The Journal of Neuroscience, August 6, 2003, 23(18):7227-7236
Previous Article | Next Article 
KCNQ/M Currents in Sensory Neurons: Significance for Pain Therapy
Gayle M. Passmore,1
Alexander A. Selyanko,1
Mohini Mistry,1
Mona Al-Qatari,1
Stephen J. Marsh,1
Elizabeth A. Matthews,1
Anthony H. Dickenson,1
Terry A. Brown,2
Stephen A. Burbidge,2
Martin Main,3 and
David A. Brown1
1Department of Pharmacology, University College
London, London WC1E 6BT, United Kingdom, 2Neurological
and Gastrointestinal Diseases Centre of Excellence for Drug Discovery,
GlaxoSmithKline, Harlow CM19 5AW, United Kingdom, and
3Systems Research, GlaxoSmithKline, Medicines Research
Centre, Stevenage SG1 2NY, United Kingdom
 |
Abstract
|
|---|
Neuronal hyperexcitability is a feature of epilepsy and both inflammatory
and neuropathic pain. M currents [IK(M)] play a key role
in regulating neuronal excitability, and mutations in neuronal KCNQ2/3
subunits, the molecular correlates of IK(M), have
previously been linked to benign familial neonatal epilepsy. Here, we
demonstrate that KCNQ/M channels are also present in nociceptive sensory
systems. IK(M) was identified, on the basis of biophysical
and pharmacological properties, in cultured neurons isolated from dorsal root
ganglia (DRGs) from 17-d-old rats. Currents were inhibited by the M-channel
blockers linopirdine (IC50, 2.1 µM) and XE991
(IC50, 0.26 µM) and enhanced by retigabine (10
µM). The expression of neuronal KCNQ subunits in DRG neurons was
confirmed using reverse transcription-PCR and single-cell PCR analysis and by
immunofluorescence. Retigabine, applied to the dorsal spinal cord, inhibited C
and A
fiber-mediated responses of dorsal horn neurons evoked by natural
or electrical afferent stimulation and the progressive "windup"
discharge with repetitive stimulation in normal rats and in rats subjected to
spinal nerve ligation. Retigabine also inhibited responses to intrapaw
application of carrageenan in a rat model of chronic pain; this was reversed
by XE991. It is suggested that IK(M) plays a key role in
controlling the excitability of nociceptors and may represent a novel
analgesic target.
Key words: M-current; dorsal root ganglion; neuropathic pain; retigabine; KCNQ; nociceptors
 |
Introduction
|
|---|
Pain can arise from tissue and nerve damage. The former is generally well
controlled, whereas neuropathic pain is not. Neuropathic pain, defined as
"pain initiated or caused by a primary lesion or dysfunction in the
nervous system" (Suzuki and
Dickenson, 2000
), is characterized by sensations such as deep
aching, increased sensitivity to noxious stimuli (hyperalgesia), and the
perception of pain in response to innocuous stimuli (allodynia). It is
conveyed from the periphery to the CNS by way of primary afferent neurons
known as nociceptors, which respond to noxious mechanical, thermal, and
chemical stimuli. Although growing numbers of pharmacological agents for the
treatment of neuropathic pain are readily available (several of which were
originally used as anticonvulsants), effective pain control without side
effects has yet to be fully achieved (for review, see
Hunt and Mantyh, 2001
;
Jensen et al., 2001
).
Furthermore, neuropathic pain can be refractory to analgesics such as morphine
(Suzuki et al., 2002
).
A feature of neuropathic pain is neuronal hyperexcitability. K+
channels play an essential role in setting the resting membrane potential and
in controlling the excitability of neurons. The opening of K+
channels leads to hyperpolarization of the cell membrane, which results in a
decrease in cell excitability. Thus, K+ channels represent
potentially attractive peripheral targets for the treatment of pain. Although
many studies have focused on the role of Na+ channels in pain, few
have considered the role of K+ channels (for review, see
McCleskey and Gold, 1999
;
Waxman et al., 1999
)
(Ishikawa et al., 1999
;
Boettger et al., 2002
).
One K+ channel that is known to regulate excitability in a
variety of central and peripheral neurons is the M channel (KM;
Brown, 1988
;
Marrion, 1997
). Thus,
mutations of its constituent KCNQ2 or KCNQ3 subunits
(Wang et al., 1998
) have been
genetically linked to a form of epilepsy known as benign familial neonatal
convulsions (Jentsch, 2000
),
whereas deletion of one KCNQ2 allele in mice enhances sensitivity to
epileptogenic agents (Watanabe et al.,
2000
), both manifestations of disordered excitability. The
presence of M currents [IK(M)] in sensory neurons has
previously been reported in bullfrog dorsal root ganglia
(Tokimasa and Akasu, 1990
) but
not hitherto in mammalian ganglia. However, the finding that the
anticonvulsant drug retigabine can alleviate some forms of chronic pain (A.
Rostock, C. Rundfeldt, and R. Bartsch, presentation to the Deutschen
Gesell-schaft für Pharmakologie und Toxikologie, 2000;
Blackburn-Munro and Jensen,
2003
) implies that M channels might regulate nociceptive sensory
neuron activity, because retigabine enhances the activity of KCNQ2/3 channels
(Main et al., 2000
;
Rundfeldt and Netzer, 2000
;
Wickenden et al., 2000
;
Tatulian et al., 2001
).
In this work, we have identified functional M channels and their
constituent molecular KCNQ subunits in sensory neurons from rat dorsal root
ganglia. We then show that retigabine enhances currents through these channels
and reduces both electrophysiological and behavioral manifestations of
enhanced nociceptive activity in experimental models of persistent pain. These
results imply that IK(M) plays a key role in regulating
excitability in nociceptors and may therefore present a novel therapeutic
target for the treatment of pain.
