 |
The Journal of Neuroscience, August 6, 2003, 23(18):7107-7116
Previous Article | Next Article 
Integrin Requirement for Hippocampal Synaptic Plasticity and Spatial Memory
Chi-Shing Chan,1
Edwin J. Weeber,3
Sindhu Kurup,1
J. David Sweatt,3 and
Ronald L. Davis1,2
Departments of 1Molecular and Cellular Biology
and 2Psychiatry and Behavioral Sciences,
3Division of Neuroscience, Baylor College of Medicine,
Houston, Texas 77030
 |
Abstract
|
|---|
The establishment of memory requires coordinated signaling between
presynaptic and postsynaptic terminals in the CNS. The integrins make up a
large family of cell adhesion receptors that are known to mediate
bidirectional signaling between cells or between cells and their external
environment. We show here that many different integrins, including 3
and 5, are expressed broadly in the adult mouse brain and are
associated with synapses. Mice with genetically reduced expression of 3
integrin fail to maintain long-term potentiation (LTP) generated in
hippocampal CA1 neurons. Mice with reduced expression of the 3 and
5 integrins exhibit a defect in paired-pulse facilitation. Mice with
reduced expression of 3, 5, and 8 are defective in
hippocampal LTP and spatial memory in the water maze but have normal fear
conditioning. These results demonstrate that several different integrins are
involved in physiological plasticity and provide the first evidence of their
requirement for behavioral plasticity in vertebrates.
Key words: integrins; synaptic plasticity; PPF; LTP; learning and memory; behaviors
 |
Introduction
|
|---|
Learning occurs via experience-dependent alterations in the strength of
synaptic connections, which, in turn, occur from changes in the biochemistry
and molecular biology underlying synaptic transmission. The presynaptic
terminal contains a complex array of molecules including cytoskeletal proteins
that tether neurotransmitter vesicles, ion channels, and sensors that function
to release neurotransmitter in response to calcium influx
(Garner et al., 2000 ;
Sudhof, 2000 ;
Martin, 2002 ). The
postsynaptic side of the synapse contains molecular machinery of equal
complexity that detects neurotransmitter release, provides for the trafficking
of neurotransmitter receptors, and produces ion influx across the postsynaptic
membrane at fast synapses and the activation of second messenger cascades at
slow synapses (Kennedy, 2000 ;
Greengard, 2001 ;
Sheng, 2001 ). Basal synaptic
communication and the changes attributable to experience require that the
presynaptic and postsynaptic faces of the synapse communicate via adhesive and
signaling events.
One family of cell adhesion receptors with attractive features for
mediating changes in synaptic communication is the integrins. Integrins are
heterodimers of noncovalently linked - and -subunits. Each
subunit has a single transmembrane domain connecting the extracellular
ligand-binding domain to cytoplasmic tails that are linked to the actin
cytoskeleton (Humphries, 2000 ;
van der Flier and Sonnenberg,
2001 ). Currently 19 different -subunits and 8
-subunits are known in vertebrates, and >20 different 
heterodimers have been described.
Recent studies have begun to reveal that integrins help to form the synapse
and that they function in synaptic change and learning. Two vertebrate
integrins, 8 and 8, have been localized to dendritic spines of
pyramidal neurons where they are associated with the postsynaptic density
(PSD) (Einheber et al., 1996 ;
Nishimura et al., 1998 ). The
5 integrin has been shown to distribute preferentially to apical
dendrites of pyramidal cells of the hippocampus and neocortex
(Bi et al., 2001 ), and four
different integrins of Drosophila have been localized to the
presynaptic and/or postsynaptic side of the larval neuromuscular junction
(Prokop, 1999 ). Evidence for a
potential role in synaptic plasticity has been gathered by attenuating the
stability of hippocampal long-term potentiation (LTP), using broad-spectrum
peptide inhibitors of the integrins or other pharmacological reagents
(Bahr et al., 1997 ;
Staubli et al., 1998 ;
Chun et al., 2001 ;
Kramar et al., 2002 ). A direct
link of integrin function to memory formation was demonstrated in
Drosophila, in which the disruption of Volado, a gene
encoding for two forms of -integrin, impairs olfactory learning
(Grotewiel et al., 1998 ).
Furthermore, disruption of the integrin-associated protein, IAP, produces
memory deficits in mice (Huang et al.,
1998 ; Chang et al.,
1999 ,
2001 ). Despite the growing
evidence linking integrin function to synaptic change and learning, the
identification in vertebrates of the relevant integrin proteins from the
numerous family members has not been made. In addition, clear links between
these integrins and their hypothetical roles in synaptic change and behavior
are lacking.
The present study was designed to determine the importance of selected
integrins to mouse learning and synaptic plasticity.
We find that heterozygous mutants of the integrin gene 3, but not of
5 or 8, reduce the magnitude of NMDA receptor-dependent
hippocampal LTP. A deficiency in spatial memory, however, is produced only
when the expression of the three integrin genes, 3, 5, and
8, is reduced simultaneously. The results provide the first evidence
that the integrin class of cell adhesion receptors mediate behavioral
plasticity.
 |
Materials and Methods
|
|---|
Mice and genotyping
All integrin knock-outs used in this study were kept as out-crossed stocks
to C57Bl/6 (Jackson Laboratories, Bar Harbor, ME) or separately to 129SvEv
(Bradley strain). The experiments reported here used animals out-crossed for a
minimum of six generations. All experiments were performed on animals
out-crossed to C57Bl/6 with the exception of that shown in
Figure 3B. Mice were
housed in conventional animal cages and maintained on a 12 hr light/dark
cycle. Integrins mutants were genotyped by genomic blotting and PCR assays of
tail DNA with the use of oligonucleotide primers representing the neomycin
gene and genomic regions flanking the insertions. All animals were handled and
treated during the experiments in ways approved by the Baylor College of
Medicine Institutional Animal Care and Use Committee and according to national
regulations and policies.

View larger version (41K):
[in this window]
[in a new window]
|
Figure 3. Effects of integrin deficiency on hippocampal LTP in area CA1. LTP was
induced by using 100 Hz stimulation (arrow). Data points were normalized to
the average response during an initial 20 min pretetanus stimulation period.
A, B, Similar deficits in LTP were observed at 60 min post-tetanus in
mice heterozygous for integrin 3 knock-out in either C57/Bl6
(n = 7; WT, n = 14) or 129/SvEv (n = 7; WT,
n = 7) backgrounds. C-E, Normal LTP was recorded in
5/+ (n = 9; WT, n = 9), 8/+ (n = 11;
WT, n = 8), and 5/+; 8/+ (n = 9; WT, n
= 9) heterozygotes. F-H, LTP immediately after HFS was normal in
3/+; 5/+ (n = 9; WT, n = 14) heterozygotes but
was reduced in 3/+; 8/+ (n = 8; WT, n = 8) and
3/+; 5/+; 8/+ heterozygotes (n = 5; WT, n
= 9). LTP measured at 60 min after HFS was deficient in all three genotypes.
