressed miRNAs, including miR-30a-5p, act as post-transcriptional inhibitors of BDNF in prefrontal cortex
Hum. Mol. Genet.,
October 1, 2008;
17(19):
3030 - 3042.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. G. Martin, S. Perga, L. Trovo, A. Rasola, P. Holm, T. Rantamaki, T. Harkany, E. Castren, F. Chiara, and C. G. Dotti
Cholesterol Loss Enhances TrkB Signaling in Hippocampal Neurons Aging in Vitro
Mol. Biol. Cell,
May 1, 2008;
19(5):
2101 - 2112.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. Mishra, B. Knerr, S. Paixao, E. R. Kramer, and R. Klein
The Protein Dendrite Arborization and Synapse Maturation 1 (Dasm-1) Is Dispensable for Dendrite Arborization
Mol. Cell. Biol.,
April 15, 2008;
28(8):
2782 - 2791.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
B.-C. Ho, N. C. Andreasen, J. D. Dawson, and T. H. Wassink
Association Between Brain-Derived Neurotrophic Factor Val66Met Gene Polymorphism and Progressive Brain Volume Changes in Schizophrenia
Am J Psychiatry,
December 1, 2007;
164(12):
1890 - 1899.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. D. Strand, Z. C. Baquet, A. K. Aragaki, P. Holmans, L. Yang, C. Cleren, M. F. Beal, L. Jones, C. Kooperberg, J. M. Olson, et al.
Expression Profiling of Huntington's Disease Models Suggests That Brain-Derived Neurotrophic Factor Depletion Plays a Major Role in Striatal Degeneration
J. Neurosci.,
October 24, 2007;
27(43):
11758 - 11768.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C. Itami, F. Kimura, and S. Nakamura
Brain-Derived Neurotrophic Factor Regulates the Maturation of Layer 4 Fast-Spiking Cells after the Second Postnatal Week in the Developing Barrel Cortex
J. Neurosci.,
February 28, 2007;
27(9):
2241 - 2252.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. B. Lang, V. Stein, T. Bonhoeffer, and C. Lohmann
Endogenous Brain-Derived Neurotrophic Factor Triggers Fast Calcium Transients at Synapses in Developing Dendrites
J. Neurosci.,
January 31, 2007;
27(5):
1097 - 1105.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
H. Fukumitsu, M. Ohtsuka, R. Murai, H. Nakamura, K. Itoh, and S. Furukawa
Brain-Derived Neurotrophic Factor Participates in Determination of Neuronal Laminar Fate in the Developing Mouse Cerebral Cortex
J. Neurosci.,
December 20, 2006;
26(51):
13218 - 13230.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
I. C Maier and M. E Schwab
Sprouting, regeneration and circuit formation in the injured spinal cord: factors and activity
Phil Trans R Soc B,
September 29, 2006;
361(1473):
1611 - 1634.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
B.-C. Ho, P. Milev, D. S. O'Leary, A. Librant, N. C. Andreasen, and T. H. Wassink
Cognitive and Magnetic Resonance Imaging Brain Morphometric Correlates of Brain-Derived Neurotrophic Factor Val66Met Gene Polymorphism in Patients With Schizophrenia and Healthy Volunteers.
Arch Gen Psychiatry,
July 1, 2006;
63(7):
731 - 740.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. Alcantara, E. Pozas, C. F. Ibanez, and E. Soriano
BDNF-modulated Spatial Organization of Cajal-Retzius and GABAergic Neurons in the Marginal Zone Plays a Role in the Development of Cortical Organization
Cereb Cortex,
April 1, 2006;
16(4):
487 - 499.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. A. Sorensen and E. W. Rubel
The Level and Integrity of Synaptic Input Regulates Dendrite Structure
J. Neurosci.,
February 1, 2006;
26(5):
1539 - 1550.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. Chakravarthy, M. H. Saiepour, M. Bence, S. Perry, R. Hartman, J. J. Couey, H. D. Mansvelder, and C. N. Levelt
Postsynaptic TrkB signaling has distinct roles in spine maintenance in adult visual cortex and hippocampus
PNAS,
January 24, 2006;
103(4):
1071 - 1076.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
L. Imamura, M. Yasuda, K. Kuramitsu, D. Hara, A. Tabuchi, and M. Tsuda
Deltamethrin, a Pyrethroid Insecticide, Is a Potent Inducer for the Activity-Dependent Gene Expression of Brain-Derived Neurotrophic Factor in Neurons
J. Pharmacol. Exp. Ther.,
January 1, 2006;
316(1):
136 - 143.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
B. Hu, A. M. Nikolakopoulou, and S. Cohen-Cory
BDNF stabilizes synapses and maintains the structural complexity of optic axons in vivo
Development,
October 1, 2005;
132(19):
4285 - 4298.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
N. Kishi and J. D. Macklis
Dissecting MECP2 Function in the Central Nervous System
J Child Neurol,
September 1, 2005;
20(9):
753 - 759.
[Abstract]
[PDF]
|
 |
|