Parts of this manuscript have been published previously in abstract form
(Selyanko et al., 2001
).
 |
Materials and Methods
|
|---|
Cell culture
Dorsal root ganglion and superior cervical ganglion neurons.
Dorsal root ganglion (DRG, from all spinal levels) and superior cervical
ganglion (SCG) neurons were dissected from 17-d-old Sprague Dawley rats killed
by CO2 asphyxiation and prepared using a standard enzymatic
dissociation procedure as described elsewhere
(Owen et al., 1990
). Briefly,
after incubation in collagenase (500 U/ml for 15 min) and then trypsin (1
mg/ml for 30 min), the ganglia were mechanically triturated with a
fire-polished glass Pasteur pipette. The ganglia were then centrifuged and
resuspended in Leibovitz' L-15 supplemented with 10% fetal calf serum (FCS), 2
mM glutamine, 24 mM NaHCO3, 38 mM
glucose, 2-3% penicillin and streptomycin, and 25 ng/ml nerve growth factor.
For electrophysiological recording, dissociated neurons were plated on 35 mm
plastic dishes (Nunc, Roskilde, Denmark) coated with laminin and used either
1-2 (SCG) or 1-8 (DRG) d in culture. For immunofluorescence, dissociated DRG
neurons were plated onto laminin-coated glass coverslips contained within
four-well sterile tissue culture plates and used 1 d in culture.
Chinese hamster ovary cells. Chinese hamster ovary (CHO) cells
were cultured and transfected as described elsewhere
(Selyanko et al., 1999
).
Briefly, CHO cells were grown at 37°C and 5% CO2 in
-MEM
supplemented with 10% FCS, 1% L-glutamine, and 1% penicillin and
streptomycin. Cells were plated in 35 mm plastic dishes and transfected 1 d
later using LipofectAMINE Plus according to the manufacturer's instructions
(Invitrogen, San Diego, CA). KCNQ and CD8 cDNA plasmids, driven by the
cytomegalovirus promoter, were cotransfected in a 10:1 ratio. For expression
of heteromultimers, equal amounts of human KCNQ2 and rat KCNQ3 cDNAs were used
(obtained from Dr. D. McKinnon, State University of New York, Stony Brook,
NY), as described by Wang et al.
(1998
). Transfected cells were
identified by adding CD8-binding Dyna-beads (Dynal, Oslo, Norway) before
recording.
Perforated patch whole-cell recording
Solutions. The extracellular solution contained (in
mM): 144 NaCl, 2.5 KCl, 2 CaCl2, 0.5 MgCl2, 5
HEPES, and 10 glucose, pH adjusted to 7.4 with Tris base. Pipettes were filled
with an intracellular solution containing (in mM): 80 K acetate, 30
KCl, 40 HEPES, 3 MgCl2, 3 EGTA, and 1 CaCl2, pH adjusted
to 7.4 with NaOH. Amphotericin B was used to perforate the patch
(Rae et al., 1991
). Pipette
resistance was 2-3M
, and the series resistance was compensated
(60-90%). Recordings were made at room temperature (20-22°C).
Data acquisition and analysis. Data were acquired and analyzed
using pClamp software (version 8.0; Axon Instruments). Currents were recorded
using an Axopatch 200A (or 200B) patch-clamp amplifier, filtered at 1 kHz, and
digitized at 4-8 kHz. IK(M) amplitude and its inhibition
by K+ channel blockers were measured from deactivation relaxations
at -50 mV. Results are expressed as mean ± SEM. In general,
half-inhibitions were calculated using the Hill equation:
y/ymax = 1/(1 +
(x/x0)p), where y is the
fractional reduction of the relaxation amplitude; ymax is
the maximum reduction; x is the drug/blocker concentration;
x0 is the IC50 (the concentration at which
y/ymax = 0.5), and p is the power (equivalent to
the Hill slope). However, for tetraethylammonium (TEA) sensitivity, some of
the inhibition curves were best fit using a two-component equation:
y/ymax = q/(1 +
x/x0) + (1 - q)/(1 +
x/x1), where x0 and
x1 are the IC50 values for two channel
populations with proportional contributions of q and (1 -
q), respectively (other definitions are as above). The program Origin
(version 5.0; Microcal Software Inc.) was used for creating the figures.
PCR analyses
Reverse transcription-PCR. Sequence-specific oligonucleotide
primers were designed to the 3' coding and or noncoding regions of all
members of the KCNQ gene family. Alignments of rat, where available, or human
KCNQ cDNA sequences allowed the design of KCNQ subtype-specific primers. The
primer sequences were as follows: KCNQ1, forward, AGGATCGGAGGCCAGACCAT;
reverse, TCATATCAGGCCTTCAAGAG; KCNQ2, forward, AAGCTAGACTTCCTGGTGAG; reverse,
ACTGTATGTGCTAAGGAACC; KCNQ3, forward, AAGACAGGTTCACGACATGG; reverse,
CTAGAAGAGACTAACAGTGC; KCNQ4, forward, GCCGGATCAAGAGCCTGCAA; reverse,
CCAAGCAGCCTGAGACCAGCT; and KCNQ5, forward, CTGTCATTCGAGCTATCAGA; reverse,
GCTTGACTGTGCATAGTAGG.
Rat DRG total RNA was purified from whole DRG by homogenization in Trizol
reagent (Invitrogen, Paisley, UK) according to the manufacturer's
instructions. Rat total RNA samples from heart and skeletal muscle were
obtained from Clontech (Palo Alto, CA). Total RNA was reverse transcribed
using the Superscript kit (Invitrogen). KCNQ cDNA fragments were amplified
using the Advantage GC melt kit (Clontech, Basingstoke, UK). Amplified cDNA
fragments were cloned using the TOPO cloning kit (Invitrogen, Groningen, The
Netherlands) and sequenced to confirm their identity.