No LTP was present in the triple heterozygote. Significant differences in
pEPSP were found between the mutant and WT animals at t = 60 min in
A, B and F-H.
|
|
Reverse transcriptase-PCR
Total RNA was extracted from 20-30 mg of isolated brain tissue from
3-month-old C57Bl/6 animals by using RNeasy Mini Kit (Qiagen, Chats-worth, CA)
according to the protocol provided by the manufacturer. Total RNA (4 µg)
was reverse transcribed in a 20 µl reaction volume containing 500 µg/ml
oligo-dT and (in mM) 50 Tris-HCl, pH 8.3, 75 KCl, 3
MgCl2 plus 0.01 M DTT, 500 µM dNTP mix,
and 200 U of Superscript II Reverse Transcriptase (RT; Invitrogen, San Diego,
CA) and was incubated at 42°C for 50 min. For PCR amplification, 2 µl
of first-strand cDNA was added to 25 µl of reaction volume containing (in
mM) 10 Tris-HCl, pH 8.3, 50 KCl, 1.5 MgCl2, 2 dNTP mix
plus 0.1 µM forward and reverse primers and 1 U of Taq
DNA polymerase. The temperature cycling conditions were initial melting at
95°C for 5 min, followed by 30 cycles of 94°C for 30 sec, and
annealing at 57, 60, or 63°C for 1 min, at 72°C for 1 min, and a final
extension at 72°C for 4 min. PCR products were visualized by 1% agarose
gel electrophoresis. The PCR primers that were used [forward, reverse (in
5' to 3' direction)] included the following: 1
(CCTGTACTGTACCCAATTGGATGG, GTGCTCTTATGAAAGTCGGTTTCC); 2
(TCTGCGTGTGGACATCAGTTTGGA, GATAACCCCTGTCGGTACTTCTGC); 3
(ACTACTCCTTACCTCTGCGCATGC, CACTTGCCATTGGTAACTTCATAG-); 4
(GCGAAGAAAACGAGCCAGAAACAT, GGGAGCAGGGGACAGGGGAGAGGA); 5
(CTGCAGCTGCATTTCCGAGTCTGG, GAAGCCGAGCTTGTAGAGGACGTA); 6
(GAGGAATATTCCAAACTGAACTAC, GGAATGCTGTCATCGTACCTAGAG); 7
(CCAGGACCTGGCCATCCGTG, CTATCCTTGCGCAGAATGAC); V
(GTGCCAGCCCATTGAGTTTGATTC, TTCACCACCATAGGGAGCAGCAAT); 9
(GACTGGAGAGGAGGAGAGGGAACT, CGATTAGGGAAAGAGATGCTGACA);
E(TGGAGGAGGAAGACGAGGAG,TTTGGGGAGTTGATGACAGT); 1
(GTGACCCATTGCAAGGAGAAGGAC, GTCATGAATTATCATTAAAAGTTT); 3
(CTGGTGTTTACCACTGATGCCAAG, TGTTGAGGCAGGTGGCATTGAAGG); 4
(CGTTTGTGTTCCAGGTCTTTGAGC, CAGAGAGGAGACGGGGAAATACTT); 5
(ACTTGGAGAACATCCGGAGC, TTGAAGCTGTCGACTCTGTC); 6 (GCTTGGCTCCCGGCTGGC,
AGTTAATGGCAAAATGTGCT); 7 (TGGATGGCTACTACGGGGCTCTGT,
CCTTCTCTTGGGGTCTCACTCTCA).
Synaptosomes and protein analysis
Cortical and hippocampal tissues were removed rapidly from freshly
dissected brain and homogenized in 10 volumes of ice-cold homogenization
buffer (320 mM sucrose, 5 mM HEPES, pH 7.4) with 9-12
strokes of a pestle in a glass homogenizer. The homogenate was centrifuged at
1000 x g at 4°C for 10 min to produce a pellet
(P1) and a supernatant (S1). P1 was washed in
homogenization buffer and centrifuged again to obtain P1' and
S1'. S1 and S1' were combined and
centrifuged at 12,500 x g for 30 min at 4°C to produce
P2. The synaptosome-enriched P2 was washed once again,
then resuspended in homogenization buffer, and layered carefully onto a
7.5-12% Ficoll gradient. The gradients were centrifuged at 68,000 x
g at 4°C for 1 hr, and purified synaptosomes were recovered from
the interface. Then the purified synaptosomes were removed to a beaker and
stirred slowly while homogenization buffer was added drop-wise at 23°C to
a final volume of 50 ml. The solution was centrifuged at 12,000 x
g for 20 min, and the pellet was resuspended in immunoprecipitation
buffer [containing (in mM) 50 Tris, pH 8.0, 1 MgCl2, 150
NaCl plus 1% NP40] along with protease inhibitors (1 mM aprotinin,
1 µg/ml leupeptin, 1 µg/ml antipain, 1 mM benzamidine).
For immunoprecipitation, 1.25 mg of synaptosome preparation was precleared
with protein G-Sepharose (Pierce, Rockford, IL) for 30 min at room temperature
(RT), followed by incubation with the polyclonal anti- 3 ( 3-3209,
Chemicon AB1948 or Chemicon AB1920, Temecula, CA), anti- 5 (Chemicon
AB1928), anti-GluR1 (Chemicon AB1504), or anti-GluR2 (Chemicon AB1768)
antisera for 1 hr at RT. Protein G-Sepharose was added, and the incubation
continued for an additional hour. Then the mix was centrifuged and the pellet
washed three times with 1x PBS (20 mM sodium phosphate, 150
mM NaCl, pH 8.0) plus 1% Triton X-100. The final pellet was
resuspended in 2x SDS nonreducing sample buffer (100 mM
Tris-HCl, pH 6.8, 10 mM EDTA, 4% SDS, 20% glycerol, 0.02%
bromophenol blue).
For Western blotting, the final immunoprecipitated pellet or 25 µg of
total forebrain synaptosomal extract was fractionated by 7.5% SDS-PAGE. The
separated proteins were transferred to Immobilon-P membrane (Millipore,
Bedford, MA). The membrane was incubated with a 1:1000 dilution of
anti- 1 antibody (Chemicon MAB1997), 1:500 anti- 3 antibody
( 3-3209), or 1:800 anti-syntaxin antibody (Stressgen Biotechnologies,
San Diego, CA) for 1 hr at RT, washed three times, and then incubated for 30
min at RT with a horseradish peroxidaseconjugated secondary antibody (Jackson
ImmunoResearch, West Grove, PA). The blot was developed with ECL Western
Blotting Detection Reagent (Amersham Biosciences, Arlington Heights, IL).
Quantitation of signal that was detected in Western blots was performed
with the Scion Image software (Scion, Frederick, MD). The net 3
integrin signal (total signal - background) in each animal was normalized
against the corresponding syntaxin signal, and the normalized 3 level
then was expressed as a percentage of that of the first wild-type animal.
Immunohistochemistry and histology
Immunohistochemical experiments were performed as described by Cherry and
Davis (1995 ). Animals were
anesthetized with isoflurane and perfused with 4% paraformaldehyde in 0.1
M phosphate buffer for 10 min. The dissected brain was separated
into two hemispheres and postfixed in 4% paraformaldehyde for an additional 1
hr at 23°C. Paraffin sections of the brain were incubated in 7.5% goat
serum in PBS containing 0.15% Triton X-100 (GS-PBST) for 1-2 hr at 23°C
and then with 150 µl of diluted primary antisera [1:500 anti- 3
antisera (Chemicon AB1948) or 1:2000 anti-syntaxin antibody (Stressgen)]
overnight at 4°C. Sections were washed twice at 23°C with PBST for 10
min and were incubated with a biotinylated secondary antibody for 1 hr. Then
the sections were washed twice in PBST and finally incubated with Vectastain
ABC reagent (Vector Laboratories, Burlingame, CA) with high salt (0.5
M NaCl) to reduce background staining. The immunostaining was
visualized by reacting sections with 1 mg/ml diaminobenzidine/0.3%
H2O2 for 5-10 min. After two washes in distilled water
the sections were mounted on slides with 80% glycerol. For histological
comparison between 3/+; 5/+; 8/+ heterozygotes and their
wild-type siblings, frozen sections were stained with hematoxylin and eosin
and mounted in Permount.
Electrophysiology
Hippocampal slices (400 µm) were bathed (1 ml/min) with artificial CSF
in an interface chamber maintained at 30°C. The Schaffer collateral
synapse was stimulated, and the population EPSP (pEPSP) was recorded in area
CA1 stratum radiatum. Responses were monitored for 20 min before
high-frequency stimulation (HFS) was given to insure a stable baseline.