|
 |

|
 |
 
N. Kishi and J. D. Macklis
Dissecting MECP2 Function in the Central Nervous System
J Child Neurol,
August 1, 2005;
20(8):
753 - 759.
[Abstract]
[PDF]
|
 |
|

|
 |

|
 |
 
E. M. Y. Moresco, S. Donaldson, A. Williamson, and A. J. Koleske
Integrin-Mediated Dendrite Branch Maintenance Requires Abelson (Abl) Family Kinases
J. Neurosci.,
June 29, 2005;
25(26):
6105 - 6118.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
Z. C. Baquet, P. C. Bickford, and K. R. Jones
Brain-Derived Neurotrophic Factor Is Required for the Establishment of the Proper Number of Dopaminergic Neurons in the Substantia Nigra Pars Compacta
J. Neurosci.,
June 29, 2005;
25(26):
6251 - 6259.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
B. W. Luikart, S. Nef, T. Virmani, M. E. Lush, Y. Liu, E. T. Kavalali, and L. F. Parada
TrkB Has a Cell-Autonomous Role in the Establishment of Hippocampal Schaffer Collateral Synapses
J. Neurosci.,
April 13, 2005;
25(15):
3774 - 3786.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. Chen, A. Zacharek, C. Zhang, H. Jiang, Y. Li, C. Roberts, M. Lu, A. Kapke, and M. Chopp
Endothelial Nitric Oxide Synthase Regulates Brain-Derived Neurotrophic Factor Expression and Neurogenesis after Stroke in Mice
J. Neurosci.,
March 2, 2005;
25(9):
2366 - 2375.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
T. Hashimoto, S. E. Bergen, Q. L. Nguyen, B. Xu, L. M. Monteggia, J. N. Pierri, Z. Sun, A. R. Sampson, and D. A. Lewis
Relationship of Brain-Derived Neurotrophic Factor and Its Receptor TrkB to Altered Inhibitory Prefrontal Circuitry in Schizophrenia
J. Neurosci.,
January 12, 2005;
25(2):
372 - 383.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
L. Pezawas, B. A. Verchinski, V. S. Mattay, J. H. Callicott, B. S. Kolachana, R. E. Straub, M. F. Egan, A. Meyer-Lindenberg, and D. R. Weinberger
The Brain-Derived Neurotrophic Factor val66met Polymorphism and Variation in Human Cortical Morphology
J. Neurosci.,
November 10, 2004;
24(45):
10099 - 10102.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
Z. C. Baquet, J. A. Gorski, and K. R. Jones
Early Striatal Dendrite Deficits followed by Neuron Loss with Advanced Age in the Absence of Anterograde Cortical Brain-Derived Neurotrophic Factor
J. Neurosci.,
April 28, 2004;
24(17):
4250 - 4258.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. Peet
Diet, diabetes and schizophrenia: review and hypothesis
The British Journal of Psychiatry,
April 1, 2004;
184(47):
s102 - s105.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
L. Tessarollo, V. Coppola, and B. Fritzsch
NT-3 Replacement with Brain-Derived Neurotrophic Factor Redirects Vestibular Nerve Fibers to the Cochlea
J. Neurosci.,
March 10, 2004;
24(10):
2575 - 2584.
[Abstract]
[Full Text]
[PDF]
|
 |
|