Single-cell PCR. Single-cell PCR analysis was performed as
previously described (Shah et al.,
2002
). Briefly, cultured neurons were collected into 7.5 µl of
recording solution and eluted into an Eppendorf tube containing 2.5 µl of
first-strand buffer [a 2 mM concentration of each DTP, 20
µM oligo-dT15, 40 mM dithiothreitol, and
20 U of RNase inhibitor (Roche Molecular Biochemicals, Indianapolis, IN)].
Reverse transcription (RT) of mRNA transcripts was initiated by addition of
100 U of Moloney murine leukemia virus reverse transcriptase RNase H(-) point
mutant (Promega, Madison, WI) followed by incubation at 37°C for 1 hr. A
multiplex PCR protocol was then used to amplify cDNA for KCNQ2-5
simultaneously. Primers were designed to be intron-spanning (on the basis of
human KCNQ genes) and have been described fully by Shah et al.
(2002
).
Immunofluorescence
DRG neurons cultured on glass coverslips were initially rinsed three times
for 5 min/rinse with PBS. Cells were fixed with freshly prepared 4%
paraformaldehyde for 30 min at room temperature and then quenched twice with
0.37% glycine and 0.27% ammonium chloride in PBS for 10 min. After several
rinses with PBS, the cells were permeabilized with 0.1% Triton X-100 in PBS
for 15 min and then incubated for 60 min in a blocking solution containing 2%
bovine serum albumin (BSA) plus 2% FCS in PBS. After three rinses with 1% BSA
in PBS, the cells were incubated overnight at 4°C with primary antibody
diluted in 1% BSA in PBS. The primary antibodies used were goat anti-KCNQ2
(1:100; Santa Cruz Biotechnology, Santa Cruz, CA), rabbit anti-KCNQ3 (1:100; a
gift from S. Burbidge, GlaxoSmithKline), goat anti-KCNQ3 (1:100; Santa Cruz
Biotechnology), and rabbit anti-KCNQ5 (1:500; a gift from A.Villaroel,
Instituto Cajal-Consejo Superior de Investigaciones Científicas,
Madrid, Spain).
Cells were rinsed six times for 5 min/rinse with 1% BSA in PBS and then
incubated with tetramethylrhadomine isothiocyanate- or FITC-coupled secondary
antibodies (1:1000; Molecular Probes, Eugene, OR) for 60 min. After six
additional washes with 1% BSA in PBS and a final wash with PBS alone, the
coverslips were mounted on ethanol-cleaned slides using a fluorescence
mounting medium (Dako, High Wycombe, UK) and visualized using a confocal
microscope. Images were obtained using either a 40 or 100x objective
with the sequential acquisition setting at 1024 x 1024 pixel resolution.
Control experiments in which the primary antibody was omitted or preincubated
with its relevant immunogenic peptide were performed to determine antibody
specificity.
In vivo spinal cord electrophysiology
Model of neuropathy. Male Sprague Dawley rats, initially weighing
130-150 gm, were used for in vivo electrophysiological studies. All
experimental procedures were approved by the Home Office and followed the
guidelines of the International Association for the Study of Pain
(Zimmerman, 1983
). The spinal
nerve ligation model of neuropathic pain was performed as first described by
Kim and Chung (1992
). Briefly,
under gaseous halothane anesthesia (3.5% for induction and 1.5% for
maintenance) in N2O and O2 (50:50), the L5 and L6 spinal
nerves were exposed as follows. The rat was placed in a prone position, and a
midline incision was made from L4 to S2. A little of the left paraspinal
muscles and left spinous process of the L5 lumbar vertebra were removed to
expose the L4 and L5 spinal nerves. L6 was identified lying just under the
sacrum. Using 6-0 silk thread, the left spinal nerves L5 and L6 were tightly
ligated in the section between their dorsal root ganglion and their
conjunction to form the sciatic nerve. Hemostasis was confirmed; the wound was
sutured; and the animal recovered from anesthesia.
Behavioral testing. For 2 weeks after surgery, the rats were
housed in groups of four in plastic cages under a 12 hr day/night cycle, and
their general health was monitored. Successful reproduction of the neuropathic
model was confirmed by behavioral testing (postoperative days 2, 3, 5, 7, 9,
12, and 14). Rats were placed in transparent plastic cubicles on a mesh floor,
and the sensitivities of both the ipsilateral and contralateral plantar
surfaces of the hindpaws to normally non-noxious punctate mechanical stimuli,
using von Frey filaments (bending forces, 1, 5, and 9 gm) were assessed as
described by Matthews and Dickenson
(2001
).
Neuronal characterization. Electrophysiology was performed 14-17 d
after surgery and on nonoperated naive rats of similar size
(Dickenson and Sullivan,
1986
). Briefly, anesthesia was induced with 3% halothane in
N2O and O2 (66:33); a cannula was inserted into the
trachea; and the rat was secured in a stereotaxic frame. A laminectomy was
performed (vertebrae L1-L3) to expose segments L4 and L5 of the spinal cord,
and the level of halothane was reduced to 1.8%. Extracellular recordings of
single convergent neurons, located deep within the dorsal horn (>500
µm), receiving input from the toe region ipsilateral to the spinal nerve
ligation (when performed), were made using a parylene-coated tungsten
electrode. Neurons selected responded to both noxious (pinch) and non-noxious
(touch) stimuli. Spikes evoked by natural stimuli applied constantly over 10
sec were quantified by the application of both punctate mechanical (von Frey
filaments, 9 and 75 gm) and thermal (constant water jet at 45°C) stimuli
applied to the center of the receptive field of the neuron. The thermal
response to 45°C was determined by subtracting the response to 32°C (a
non-noxious temperature to ascertain any mechanical response evoked by the
water jet) from the response to 45°C. All responses to natural stimuli
were normalized by the subtraction of any spontaneous activity measured before
the application of each stimulus. Response of the neuron to transcutaneous
electrical stimulation was established by insertion of two fine needles into
the center of its peripheral receptive field. A test consisted of a train of
16 stimuli (2-msec-wide pulse at 0.5 Hz at three times the threshold required
to evoke a C fiber response), and a poststimulus histogram was constructed.