Measurements are shown as the average slope of the pEPSP from six individual
traces and are standardized to the 20 min of baseline recordings. Baseline
stimulus intensities were adjusted to produce a pEPSP at 50% of the maximal
response. NMDA-dependent LTP was induced with one set of HFS consisting of two
trains of 100 Hz stimulation for 1 sec, separated by 20 sec. Stimulus
intensities used for the HFS were matched to those used in the baseline
recordings. We minimized day-to-day variability in slice preparations and
recordings by preparing mutant and wild-type hippocampal slices simultaneously
and placed them side by side on the same recording chamber. Paired-pulse
facilitation (PPF) was calculated as the average of the ratio of the second to
the first response. Calculating PPF as the mean of the second response divided
by the mean of the first response (Kim and
Alger, 2001 ) did not affect the conclusions as to whether the
control animals exhibited PPF or whether mutant animals were significantly
different from the controls.
Behavioral assays
Water maze. Mice were tested in a polypropylene pool with a
diameter of 1.3 m. The platform for the hidden version of the task was 10
x 10 cm and made of Plexiglas; it was adjusted so that the platform was
2 cm below the water surface. The visible version of the task used a platform
with a black 9 x 9 x 8 cm Plexiglas cube supported 18 cm above the
surface of the platform. Spatial cues were placed on four sides of the room,
and the swim pattern of the animals was tracked with a ceiling-mounted video
camera connected to a digital tracking device (VP200, HVS Image, San Diego,
CA). Data were processed by the HVS water maze software.
Before being trained in the water maze, the mice were handled extensively
for 2 weeks. The animals were kept in individual cages during training and
were allowed to acclimatize to the water maze room 1 hr before the start of
the experiment each day. On the first day of training the mice were given a 60
sec practice swim and a practice climb onto the platform. Mice were placed
into the water facing the wall of the maze and allowed to search for the
platform. The trial ended when an animal climbed onto the platform or when a
maximum of 60 sec had elapsed. The animal was allowed to stay on the platform
for 20 sec before being returned to its cage. Four trials were performed each
day with an inter-trial interval (ITI) of 60 min, and each trial began at
either the 12, 3, 6, or 9 o'clock position of the pool. The platform location
remained the same for any particular mouse for the duration of the training,
but different animals were trained with the platform in different positions to
avoid quadrant bias. Animals were trained for 7 d at the same time each day.
At 1 hr after the last training trial a probe trial (or transfer test) was
administered in which the platform was removed from the pool; animals were
placed in a quadrant opposite to the location of the training platform and
were allowed to swim for 60 sec. Both the time the mice spent searching for
the platform in each quadrant and the number of times the mice entered the
quadrant of the former platform location were measured. The visible platform
task was performed 24 hr after the completion of the probe trial in which the
location of the visible platform varied on each trial. Eight trials were
administered in two blocks of four, with 1 hr ITI between blocks. The latency
and the path length to reach the visible platform were measured.
Fear conditioning. The conditioning chamber (26 x 22 x
18 cm; San Diego Instruments, San Diego, CA) was made of Plexiglas and was
equipped with a grid floor for delivery of the unconditioned stimulus (US) and
photobeams to monitor activity. The conditioning chamber was placed inside a
soundproof isolation cubicle. Training occurred in the presence of white light
and background noise generated by a small fan. Each mouse was placed inside
the conditioning chamber for 2 min before the onset of a conditioned stimulus
(CS; an 85 dB tone), which lasted for 30 sec. A 2 sec US footshock (0.6 mA)
was delivered immediately after the termination of the CS. Each mouse remained
in the chamber for an additional 60 sec, followed by another CS-US pairing.
Each mouse was returned to its home cage after another 30 sec. The test for
contextual fear memory was performed 2 and 24 hr after training by measuring
freezing behavior during a 5 min test in the conditioning chamber. Freezing
was defined as a lack of movement in each 5 sec interval. Cued fear memory was
tested in the presence of red light, coconut odor, and the absence of
background noise. In addition, a triangular black box was put inside the
conditioning chamber and the grid floor covered to present an altered context.
Each mouse was placed in this novel context for 3 min at 24 hr after training,
and they were exposed to the CS for another 3 min. Freezing behavior was
recorded and processed by SDI Photobeam Activity System software (San Diego
Instruments) throughout each testing session.
 |
Results
|
|---|
Expression of integrins in the brain
We began our studies on the potential involvement of integrins in
vertebrate learning by surveying the regional mRNA expression of 16 different
integrin subunits ( 1, 2, 3, 4, 5, 6,
7, 9, V, E, 1, 3, 4, 5,
6, and 7) in the adult mouse brain with RT-PCR
(Table 1). Surprisingly, with
the exception of 9 and E, all of the subunits that were examined
were expressed in most or all of these regions, with only modest or no
preferential expression between these brain regions. The expression of
integrin subunits 9 and E was not detectable in the brain in our
experiments. A representative RT-PCR result for 3 is illustrated in
Figure 1A. In
situ RNA hybridization experiments also have been reported that
demonstrate widespread expression of many different integrin genes in the
adult brain (Pinkstaff et al.,
1999 ).

View larger version (70K):
[in this window]
[in a new window]
|
Figure 1. Analysis of integrin 3 expression in the adult brain. A,
Expression in various regions of the brain as assayed by RT-PCR. Cx, Cortex;
Hp, hippocampus; Cb, cerebellum; Th, thalamus; OB, olfactory bulb.
B-E, Immunohistochemistry of the cortex (B), hippocampus
(C, D), and cerebellum (E) with the use of an anti- 3
integrin antibody. Cellular staining was detected in all six layers of the
cortex (I-VI), in the granule cells of the dentate gyrus (DG), in the
pyramidal cells of the CA1 and CA3 regions, and in Purkinje neurons. At higher
magnification (40 x objective), staining of the processes of the
pyramidal cells (D) and Purkinje neurons (E) was also
detectable (arrows).
|
|
We studied the expression pattern of selected integrin proteins, including
3, by immunohistochemistry to complement previous studies of 5,
8, and V (Einheber et al.,
1996 ; Nishimura et al.,
1998 ; Bi et al.,
2001 ; King et al.,
2001 ). The 3 integrin was detected throughout the brain
(Fig. 1B-E),
consistent with the RT-PCR results. Within the neocortex
3-immunoreactive cells were detected in all six layers of the cortex.
Pyramidal neurons of the CA1 and CA3 regions of the hippocampus were labeled
along with granule neurons of the dentate gyrus and Purkinje neurons of the
cerebellum (Fig.
1B-E). The processes that emanate from many of these
neurons also were found to contain 3-immunoreactive material
(Fig. 1D,E). These
observations along with previous studies reveal that several integrin
subunits, including 3, 5, V, and 8, are expressed
in the adult mouse brain and are associated with neurites and synapses.
We prepared antisera against the cytoplasmic domain of mouse 3
integrin and tested the antisera by Western blotting. The antisera recognized
a 150 kDa protein from the cortex after nonreducing gel electrophoresis,
consistent with the predicted size of the native 3 integrin subunit
(Fig. 2A). The
antisera also recognized a 180 kDa protein in adults, which could be a larger
form of 3 integrin in adult animals or a cross-reacting protein
specific to the adult stage. The specificity of the antisera was tested by
probing extracts from fetuses of homozygous 3 knock-outs collected
before the time of lethality. Control fetuses contained immunoreactive protein
that migrated as a broad band of 150 kDa that was not detected in the
homozygous mutant fetuses (Fig.
2A).

View larger version (33K):
[in this window]
[in a new window]
|
Figure 2. Synaptosome localization of 3 and 5 integrins in cortex and
hippocampus. A, Immunoblot of integrin 3 protein in total
forebrain extracts of 3 integrin heterozygous ( 3/+) adults and
in wild-type (+/+) and homozygous ( 3/ 3) mutant fetuses. The
full-length 3 integrin subunit is identified; the asterisk identifies a
larger integrin that is specific to the adult. Synaptosomes are shown from the
following: lane 1, an 3/ 3 homozygous fetus; lanes 2, 4, two
individual wild-type fetuses; lanes 3, 5, two individual 3/+
heterozygous adults. B, 1 integrin is coimmunoprecipitated by
anti- 3 and anti- 5 antibodies. Lane 1, Immunoblot of 1
integrin protein in total synaptosomal extract; lanes 2-9, proteins from total
synaptosomal extract were immunoprecipitated with no antibody (lane 2),
preimmune serum for 3-3209 (lane 3), anti- 3 integrin
3-3209 (lane 4), AB1948 (lane 5), AB1920 (lane 6), anti- 5
integrin (lane 7), anti-GluR1 (lane 8), or anti-GluR2 (lane 9) antibodies,
followed by immunoblotting with an anti- 1 antibody. C,
Immunoblot to compare the level of integrin 3 protein in total
forebrain extracts of wild-type and heterozygous integrin adults. Two
individual adult animals were used to represent each genotype. The full-length
3 integrin (top) and syntaxin (control; middle) protein are indicated.
In the bottom panel the normalized level of 3 protein in each animal
was expressed as a percentage relative to the level detected in the first
wild-type animal (wt1; see Materials and Methods).
|
|
To explore the subcellular localization of 3 integrin, we prepared
synaptosomes from homogenates of the cortex and hippocampus and assayed these
for the presence of 3. Our anti- 3 antisera as well as two
additional commercial antibodies immunoprecipitated a protein of 110 kDa that
was detected by an anti- 1 antibody from crude synaptosomes (data not
shown) or synaptosomes purified on a Ficoll gradient
(Fig. 2B). 1
integrin is the only -integrin known to associate with 3.
Parallel experiments that used an anti- 5 antibody produced a similar
conclusion. An anti- 5 antibody also immunoprecipitated 1-integrin
from crude and enriched synaptosomes (Fig.
2B). Other antisera [anti-GluR1, anti-GluR2,
anti-syntaxin (data not shown), and anti-SNAP-25 (data not shown)] failed to
immunoprecipitate 1-integrin, confirming the specificity of the
interaction. These results along with previous observations strongly suggest
that several different integrins, including 3/ 1,
5/ 1, and 8/ 1, are localized at synapses in the adult
brain.
Synaptic transmission and plasticity in integrin-deficient mice
To determine whether 3 integrin participates in synaptic
transmission and plasticity, we measured the field EPSPs (fEPSPs) in field CA1
of hippocampal slices prepared from the 3 heterozygous mutants along
with control siblings. Homozygous 3 mutants die within a few hours of
birth (Kreidberg et al.,
1996 ), so this approach assumes that a 50% reduction in integrin
level in heterozygous adults, which we confirmed as shown in
Figure 2C, may produce
phenotypic effects. We observed no difference in basal synaptic transmission
in 3 mutants as compared with their control littermates by comparing
stimulus intensity versus fEPSP or fiber volley versus fEPSP graphs (data not
shown). However, the 3 heterozygotes did exhibit a more rapidly
decaying NMDA receptor-dependent LTP induced with two 100 Hz stimuli
(Fig. 3A,B). The
magnitude of LTP induced in the heterozygotes was not significantly different
from control animals immediately after the tetanus, but it decayed rapidly so
that a significant difference in magnitude was detected at 60 min. The rapidly
decaying LTP was observed in 3 heterozygotes that were out-crossed
repeatedly into two different genetic backgrounds (C57BL/6 and 129SvEv).
Therefore, the LTP deficit maps genetically to the 3 knock-out
allele.
The expression of 5 and 8 integrins overlaps with 3 in
the hippocampus, with all subunits being expressed in the dentate gyrus and in
the CA1 and CA3 fields of the hippocampus (data not shown)
(Pinkstaff et al., 1999 ).
Furthermore, because all three integrins dimerize with 1, we wondered
whether these integrins might compensate for each other functionally. To test
this possibility, we generated 3/+; 5/+ double,
3/+; 8/+ double, 5/+; 8/+ double, and
3/+; 5/+; 8/+ triple heterozygotes and assayed each
genotype for activity-dependent synaptic plasticity. No difference in LTP was
detected in 5/+ or 8/+ animals when compared with control
siblings (Fig. 3C,D).
Similarly, no significant deficit was found in 5/+; 8/+ double
mutants (Fig. 3E). In
contrast, double heterozygotes of 5/+ or 8/+ made in combination
with 3/+ both showed a deficit in LTP
(Fig. 3F,G). The
magnitude of the deficit at 60 min in 3/+; 5/+ and
3/+; 8/+ was similar to that observed in 3/+ heterozygotes
alone (Fig. 3A,F,G).
However, the double heterozygote 3/+; 8/+ produced a more severe
deficiency immediately after the tetanus
(Fig. 3G). The triple
heterozygotes, in contrast, nearly completely eliminated LTP when measured at
60 min (Fig. 3H).
These data obtained with mutant combinations confirm the primary role of
3 in promoting the stability of LTP. They further suggest some
redundancy and a role for 8 for the induction or stability of LTP
within seconds or minutes after tetanus when 3 also is limiting, and
for 5 on the magnitude of LTP that can be generated when both 3
and 8 are limiting.
We next examined PPF in single, double, and triple heterozygotes. No
significant difference was detected at interpulse intervals (IPIs) from 10 to
400 msec between controls and any single or double heterozygote combination
except for 3/+; 5/+ (Fig.
4A-F),

View larger version (27K):
[in this window]
[in a new window]
|
Figure 4. Impaired paired-pulse facilitation (PPF) in integrin mutant heterozygotes.
PPF was used to assay short-term synaptic plasticity and presynaptic function.
Insets, Representative pEPSP traces from PPF experiments with the use of an
interpulse interval of 100 msec (mean of 6 successive EPSPs). The first
response (dotted line) and second response (solid line) for mutant
(a) and wild-type (b) animals are shown. Calibration: 1 mV,
10 msec. Because PPF varies with the size of the first response, the
stimulation was adjusted so that the slope of the pEPSP from the first
stimulus for all slices was the same. Asterisks indicate a value significantly
different from controls (p < 0.05, Student's t test).
A-E, PPF was unaffected for the genotypes 3/+ (n =
10; WT, n = 8), 5/+ (n = 7; WT, n = 8),
8/+ (n = 9; WT, n = 13), 5/+; 8/+
(n = 8; WT, n = 9), and 3/+; 8/+ (n =
11; WT, n = 8). F, G, Defective PPF was observed in
3/+; 5/+ (n = 11; WT, n = 10) at interpulse
intervals of 75, 100, 150, and 200 msec and in 3/+; 5/+;
8/+ mutants (n = 14; WT, n = 8) at interpulse
intervals of 20, 30, 40, 50, 75, 100, and 150 msec.
|
|
which was defective at IPIs of 75-200 msec. The triple heterozygote also
exhibited a deficiency in PPF that is similar or perhaps slightly more extreme
than that observed in 3/+; 5/+ heterozygotes
(Fig. 4G). These data
therefore indicate that wild-type levels of 3 and 5 integrins
are required for normal presynaptic plasticity, as assayed by PPF.
Behavioral analyses of integrin-deficient mice
We tested all single, double, and triple heterozygotes in a series of
neurological and behavioral tests to uncover the potential roles for integrins
in behavior and to correlate behavioral deficits with detectable physiological
deficits. No deficiencies were detected in general health and neurological
properties, including body weight, grooming behavior, walking, mating, reflex
behaviors (eye blink, ear twitch, pupil constriction, body righting, and
whisker touch), and responses to approaching objects or a visual cliff.