Electrically evoked spikes were separated on a latency basis into A
fibers (0-20 msec), A
fibers (20-90 msec), C fibers (90-300 msec), and
postdischarge spikes (300-800 msec). The "input" represents the
number of spikes (90-800 msec) evoked by the first stimulus of the train.
"Excess spikes" are measures of "windup," which is
increased NMDA receptor-mediated neuronal excitability to repeated constant
stimulation (Dickenson, 1995
).
Excess spikes were calculated as the total spikes (90-800 msec) after a
16-stimulus train-input x 16. Windup graphs for individual neurons show
how the combined number of evoked C fiber and postdischarge action potentials
(i.e., 90-800 msec) increase with each repeated electrical stimulation.
Pharmacological studies. The testing protocol, initiated every 10
min, consisted of an electrical test followed by the natural stimuli, as
described. Stabilization of the neuronal responses was confirmed with at least
three consistent predrug responses (<10% variation), for all measures.
These values were then averaged to generate predrug control values with which
to compare the effect of retigabine administration on subsequent evoked
responses. Retigabine was dissolved in saline and applied directly onto the
spinal cord in 50 µl volumes. Each dose (10, 30, 60, and 90 µg) was
followed until maximum effects were exerted (a minimum of 60 min), when the
next dose would be applied cumulatively. The results were calculated as
maximum percentage of inhibition from the averaged predrug value for each
neuron, and the overall results for each dose were expressed as mean ±
SEM of the normalized data. Statistical analysis of maximal drug effects at
each dose compared with the averaged predrug value was determined by paired
t test on raw data. An unpaired t test on the normalized
data was used for the comparison of drug effects between different
experimental groups. The level of significance was taken as p <
0.05.
Animal model of nociceptive and inflammatory hypersensitivity
The methods for induction and assessment of carrageenan-induced
hyperalgesia have been described previously
(Clayton et al., 2002
).
Induction of carrageenan-induced hyperalgesia. Briefly, male
random-bred hooded rats were injected intraplantar into the left hind paw with
100 µl of 2% carrageenan. To assess the analgesic effect of retigabine and
its antagonism by XE991, animals were dosed orally at 5 mg/kg with a
combination of vehicle plus vehicle, vehicle plus retigabine, vehicle plus
XE991, or retigabine plus XE991 2 hr after the carrageenan dose and 1 hr
before assessment of hyperalgesia.
Behavioral assessment of hyperalgesia. In normal rats, body weight
is distributed equally between the two hindpaws. However, body weight is
redistributed when one hindpaw is inflamed or painful so that less weight is
placed on the affected paw. Thus, redistribution of body weight after
induction of inflammation may be used to assess the development of
hyperalgesia. Weight bearing was examined using a dual-channel weight averager
(Bioengineering; GlaxoSmithKline). The two hindpaws were placed on separate
sensors, and the percentage of weight distribution was calculated over 7 sec
(Clayton et al., 1997
).
Data analysis. All data are expressed as mean ± SEM. In all
experiments, there were seven animals per group. Statistical analysis was
performed to compare control responses with test responses using ANOVA
followed by a post hoc Kruskal-Wallis test on raw data. The level of
significance was taken as p < 0.05.
Drugs and chemicals
Retigabine and XE991 (10, 10-bis
(4-pyridinyl-methyl)-9(10H)anthracenone) were gifts from GlaxoSmithKline
(Stevenage, UK) and DuPont (Wilmington, DE), respectively. Linopirdine was
purchased from Research Biochemicals (Natick, MA, USA). Margatoxin (MgTX) was
obtained from Peptide Institute. TEA was purchased from Lancaster Synthesis
(Morecambe, UK). WAY-123,398 ([(4-methylsulfonyl) amido]benzene-sulfonamide)
was a gift from Wyeth-Ayerst Research (Princeton, NJ). Nerve growth factor was
purchased from Tocris (Bristol, UK). All other drugs and chemicals were
obtained from Invitrogen, Sigma (Gillingham, UK), or BDH (Poole, UK).
 |
Results
|
|---|
Identification of the M current
The IK(M) was identified by using a standard
deactivation voltage protocol, in which the cell is held at a steady
depolarized potential to activate the current and then deactivated by
intermittent hyperpolarizing steps (Fig.
1A); the contribution of IK(M) to the
outward current is then diagnosed from the slow deactivation tail current
(Fig. 1B)
(Brown and Adams, 1980
). The
reason for using this protocol is that, because the M current does not
inactivate, contamination by other voltage-gated currents is minimized.

View larger version (22K):
[in this window]
[in a new window]
|
Figure 1. M currents are expressed in both small and large DRG neurons. A,
Standard deactivation protocol for recording IK(M).
B, Representative current recorded from a small (17.3 pF) DRG neuron.
C, Mean instantaneous (open circles) and leak-subtracted steady-state
(filled circles) I-V relationships for IK(M)
recorded from small DRG neurons (n = 17; capacitance, 19.4 ±
1.2pF), obtained by measuring the current at the beginning and end of the
voltage pulse, respectively. Leak subtraction was performed by extrapolation
of the linear portion of the I-V curve negative to -70 mV.