Moreover, all seven genotypes were indistinguishable from controls in
performance on the accelerating rotarod, for locomotor activity in an open
field, and thigmotaxis (data not shown). All seven genotypes and their
littermate controls also were tested for spatial memory in the hidden platform
version of the water maze test. In this test, which requires normal
hippocampal function, animals learn to escape to a hidden platform in a pool
by using spatial cues (Morris et al.,
1982 ). None of the single heterozygotes or double heterozygotes
performed differently from their respective controls in this task for spatial
memory. The triple heterozygotes, however, were discovered to be deficient in
spatial memory ability. They exhibited a normally improving escape latency
over 7 d of training that was comparable to control siblings
(Fig. 5A). Subsequent
probe tests, however, demonstrated that the triple heterozygotes spent less
time in the quadrant that previously contained the hidden platform
(Fig. 5B) and failed
to cross the virtual platform position as frequently as controls
(Fig. 5C).
Nevertheless, these animals exhibited a normal speed of swimming and learned
as well as controls in the visible platform version of this task
(Fig. 5E), which does
not require normal hippocampal function
(Morris et al., 1982 ).
Therefore, the simultaneous reduction in expression of 3, 5, and
8 together produces an inability to learn spatial information to the
same extent as control animals. This observation is consistent with the
possibility that the integrins have some overlapping functions in the CNS.

View larger version (27K):
[in this window]
[in a new window]
|
Figure 5. Performance of 3/+; 5/+; 8/+ triple heterozygotes on the
water maze task. A, Escape latency during the acquisition phase in
the hidden platform task. No significant difference was detected between the
mutant heterozygotes (n = 18) and wild-type controls (n =
18) (F(1,27) = 0.72; p = 0.85, ANOVA).
B, Percentage of time spent in each quadrant during a probe trial
performed 1 hr after the last training trial on day 7. Controls (n =
18) spent significantly more time in the trained quadrant than the triple
heterozygotes (n = 18; p < 0.003, Scheffé's
post hoc). ANOVA with repeated measures showed further that the
controls spent significantly more time in the trained quadrant than in the
other quadrants (F(3,68) = 32.53; p <
0.00001), but the triple heterozygotes spent a similar amount of time in all
quadrants (F(3,68) = 2.49; p = 0.067).
C, Number of platform crossings during the probe trial. Control mice
crossed the virtual platform position in the trained quadrant more than the
mutants (p < 0.01, Scheffé's post hoc) and crossed
this position in the trained quadrant more often than the corresponding
position in other quadrants (F(3,68) = 0.32; p =
0.81). D, E, Swim speed and mean escape latency versus trial number
during the visible platform task. No significant difference for either measure
was detected between control and the triple heterozygotes
(F(1,112) = 0.67 and p = 0.697 for swim speed;
F(1,112) = 0.35 and p = 0.93 for escape latency).
Asterisk indicates a significant difference.
|
|
Pavlovian fear conditioning of contextual cues requires the normal
functioning of both the hippocampus and the amygdala, whereas conditioning to
tones only (cued) requires normal functioning of the amygdala, but not the
hippocampus (Kim and Fanselow,
1992 ). We again examined the performance of all seven genotypes
and their controls after both contextual and cued fear conditioning.
During training the animals were presented with two presentations of tone
paired with a footshock inside a soundproof chamber. Then memory of contextual
fear conditioning was measured by placing the animals inside the same chamber
in which they had received the training and recording the percentage of time
that they exhibited a fear response (freezing) over a 5 min interval. The
triple heterozygotes (Fig.
6A) as well as all single and double heterozygotes (data
not shown) exhibited normal memory at both 2 and 24 hr after training. To
measure memory of the tone, we placed the animals into a chamber with
different contextual cues and measured their fear response to the tone. The
percentage of time that the controls and the triple heterozygotes spent
freezing before the tone onset during the memory test (Pre-CS) was not
significantly different (Fig.
6B), nor was there any difference in freezing responses
between groups during the presentation of the tone (CS). Therefore, although
the triple heterozygotes exhibit a deficiency in spatial memory in the water
maze, this deficiency is not generalizable to other hippocampal-based memory
tasks.
Brain anatomy of integrin-deficient mice
To determine whether the deficits in LTP, PPF, and spatial memory observed
in the triple heterozygotes were attributable to developmental defects of the
CNS and particularly the hippocampus, we compared their brain anatomy with
normal siblings. A complete loss of 3 function (homozygous knock-out)
has been reported to disrupt cortical delamination
(Dulabon et al., 2000 ). Nissl
staining of paraffin brain sections failed to uncover any detectable
difference in the laminar organization of the neocortex of the mutant
heterozygotes (Fig.
7A,B). We found no obvious difference in the number of
cells or their organization in each layer in the sensory and motor cortex and
in the various subfields of the hippocampus and dentate gyrus
(Fig. 7C,D). In
addition, we detected no obvious difference in the size or organization of
hippocampal neuropil regions as revealed by staining with an anti-syntaxin
antibody (Fig. 7E,F).
Therefore, these results, combined with behavioral results that test for
normal hippocampal function (Fig.
6), suggest that the behavioral and physiological deficits of the
triple heterozygotes are attributable to a physiological rather than a
developmental requirement for integrins.
 |
Discussion
|
|---|
As reported here, we have examined the role for integrins in synaptic
plasticity and behavior by assaying animals heterozygous for several different
-integrin genes. We adopted the approach of examining dominant
phenotypes for two reasons. First, integrin knock-out alleles, in general, are
homozygous lethal. This is attributable to a requirement for integrins for
some developmental processes (Bouvard et
al., 2001 ). The second reason is that behavioral phenotypes are
quite sensitive to gene dosage. For example, Drosophila learning
mutants (dunce, rutabaga, turnip, cabbage, Volado, and PP1)
and circadian rhythm mutants (clock, cycle, lark, timeless, period,
and doubletime) have behavioral phenotypes that are dominant or
semidominant (Davis, 1996 ;
Grotewiel et al., 1998 ) (see
www.flybase.org).
Moreover, the few mouse learning mutants tested as heterozygotes (NF1, NGF,
BDNF) are also dominant or semidominant
(Chen et al., 1997 ;
Linnarsson et al., 1997 ;
Costa et al., 2002 ). The
sensitivity of behavior to gene dosage is poorly appreciated, yet it offers an
approach to screen for and study mutants that have developmental roles in
addition to roles in the function of the adult CNS.
The results presented here provide direct evidence that integrins are
involved in activity-dependent synaptic plasticity and in spatial memory. The
phenotypes we observed in the mutant animals map to the relevant integrin loci
because we have out-crossed all of the mutants to the wild-type genetic
backgrounds for at least six generations, thereby replacing >98% of the
original genome. In addition, the detected phenotypes in the triple
heterozygotes are not likely attributable to structural defects in the CNS
because we have failed to find any gross neuroanatomical abnormalities in the
mutant brains. However, we cannot rule out the possibility that there may be
subtle subcellular structural defects that exceed our level of detection.
Further support for a physiological versus a structural basis of the mutant
phenotypes is that the mutant animals perform indistinguishably from wild-type
controls in a battery of neurological and behavioral tests, including eye
blink reflex, ear twitch, whisker touch, pupil constriction to light, righting
response, rotarod motor learning, open field exploration, and both cued and
contextual fear conditioning. In other words, the mutants are
indistinguishable from controls in all tests except for the spatial version of
the Morris water maze.
We found that heterozygosity for the 3 locus reduces the magnitude
of LTP to 50% of its normal level when measured at 1 hr after HFS. LTP
immediately after tetanus in these animals also was depressed, but this
depression failed to reach statistical significance. These findings, along
with the normal basal synaptic transmission, normal neuroanatomy, and normal
learning (in many assays) of animals heterozygous for 3 (and/or other
integrin genes), argue that the 3 integrin is required for
experience-dependent synaptic change.
How might this integrin be involved in LTP? Integrins are involved in many
different processes, and there are consequently many different ways in which
the 3 integrin might influence LTP. The integrins are known to
stimulate changes in intracellular calcium
(Sjaastad and Nelson, 1997 ),
so a role in LTP may be via the regulation of this molecule. An alternative is
that the integrins may be involved in some way in the sensitivity of
neurotransmitter receptor function. A switch in NMDA receptor subunit
composition during the maturation of synapses is under the control of certain
integrins (Chavis and Westbrook,
2001 ), and it is easy to envision analogous mechanisms underlying
LTP. A third possibility is that tetanus may induce integrin clustering or a
switch of the integrin into a high-affinity state, one that is sufficient to
produce a structural change at the synapse and an associated potentiation of
function.
The integrins, however, not only are involved in long-term synaptic change
but also are involved in short-term plasticity. Animals heterozygous for
3 and 5 or for 3, 5, and 8 have defective
PPF. PPF in 3/+; 5/+ double heterozygotes, for instance, forms in
parallel to PPF in control animals at short inter-stimulus intervals and
reaches a similar magnitude but is dampened at longer interstimulus intervals.
PPF is attributable to an enhanced probability of synaptic vesicle release,
with the second stimulus caused by residual calcium remaining from the first
(Wu and Saggau, 1994 ). The
presence of the PPF deficit only in animals heterozygous for both 3 and
5, but not either allele alone, suggests that these integrins function
together to influence release probability, perhaps by regulating the
presynaptic level of calcium. As mentioned above, several different integrins,
including 5 1, are involved in regulating intracellular calcium
levels after their activation (Sjaastad
and Nelson, 1997 ). It may be that PPF requires an
integrin-dependent elevation or maintenance of presynaptic calcium after the
first pulse. Alternatively, because integrins function via an intimate
association with the cytoskeleton, they may be involved in directly regulating
release probability via a mechanical mechanism. The compounding effects of
8 in synapses from 3/+; 5/+; 8/+ triple
heterozygotes is likely attributable to a postsynaptic role for 8,
because the expression of this integrin has been found only postsynaptically
(Einheber et al., 1996 ).
Postsynaptic neurons also may play a significant role in modulating
transmitter release at the presynaptic terminals
(Davis and Murphey, 1993 ;
Markram et al., 1998 ;
Reyes et al., 1998 ;
Scanziani et al., 1998 ).
Although animals heterozygous for the 3 null allele have a clear
deficit in LTP, we failed to find any associated behavioral deficit in these
animals. Indeed, a clear phenotype in water maze performance was detected only
in animals simultaneously heterozygous for 3, 5, and 8.
Table 2 summarizes the
correspondence in physiological and behavioral phenotypes of the seven
genotypes that were studied. Some redundancy of integrin function is to be
expected, given that all three of these integrins share 1 as a partner
and that all three interact with some of the same ligands
(van der Flier and Sonnenberg,
2001 ). It is interesting, however, that these heterozygotes
perform normally in contextual fear conditioning, which is also a
hippocampal-dependent task. It is likely that at least some different
molecular mechanisms govern performance in the two different
hippocampal-dependent tasks or that perhaps they require a different threshold
of integrin function for normal performance. The dissociation between LTP and
spatial learning that was observed is possibly also attributable to different
threshold requirements for integrin function, or it is possible that NMDA
receptor-dependent LTP in area CA1 is a permissive but dispensable
physiological component of normal spatial learning.
A myriad of other molecules is involved in integrin interactions and
integrin function. This complexity makes difficult any precise assignment for
how integrins regulate synaptic plasticity and behavior. One attractive
possibility, beyond those mentioned above, is that the integrins function in
synaptic plasticity and behavior by mediating the activation of the MAPK
pathway. The pathway that leads to ERK activation frequently has been
implicated in synaptic change and behavior
(Adams and Sweatt, 2002 ). The
activation of integrins causes activation of the tyrosine kinases FAK, FYN,
and SRC. The phosphorylation of FAK, in particular, by SRC produces a binding
site for the adapter protein, GRB2, which is linked via the activation of RAS
to the MAPK cascade (Giancotti and
Ruoslahti, 1999 ). Another attractive model mentioned above is that
the synaptic integrins function in an inside-to-out signaling such that second
messenger cascade activation in neurons modifies the affinity of integrins at
the cell surface for their ligands
(Grotewiel et al., 1998 ). This
could lead in principle to a fairly rapid but subtle morphological change in
the structure of the synapse such that synaptic transmission would be
altered.
Despite these current unknowns, the available data suggest that the
integrin family of cell adhesion receptors is likely to have a very profound
role in regulating synaptic structure, signaling, and plasticity. There is now
evidence indicating that a minimum of eight different integrins resides at
hippocampal synapses, including 3, 5, V, 8,
1, 3, 5, and 8
(Einheber et al., 1996 ;
Nishimura et al., 1998 ; this
study). These expression data offer intriguing possibilities for integrin
participation in synaptic function. One general possibility is that the
coexpressed integrins may be functionally redundant and participate in the
same synaptic process. Alternatively, they may have distinct functions, with
some being required for maintaining synaptic organization and integrity, for
instance, and others involved in different aspects of synaptic plasticity. The
differential sensitivity of LTP and PPF to integrin gene dosage shown above is
consistent with the idea that the different integrins may have distinct
synaptic functions. A second general possibility is that the integrins may be
expressed at synapses in a combinatorial manner such that different synapses
may express a different combination of integrin receptors. Electron
immunomicrographs that show differential 8 expression at two adjacent
synapses of the same CA1 neuron (Einheber
et al., 1996 ) are consistent with the hypothesis of combinatorial
expression patterns. Such expression patterns would provide marked flexibility
of synapses and neuronal circuits via the cell adhesion and signaling
functions offered by the integrin family of receptors.
 |
Footnotes
|
|---|
Received Mar. 26, 2003;
revised May. 16, 2003;
accepted May. 28, 2003.
We thank Dr. Richard Paylor (Baylor College of Medicine) for significant
help in establishing mouse behavioral assays in the laboratory. We also thank
the Jackson Laboratories, Jordan Kreidberg (Harvard Medical School), and Lou
Reichardt (University of California, San Francisco) for supplying
the 5, 3, and 8 knock-out animals, respectively. This work
was supported by Grant MH60420 from the National Institute of Mental Health to
R.L.D. and the Baylor College of Medicine Mental Retardation Research Center
(Grant HD24064). R.L.D. is the recipient of the R. P. Doherty-Welch Chair in
Science at the Baylor College of Medicine.
Correspondence should be addressed to Ronald L. Davis, Department of
Molecular and Cellular Biology, Baylor College of Medicine, Houston, TX 77030.
E-mail:
rdavis{at}bcm.tmc.edu.
Copyright © 2003 Society for Neuroscience
0270-6474/03/237107-10$15.00/0
 |
References
|
|---|
Adams JP, Sweatt JD (2002) Molecular psychology: roles
for the ERK MAP kinase cascade in memory. Annu Rev Pharmacol
Toxicol 42:
135-163.[Web of Science][Medline]
Bahr BA, Staubli U, Xiao P, Chun D, Ji ZX, Esteban ET, Lynch G
(1997) Arg-Gly-Asp-Ser-selective adhesion and the stabilization
of long-term potentiation: pharmacological studies and the characterization of
a candidate matrix receptor. J Neurosci
17: 1320-1329.[Abstract/Free Full Text]
Bi X, Lynch G, Zhou J, Gall CM (2001) Polarized
distribution of 5 integrin in dendrites of hippocampal and cortical
neurons. J Comp Neurol 435:
184-193.[Web of Science][Medline]
Bouvard D, Brakebusch C, Gustafsson E, Aszodi A, Bengtsson T, Berna
A, Fassler R (2001) Functional consequences of integrin gene
mutations in mice. Circ Res 89:
211-223.[Abstract/Free Full Text]
Chang HP, Lindberg FP, Wang HL, Huang AM, Lee EH
(1999) Impaired memory retention and decreased long-term
potentiation in integrin-associated protein-deficient mice. Learn
Mem 6:
448-457.[Abstract/Free Full Text]
Chang HP, Ma YL, Wan FJ, Tsai LY, Lindberg FP, Lee EH
(2001) Functional blocking of integrin-associated protein impairs
memory retention and decreases glutamate release from the hippocampus.