D, Semilogarithmic plot of the voltage dependence of the fast (filled
circles) and slow (open squares) deactivation time constants ( ) of
IK(M) recorded from small DRG neurons (n = 9;
capacitance, 19.0 ± 1.2 pF). E, F, Representative current
recorded from a large (>100 pF) DRG neuron before (E) and after
(F) block of IIns and Ih with
100 nM -DaTX and 1 mM Cs+,
respectively. Note the gain increase in F. G, Voltage protocol used
for recording IK(M) in the absence and presence of various
concentrations of K+ channel blockers and M channel blockers and
activators. H, I, Enhancement (H) and inhibition
(I) of IK(M) recorded from a large DRG neuron
with 10 µM retigabine and 0.03-10 µM XE991,
respectively.
|
|
An M current so defined was identified in each of 30 small neurons tested
(capacitance, 20.4 ± 1.1 pF; range, 11.5-34 pF). Of 22 cells so tested,
16 also responded to 1 µM capsaicin with an inward current (204
± 97 pA at -50 mV) and an increase in conductance (data not shown),
whereas the remaining 6 of 22 cells showed no response. Capsaicin-sensitive
and -inse-nsitive cells had the same size (mean capacitance, 19.9 ± 1.4
and 17.3 ± 3.3 pF, respectively; p > 0.05). The small size
of cells expressing IK(M) and their sensitivity to
capsaicin suggest that they were probably nociceptors.
The I-V relationship for IK(M), computed from
the initial amplitude of the deactivation tail currents
(Adams et al., 1982
), showed a
negative threshold of activation (-60 mV), close to the resting membrane
potential, and a reversal potential for its tail of approximately -80 mV,
close to EK (Fig.
1C). Deactivation of IK(M) was
best-fitted by two exponentials, with the time constants,
fast
and
slow, equal to 76.4 ± 9.9 and 583 ± 134
msec, respectively, at -50 mV (n = 9). These time constants were very
close to
fast and
slow for
IK(M) in rat sympathetic neurons and those for the KCNQ2
plus KCNQ3 current (IKCNQ2+KCNQ3) in transfected CHO cells
(Table 1). Deactivation showed
the characteristic acceleration with increasing hyperpolarization; both
fast and
slow shortened, with
fast falling e-fold for a 52.6 mV hyperpolarization
(Fig. 1D).
I(K)M was also detected in 9 of 10 large cells tested
(capacitance, >100 pF). However, in contrast to small cells,
IK(M) was not clearly visible in the initial macroscopic
current recordings because it was masked by the presence of a large
"instantaneous" outward current (IIns) and a
slow hyperpolarization-activated inward current (Ih),
which were activated positive and negative to Vrest, respectively
(Fig. 1E).
Nevertheless, the presence of I(K)M became apparent after
inhibition of IIns and Ih with 100
nM
-dendrotoxin (
-DaTX) or 1-50 nM MgTX
and 1 mM Cs+, respectively
(Fig. 1F, note the
increased gain). Confirmation of this current as I(K)M was
achieved using retigabine (10 µM;
Fig. 1H) and XE991
(0.03-10 µM; Fig.
1I), which, as anticipated, activated and blocked the
current, respectively (see below).
K+ channel pharmacology
Linopirdine has previously been demonstrated to be a potent inhibitor of
the M current in hippocampal and rat sympathetic neurons
(Aiken et al., 1995
;
Lamas et al., 1997
).
IK(M) in DRG neurons showed a high sensitivity to
linopirdine (Fig.
2B,C;IC50, 2.1 ± 0.2 µM;
n = 8) and to its analog XE991
(Fig.
2C;IC50, 0.26 ± 0.01 µM;
n = 6) (Wang et al.,
1998
), as well as to Ba2+ (data not shown;
IC50, 0.3 ± 0.04 mM; n = 4). One to 40
µM MgTX and
DaTX (blockers of slowly inactivating
Kv1.1, 1.2, and 1.3 and 1.1, 1.2, and 1.6 channels, respectively;
Kaczorowski and Garcia, 1999
),
1 mM 4-AP, or 10 µM WAY-123,398 (a blocker of
ether-a-go-go-related gene potassium channels, which are capable of
generating M-like currents; Selyanko et
al., 1999
) had no effect. Thus, IK(M) in DRG
neurons closely resembled that in sympathetic neurons and also the currents
generated by its presumed KCNQ2 and KCNQ3 genes when coexpressed in
Xenopus oocytes or mammalian cell lines
(Table 2).

View larger version (25K):
[in this window]
[in a new window]
|
Figure 2. Pharmacology of IK(M) in small DRG neurons. A,
Voltage protocol used for recording IK(M) in the absence
and presence of various concentrations of K+ channel blockers and M
channel blockers and activators. B, D, F, IK(M) recorded
in response to various concentrations of linopirdine (B), TEA
(D), and retigabine (F). C, concentration
dependence of inhibition of IK(M) by linopirdine (closed
circles) and XE991 (open circles). E, Concentration dependence of
inhibition of IK(M) by TEA in individual DRG neurons.
G, Steady-state I-V relationship under control conditions
(filled circles) and in the presence of 10 µM retigabine (open
circles).
|
|
View this table:
[in this window]
[in a new window]
|
Table 2. Effects of K+ channel blockers on IK(M)
in DRG and SCG neurons and IKCNQ2+KCNQ3 in mammalian cells
or frog oocytes
| |
TEA sensitivity
KCNQ2-5 subunits vary in their sensitivity to TEA
(Yang et al., 1998
;
Wang et al., 1998
;
Kubisch et al., 1999
;
Hadley et al., 2000
;
Lerche et al., 2000
;
Schroeder et al., 2000
), with
KCNQ2 having the highest affinity arising from the presence of a tyrosine just
downstream of the GYG pore sequence
(Hadley et al., 2000
). When
measured in individual DRG neurons, the TEA sensitivity was variable
(Fig. 2D,E),
indicating different proportions of TEA-sensitive and -insensitive subunits.