Neuroscience 102:
289-296.[Medline]
Chavis P, Westbrook G (2001) Integrins mediate
functional pre- and postsynaptic maturation at a hippocampal synapse.
Nature 411:
317-321.[Medline]
Chen KS, Nishimura MC, Armanini MP, Crowley C, Spencer SD, Phillips
HS (1997) Disruption of a single allele of the nerve growth
factor gene results in atrophy of basal forebrain cholinergic neurons and
memory deficits. J Neurosci 17:
7288-7296.[Abstract/Free Full Text]
Cherry JA, Davis RL (1995) A mouse homolog of dunce, a
gene important for learning and memory in Drosophila, is
preferentially expressed in olfactory receptor neurons. J
Neurobiol 28:
102-113.[Web of Science][Medline]
Chun D, Gall CM, Bi X, Lynch G (2001) Evidence that
integrins contribute to multiple stages in the consolidation of long-term
potentiation in rat hippocampus. Neuroscience
105: 815-829.[Web of Science][Medline]
Costa RM, Federov NB, Kogan JH, Murphy GG, Stern J, Ohno M,
Kucherlapati R, Jacks T, Silva AJ (2002) Mechanism for the
learning deficits in a mouse model of neurofibromatosis type 1.
Nature 415:
526-528.[Medline]
Davis GW, Murphey RK (1993) A role for postsynaptic
neurons in determining presynaptic release properties in the cricket CNS:
evidence for retrograde control of facilitation. J Neurosci
13: 3827-3838.[Abstract]
Davis RL (1996) Physiology and biochemistry of
Drosophila learning mutants. Physiol Rev
76: 299-317.[Abstract/Free Full Text]
Dulabon L, Olson EC, Taglienti MG, Eisenhuth S, McGrath B, Walsh
CA, Kreidberg JA, Anton ES (2000) Reelin binds 3 1
integrin and inhibits neuronal migration. Neuron
27: 33-44.[Web of Science][Medline]
Einheber S, Schnapp LM, Salzer JL, Cappiello ZB, Milner TA
(1996) Regional and ultrastructural distribution of the 8
integrin subunit in developing and adult rat brain suggests a role in synaptic
function. J Comp Neurol 370:
105-134.[Web of Science][Medline]
Garner CC, Nash J, Huganir RL (2000) PDZ domains in
synapse assembly and signaling. Trends Cell Biol
10: 274-280.[Web of Science][Medline]
Giancotti FG, Ruoslahti E (1999) Integrin signaling.
Science 285:
1028-1032.[Abstract/Free Full Text]
Greengard P (2001) The neurobiology of slow synaptic
transmission. Science 295:
1024-1030.
Grotewiel MS, Beck CD, Wu KH, Zhu XR, Davis RL (1998)
Integrin-mediated short-term memory in Drosophila.
Nature 391:
455-460.[Medline]
Huang AM, Wang HL, Tang YP, Lee EH (1998) Expression
of integrin-associated protein gene associated with memory formation in rats.
J Neurosci 18:
4305-4313.[Abstract/Free Full Text]
Humphries MJ (2000) Integrin structure. Biochem
Soc Trans 28:
311-339.[Web of Science][Medline]
Kennedy MB (2000) Signal-processing machines at the
postsynaptic density. Science 290:
750-754.[Abstract/Free Full Text]
Kim J, Alger BE (2001) Random response fluctuations
lead to spurious paired-pulse facilitation. J Neurosci
21: 9608-9618.[Abstract/Free Full Text]
Kim JJ, Fanselow MS (1992) Modality-specific
retrograde amnesia of fear. Science 256:
675-677.[Abstract/Free Full Text]
King VR, McBride A, Priestley JV (2001)
Immunohistochemical expression of the 5 integrin subunit in the normal
adult rat central nervous system. J Neurocytol
30: 243-252.[Web of Science][Medline]
Kramar EA, Bernard JA, Gall CM, Lynch G (2002)
3 Integrin receptors contribute to the consolidation of long-term
potentiation. Neuroscience 110:
29-39.[Web of Science][Medline]
Kreidberg JA, Donovan MJ, Goldstein SL, Rennke H, Shepherd K, Jones
RC, Jaenisch R (1996) 3 1 Integrin has a crucial role
in kidney and lung organogenesis. Development
122: 3537-3547.[Abstract]
Linnarsson S, Bjorklund A, Ernfors P (1997) Learning
deficit in BDNF mutant mice. Eur J Neurosci
9: 2581-2587.[Web of Science][Medline]
Markram H, Wang Y, Tsodyks M (1998) Differential
signaling via the same axon of neocortical pyramidal neurons. Proc Natl
Acad Sci USA 95:
5323-5328.[Abstract/Free Full Text]
Martin TPJ (2002) Prime movers of synaptic vesicle
exocytosis. Neuron 34:
9-12.[Web of Science][Medline]
Morris RG, Garrud P, Rawlins JN, O'Keefe J (1982)
Place navigation impaired in rats with hippocampal lesions.
Nature 297:
681-683.[Medline]
Nishimura SL, Boylen KP, Einheber S, Milner TA, Ramos DM, Pytela R
(1998) Synaptic and glial localization of the integrin
v 8 in mouse and rat brain. Brain Res
791: 271-282.[Web of Science][Medline]
Pinkstaff JK, Detterich J, Lynch G, Gall C (1999)
Integrin subunit gene expression is regionally differentiated in adult brain.
J Neurosci 19:
1541-1556.[Abstract/Free Full Text]
Prokop A (1999) Integrating bits and pieces: synapse
structure and formation in Drosophila embryos. Cell Tissue
Res 297:
169-186.[Web of Science][Medline]
Reyes A, Lujan R, Rozov A, Burnashev N, Somogyi P, Sakmann B
(1998) Target cell-specific facilitation and depression in
neocortical circuits. Nat Neurosci 1:
279-285.[Web of Science][Medline]
Scanziani M, Gahwiler BH, Charpak S (1998) Target
cell-specific modulation of transmitter release at terminals from a single
axon. Proc Natl Acad Sci USA 95:
12004-12009.[Abstract/Free Full Text]
Sheng M (2001) Molecular organization of the
postsynaptic specialization. Proc Natl Acad Sci USA
98: 7058-7061.[Abstract/Free Full Text]
Sjaastad MD, Nelson WJ (1997) Integrin-mediated
calcium signaling and regulation of cell adhesion by intracellular calcium.
BioEssays 19:
47-55.[Web of Science][Medline]
Staubli U, Chun D, Lynch G (1998) Time-dependent
reversal of long-term potentiation by an integrin antagonist. J
Neurosci 18:
3460-3469.[Abstract/Free Full Text]
Sudhof TC (2000) The synaptic vesicle cycle revisited.