Thus, in some cells (two of seven), the TEA sensitivity was very high
(IC50,
0.2-0.6 mM), suggesting expression of KCNQ2
subunits only, whereas in other cells (three of seven), the TEA sensitivity
was intermediate and similar to that expected for KCNQ2/3 heteromers
(IC50,
3.9-4.7 mM). Two of seven cells displayed
biphasic inhibition by TEA, and a two-component Hill equation gave an improved
fit (lower IC50 values, 0.26 and 0.41 mM, upper
IC50 values, 8.55 and 3.28 mM), suggesting expression of
a mixture of homomeric and heteromeric subunits.
Activation by retigabine
In seven of seven cells tested, the neuronal KCNQ channel opener retigabine
(see Introduction) enhanced IK(M)
(Fig. 2F) and produced
a characteristic slowing of its deactivation, consistent with the negative
shift in activation of neuronal KCNQ channels
(Main et al., 2000
;
Rundfeldt and Netzer, 2000
;
Wickenden et al., 2000
;
Tatulian et al., 2001
). The
effect of retigabine was concentration- and voltage-dependent, being stronger
at -20 than at -50 mV. Steady-state I-V relationships constructed in
the presence and absence of retigabine showed that this outward current was
reduced by membrane hyperpolarization and dissipated at approximately -80 mV,
close to EK (e.g., see
Fig. 2G). This was
accompanied by a negative shift (by 12.3 ± 3.3 mV) in zero current
(resting) potential.
M current modulation and cell excitability
M current can act as a brake on repetitive firing in neurons
(Brown, 1988
). Thus, M channel
blockers enhance repetitive firing in sympathetic
(Wang et al., 1998
) and
hippocampal (Aiken et al.,
1995
) neurons. We therefore tested what effect linopirdine and
retigabine might have on the firing properties of small DRG neurons during
long (1 sec) depolarizing current pulses. The resting potential was close to
-55 mV and was maintained at this level, if necessary, by injecting DC
current. The cells were highly refractory and fired only once in response to
currents of 150-200 pA or more (Fig.
3A). In five of five neurons, the inhibition of the M
current by 30 µM linopirdine reduced the threshold of firing,
and in two of them, it produced a brief burst of multiple firing
(Fig. 3B).

View larger version (22K):
[in this window]
[in a new window]
|
Figure 3. Modulation of excitability in small DRG neurons by inhibiting
IK(M) with linopirdine and by activating
IK(M) with retigabine. A, Single firing was
produced by a 400 pA depolarizing current pulse in the control, whereas two or
three spikes were produced in response to the same current injection in the
presence of 30 µM linopirdine (B). C, Under
control conditions, electrotonic potentials and a single action potential
(top) were produced by hyperpolarizing and depolarizing current pulses
(bottom), respectively. D, Ten micromolar retigabine hyperpolarized
the membrane by 12 mV and abolished the spike. E, A depolarizing
current injection restores the membrane potential to the initial value in
presence of 10 µM retigabine. The action potential remains
absent and reduced voltage responses are produced, owing to an enhanced
membrane conductance. F, The effects of retigabine on spike
initiation and membrane conductance were reversed by 10 µM
linopirdine. The data in panels A and B and C-F
were obtained from two different cells.
|
|
In contrast, retigabine (10 µM) hyperpolarized the membrane
and increased the threshold of firing (Fig.
3D). When the membrane potential was restored to the
initial level by injecting the depolarizing DC current, the voltage changes
associated with current pulses were much smaller than in the control, implying
an increase in membrane conductance (Fig.
3E). The increase in conductance and inhibition of firing
produced by retigabine could then be reversed by adding 10 µM
linopirdine (Fig. 3F).
Similar effects of retigabine were obtained from five other cells; in two of
two cells tested, the effect of retigabine was reversed by 10 µM
XE991.
Expression of KCNQ subtypes in DRG neurons
RT-PCR and single-cell PCR analyses were used to determine the expression
of the family of KCNQ genes in rat DRG. KCNQ2-5 but not KCNQ1 were expressed
at detectable levels in whole rat DRG (Fig.
4A). Several controls to support our observations are
included. First, no amplified bands were detected in the absence of reverse
transcriptase (second lane), thus confirming that the amplified bands were of
cDNA and not genomic origins. Second, each of the amplified fragments was
cloned and sequenced to confirm its identity. Thirdly, either brain (third
lane) or heart tissue (fifth lane) was used as a positive control, allowing
confirmation of a negative signal in the DRG. These results confirm that all
of the potential molecular correlates of IK(M) are
expressed in the DRG. A low level of KCNQ1 expression in the brain was also
detected, as previously reported (Kubisch
et al., 1999
). Interestingly, KCNQ4 and low levels of KCNQ5
expression were also detected in the heart
(Fig. 4A, fifth lane).
In the case of KCNQ4, this confirms previous data from Northern analysis (S.
A. Burbidge, D. Crowther, and P. Sanseau, personal communication).

View larger version (48K):
[in this window]
[in a new window]
|
Figure 4. KCNQ subunit mRNA expression in rat dorsal root ganglion neurons.
A, Reverse transcription-PCR analysis of RNA isolated from adult rat
DRG using primer pairs for KCNQ subunits 2-5. B, Single cell PCR
analyses on cultured rat DRG small and large neurons using primer pairs for
KCNQ subunits 2-5. Arrows point to KCNQ subunit-specific PCR products. Control
reactions were performed using primer pairs on plasmid constructs containing
the coding sequence for each of the KCNQ subunits 2-5. PCR products were
separated by electrophoresis through 2% Metaphor agarose (FMC Bioproducts,
Rockland, MD) and a 1 kb plus DNA ladder (Invitrogen).
|
|
Single-cell PCR was used to determine the KCNQ subunit expression in
individual small and large neurons when cultured as for the
electrophysiological experiments (Fig.
4B). PCR products of the predicted size from cDNA were
obtained for KCNQ2, KCNQ3, and KCNQ5 from both small and large DRG neurons
(n = 12). Neurons isolated from both acutely dissociated cultures and
3 d primary cultures gave identical results. KCNQ4 mRNA was not detected in
either small or large DRG neurons, indicating that its expression in whole
ganglia (Fig. 4A)
refers to other cell types within the ganglia. Control reactions performed in
parallel using plasmid DNA containing the coding sequence for KCNQ2-5 gave
specific PCR products for each primer pair. Contamination by genomic DNA can
be excluded because the primer pairs were intron spanning and because longer
PCR products were not evident in the single cell PCRs.
Immunofluorescence results
Confocal immunofluorescence microscopy of cultured DRG neurons revealed
variable expression of KCNQ2, 3 and 5 immunoreactivity on the somata and
neuronal processes of both small and large neurons
(Fig. 5). Thus, although some
cells expressed both KCNQ2 and KCNQ3, others expressed KCNQ2 in the absence of
KCNQ3 (Fig. 5C).
Likewise, although some cells expressed both KCNQ3 and KCNQ5, others expressed
KCNQ3 in the absence of KCNQ5 (Fig.
5I). Colocalization of KCNQ2 and KCNQ5
(Fig. 5F) was also
detected, although it is likely that such cells also express KCNQ3 because
KCNQ2 and KCNQ5 do not form heteromeric channels
(Lerche et al., 2000
;
Schroeder et al., 2000
).
Costaining for KCNQ2, 3, and 5 subunits could not be performed because of
species limitations of the secondary antibodies.

View larger version (131K):
[in this window]
[in a new window]
|
Figure 5. Immunocytochemistry with antibodies to KCNQ2, KCNQ3, and KCNQ5 reveals
variable expression of KCNQ subunits in small and large DRG neurons. Confocal
images of KCNQ2, KCNQ3, and KCNQ5 immunostaining in cultured DRG neurons are
shown. A, B, D, E, G, H, Immunostaining images for individual
antibodies. C, F, I, Overlays of immunostaining for KCNQ2 and KCNQ3
(C), KCNQ2 and KCNQ5 (F), and KCNQ3 and KCNQ5 (I).
Scale bar, 25 µm.
|
|
In vivo spinal cord electrophysiology and pharmacology in a
model of neuropathy
Rats subjected to spinal nerve ligation (see Materials and Methods)
exhibited abnormal foot posture ipsilateral to nerve injury, whereby toes were
held together in a "guarding" behavior. Successful replication of
the nerve injury model was confirmed by the development of mechanical
allodynia in the injured hindpaw, displayed as a brisk withdrawal, in some
cases accompanied by shaking and licking of the foot, to normally innocuous
von Frey filaments (1, 5, and 9 gm bending forces). Increased frequency of
foot withdrawal was observed with increased bending force. Mechanical
allodynia was evident at postoperative day 2, reached a maximum at days 7-12,
and was still present at day 14 (Matthews
and Dickenson, 2001
). Consistent withdrawal responses were never
exhibited by the contralateral hindpaw.
Recordings were obtained from ipsilateral dorsal horn neurons in 10 animals
after spinal nerve ligation and in 11 naive animals. No significant
differences were found between the two experimental groups in the mean values
of recorded neuron depth and the responses evoked by electrical and natural
stimulation. However, neurons of spinal nerve-ligated animals showed
appreciable ongoing spontaneous activity (mean rate, 2.75 ± 1.09 Hz),
whereas no such activity was observed in naive animals; this difference was
significant (p < 0.02).
Application of retigabine (10-90 µg) produced statistically significant
dose-related inhibitions of both the electrically and naturally evoked
neuronal responses from the determined predrug control values in both
experimental groups (Fig. 6;
p < 0.05; n = 5-10). Clear effects were seen at
60
min after application of the drug (Fig.
6I). In naive and nerve-injured rats, the A
fiber
response was least affected by spinal retigabine, with mean maximal
inhibitions from predrug control values at the top dose only reaching 23
± 3 and 33 ± 8%, respectively
(Fig. 6C). The other
electrically evoked neuronal responses were more susceptible to the inhibitory
actions of retigabine. Thus, in nerve-injured animals, the C fiber, A
fiber, and input responses reached similar mean maximal observed inhibitions
in the range of 61 ± 4 to 73 ± 9%
(Fig. 6A,B,
respectively). Greater inhibitory effects of the high dose of retigabine were
observed on the postdischarge and excess spike measurements
(Fig. 6D,E,
respectively), such that, at 90 µg, retigabine maximally inhibited both
measures in ligated animals by 81 ± 5%, whereas in naive rats, the
effect was 69 ± 11 and 65 ± 7% from predrug control values for
postdischarge and excess spikes, respectively. This is further emphasized by
the examples in Figure 6, G and
H, in which windup (the increase in the number of spikes
per stimulus over the train of electrical impulses, which generates the
postdischarge and excess spikes; Dickenson,
1995
) is clearly reduced more after nerve injury, as shown by the
flattening of the windup slope. Overall, there was no difference in the
predrug values of these measures of neuronal excitability for the naive and
nerve-injured groups.

View larger version (40K):
[in this window]
[in a new window]
|
Figure 6. Effect of retigabine on electrically evoked dorsal horn responses.
A-F, Effect of spinally applied retigabine on the electrically evoked
dorsal horn neuronal responses recorded from naive (open squares; n =
5-10) and spinal nerve-ligated (filled circles; n = 5-8) rats at
postoperative days 14-17. Data are expressed as maximal mean percent
inhibition of the predrug values ± SEM. A, C fiber responses;
B, A fiber responses; C, A fiber responses;
D, after discharge; E, excess spikes; F, input.