Neuron 28:
317-320.[Web of Science][Medline]
van der Flier A, Sonnenberg A (2001) Function and
interactions of integrins. Cell Tissue Res
305: 285-298.[Web of Science][Medline]
Wu LG, Saggau P (1994) Presynaptic calcium is
increased during normal synaptic transmission and paired-pulse facilitation,
but not in long-term potentiation in area CA1 of hippocampus. J
Neurosci 14:
645-654.[Abstract]
This article has been cited by other articles:

|
 |

|
 |
 
A. K. Mobley, J. H. Tchaicha, J. Shin, M. G. Hossain, and J. H. McCarty
{beta}8 integrin regulates neurogenesis and neurovascular homeostasis in the adult brain
J. Cell Sci.,
June 1, 2009;
122(11):
1842 - 1851.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
X.-b. Wang, O. Bozdagi, J. S. Nikitczuk, Z. W. Zhai, Q. Zhou, and G. W. Huntley
Extracellular proteolysis by matrix metalloproteinase-9 drives dendritic spine enlargement and long-term potentiation coordinately
PNAS,
December 9, 2008;
105(49):
19520 - 19525.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. Ryu, K. Futai, M. Feliu, R. Weinberg, and M. Sheng
Constitutively Active Rap2 Transgenic Mice Display Fewer Dendritic Spines, Reduced Extracellular Signal-Regulated Kinase Signaling, Enhanced Long-Term Depression, and Impaired Spatial Learning and Fear Extinction
J. Neurosci.,
August 13, 2008;
28(33):
8178 - 8188.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
Y. Ishikawa, Y. Horii, H. Tamura, and S. Shiosaka
Neuropsin (KLK8)-Dependent and -Independent Synaptic Tagging in the Schaffer-Collateral Pathway of Mouse Hippocampus
J. Neurosci.,
January 23, 2008;
28(4):
843 - 849.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. Kostic, J. Sap, and M. P. Sheetz
RPTP{alpha} is required for rigidity-dependent inhibition of extension and differentiation of hippocampal neurons
J. Cell Sci.,
November 1, 2007;
120(21):
3895 - 3904.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. Rohrbough, E. Rushton, E. Woodruff III, T. Fergestad, K. Vigneswaran, and K. Broadie
Presynaptic establishment of the synaptic cleft extracellular matrix is required for post-synaptic differentiation
Genes & Dev.,
October 15, 2007;
21(20):
2607 - 2628.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. K. Sfakianos, A. Eisman, S. L. Gourley, W. D. Bradley, A. J. Scheetz, J. Settleman, J. R. Taylor, C. A. Greer, A. Williamson, and A. J. Koleske
Inhibition of Rho via Arg and p190RhoGAP in the Postnatal Mouse Hippocampus Regulates Dendritic Spine Maturation, Synapse and Dendrite Stability, and Behavior
J. Neurosci.,
October 10, 2007;
27(41):
10982 - 10992.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
V. Nagy, O. Bozdagi, and G. W. Huntley
The extracellular protease matrix metalloproteinase-9 is activated by inhibitory avoidance learning and required for long-term memory
Learn. Mem.,
September 25, 2007;
14(10):
655 - 664.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C.-S. Chan, J. M. Levenson, P. S. Mukhopadhyay, L. Zong, A. Bradley, J. D. Sweatt, and R. L. Davis
{alpha}3-Integrins are required for hippocampal long-term potentiation and working memory
Learn. Mem.,
September 6, 2007;
14(9):
606 - 615.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
O. Bozdagi, V. Nagy, K. T. Kwei, and G. W. Huntley
In Vivo Roles for Matrix Metalloproteinase-9 in Mature Hippocampal Synaptic Physiology and Plasticity
J Neurophysiol,
July 1, 2007;
98(1):
334 - 344.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
D. J. Webb, H. Zhang, D. Majumdar, and A. F. Horwitz
{alpha}5 Integrin Signaling Regulates the Formation of Spines and Synapses in Hippocampal Neurons
J. Biol. Chem.,
March 9, 2007;
282(10):
6929 - 6935.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
T. Murata, H. Ohnishi, H. Okazawa, Y. Murata, S. Kusakari, Y. Hayashi, M. Miyashita, H. Itoh, P.-A. Oldenborg, N. Furuya, et al.
CD47 Promotes Neuronal Development through Src- and FRG/Vav2-Mediated Activation of Rac and Cdc42
J. Neurosci.,
November 29, 2006;
26(48):
12397 - 12407.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
Z. Huang, K. Shimazu, N. H. Woo, K. Zang, U. Muller, B. Lu, and L. F. Reichardt
Distinct Roles of the beta1-Class Integrins at the Developing and the Mature Hippocampal Excitatory Synapse
J. Neurosci.,
October 25, 2006;
26(43):
11208 - 11219.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. Syken, T. GrandPre, P. O. Kanold, and C. J. Shatz
PirB Restricts Ocular-Dominance Plasticity in Visual Cortex
Science,
September 22, 2006;
313(5794):
1795 - 1800.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
P. Bhandari, J. W. Gargano, M. M. Goddeeris, and M. S. Grotewiel
Behavioral Responses to Odorants in Drosophila Require Nervous System Expression of the {beta} Integrin Gene Myospheroid
Chem Senses,
September 1, 2006;
31(7):
627 - 639.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
E. A. Kramar, B. Lin, C. S. Rex, C. M. Gall, and G. Lynch
Integrin-driven actin polymerization consolidates long-term potentiation
PNAS,
April 4, 2006;
103(14):
5579 - 5584.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
V. Nagy, O. Bozdagi, A. Matynia, M. Balcerzyk, P. Okulski, J. Dzwonek, R. M. Costa, A. J. Silva, L. Kaczmarek, and G. W. Huntley
Matrix Metalloproteinase-9 Is Required for Hippocampal Late-Phase Long-Term Potentiation and Memory
J. Neurosci.,
February 15, 2006;
26(7):
1923 - 1934.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
Y. Shi and I. M. Ethell
Integrins Control Dendritic Spine Plasticity in Hippocampal Neurons through NMDA Receptor and Ca2+/Calmodulin-Dependent Protein Kinase II-Mediated Actin Reorganization
J. Neurosci.,
February 8, 2006;
26(6):
1813 - 1822.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C.-S. Chan, E. J. Weeber, L. Zong, E. Fuchs, J. D. Sweatt, and R. L. Davis
{beta}1-Integrins Are Required for Hippocampal AMPA Receptor-Dependent Synaptic Transmission, Synaptic Plasticity, and Working Memory
J. Neurosci.,
January 4, 2006;
26(1):
223 - 232.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
L. Perez-Martinez and D. M. Jaworski
Tissue Inhibitor of Metalloproteinase-2 Promotes Neuronal Differentiation by Acting as an Anti-Mitogenic Signal
J. Neurosci.,
May 18, 2005;
25(20):
4917 - 4929.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
H. Ohnishi, Y. Kaneko, H. Okazawa, M. Miyashita, R. Sato, A. Hayashi, K. Tada, S. Nagata, M. Takahashi, and T. Matozaki
Differential Localization of Src Homology 2 Domain-Containing Protein Tyrosine Phosphatase Substrate-1 and CD47 and Its Molecular Mechanisms in Cultured Hippocampal Neurons
J. Neurosci.,
March 9, 2005;
25(10):
2702 - 2711.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
B. Lin, E. A. Kramar, X. Bi, F. A. Brucher, C. M. Gall, and G. Lynch
Theta Stimulation Polymerizes Actin in Dendritic Spines of Hippocampus
J. Neurosci.,
February 23, 2005;
25(8):
2062 - 2069.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
T. Numakawa, T. Ishimoto, S. Suzuki, Y. Numakawa, N. Adachi, T. Matsumoto, D. Yokomaku, H. Koshimizu, K. E. Fujimori, R. Hashimoto, et al.
Neuronal Roles of the Integrin-associated Protein (IAP/CD47) in Developing Cortical Neurons
J. Biol. Chem.,
October 8, 2004;
279(41):
43245 - 43253.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
V. Sytnyk, I. Leshchyns'ka, A. Dityatev, and M. Schachner
Trans-Golgi network delivery of synaptic proteins in synaptogenesis
J. Cell Sci.,
January 22, 2004;
117(3):
381 - 388.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
F. M. Smart, G. M. Edelman, and P. W. Vanderklish
BDNF induces translocation of initiation factor 4E to mRNA granules: Evidence for a role of synaptic microfilaments and integrins
PNAS,
November 25, 2003;
100(24):
14403 - 14408.
[Abstract]
[Full Text]
[PDF]
|
 |
|
|