G, H, Inhibitory effect of spinally applied retigabine (open circle,
control; filled triangle, 10 µg of retigabine; open square, 30 µg of
retigabine; filled circle, 90 µg of retigabine) on individual neurons
exhibiting windup recorded from naive (G) and spinal nerve-ligated
(H) rats. I, Time course of the effect of increasing doses
of spinally applied retigabine on the evoked response of a typical dorsal horn
neuron recorded from a spinal nerve-ligated rat. Examples of the effect on the
A fiber (filled triangle), C fiber (open circle), and postdischarge
(filled circle) measurements are shown with the cumulative dose indicated, and
the data are expressed as percent of the predrug control value.
|
|
Retigabine (90 µg) also inhibited the naturally evoked neuronal
responses to innocuous (von Frey, 9 gm) and noxious (von Frey, 75 gm) punctate
mechanical stimuli and noxious heat (45°C) in both experimental groups by
amounts within the range of 65 ± 13 to 87 ± 5% from the predrug
control (data not shown).
Analgesic properties of retigabine
To assess the analgesic effect of retigabine, we used a model for chronic
pain in which the irritant carrageenan is injected into one hindpaw. This
leads the animal to distribute its weight unevenly between the two legs. Thus,
3 hr after intraplantar administration of carrageenan (2%, 100 µl), there
was a substantial and significant decrease in the weight bearing on the left
hindpaw, such that animals distributed only 21 ± 3% of their hind leg
load onto the inflamed paw (Fig.
7), compared with the normal 50% after injection of vehicle alone.
Retigabine [5 mg/kg, orally (p.o.)] strongly reduced this asymmetry, so that
the weight borne on the inflamed leg increased to 41 ± 2%. This effect
was antagonized by coadministration of XE991 (5 mg/kg, p.o.), resulting in a
weight distribution (28 ± 3%) similar to that in animals treated with
vehicle alone. Interestingly, XE991 itself had no effect on weight
distribution.

View larger version (34K):
[in this window]
[in a new window]
|
Figure 7. Analgesic activity of retigabine and block by XE991: effect of M channel
activators and blockers on weight bearing in a behavioral model of
inflammatory pain. Retigabine (5 mg/kg, p.o.), administered 2 hr after
intraplantar carrageenan, significantly increased the weight placed on the
inflamed paw. Coadministration of XE991 (5 mg/kg, p.o.) reversed the analgesic
effects of retigabine, whereas treatment with XE991 (5 mg/kg, p.o.) alone had
no effect on weight distribution. Bars indicate mean ± SEM of seven
animals in each case. **p < 0.05.
|
|
 |
Discussion
|
|---|
In this work we have established that the sensory neurons of rat dorsal
root ganglia express the KCNQ molecular substrates of neural M channels and
possess identifiable M currents. We have also shown that these play a
significant role in regulating the excitability of small-diameter,
predominantly nociceptive neurons. As a result, the enhancement of the M
current by retigabine strongly and selectively reduces responses of
nociceptive neurons in the dorsal horn, an effect that is maintained after
nerve injury, and exerts an analgesic action in an animal model of
inflammatory pain.
Biophysically and pharmacologically, the M current that we have identified
in these sensory neurons closely matched that previously reported in rat
sympathetic neurons (Tables 1,
2)
(Lamas et al., 1997
;
Wang et al., 1998
;
Selyanko et al., 1999
;
Pan et al., 2001
). It also
showed a good match against currents generated on coexpressing KCNQ2 and KCNQ3
cDNAs, the proposed molecular subunits of the native ganglionic M channel
(Wang et al., 1998
) (cf.
Hadley et al., 2000
;
Pan et al., 2001
). In fact,
individual DRG neurons variably expressed three subunits from this family
(KCNQ2, 3, and 5), as judged from single-cell PCR and immunocytochemical
observations, and some neurons, at least, contained mRNA for all three. This
is probably true for subunit protein expression as well, to judge from the
high frequency with which cells expressed immunoreactivity for each of the
subunits. Karchewski et al.
(2001
) have also briefly
reported the presence of KCNQ mRNA and protein in rat DRG neurons, with some
differential subunit expression in different subpopulations.
Expression studies indicate that KCNQ2 and KCNQ3 subunits are more
efficiently translated into functional membrane channels as heteromultimers
than as homomultimers (Schwake et al.,
2000
; Selyanko et al.,
2000
), and the same is probably true for KCNQ3/5 heteromultimers
(Schroeder et al., 2000
). On
the other hand, the immunocytochemistry also suggested that a proportion of
neurons expressed KCNQ2 protein in the absence of KCNQ3 and hence might well
carry currents through homomeric KCNQ2 channels. Support for this is provided
by the high sensitivity to TEA of M currents recorded in a proportion of
cells, in which the IC50 values (0.2-0.6 mM)
approximated those obtained against homomeric KCNQ2 currents (between 0.1 and
0.4 mM; Wang et al.,
1998
; Hadley et al.,
2000
; Shapiro et al.,
2000
; Wickenden et al.,
2000
); other cells yielded IC50 values
10 times
greater and more in accord with the expression of KCNQ2/3 heteromultimers. A
rather similar situation has been noted in sympathetic neurons isolated from
rats of this (17 d) age, in which a proportion of the current was sufficiently
sensitive to TEA to suggest that it was carried by homomeric KCNQ2 channels
(Hadley et al., 2003
). In
contrast, blocking of sympathetic neuron currents in postnatal day 45 rats by
TEA more closely accorded with a uniform population of heteromeric KCNQ2/3
channels. This was attributed to the incremental expression of KCNQ3 during
postnatal development (Tinel et al.,
1998
; Hadley et al.,
2003
).
Many cells also expressed both KCNQ5 mRNA and KCNQ5 protein, and KCNQ3 and
KCNQ5 were clearly colocalized in some cells. KCNQ5 (like KCNQ3) is very
insensitive to TEA (IC50,
71 mM;
Schroeder et al., 2000
), so a
contribution of currents through KCNQ3/5 channels should be revealed as a
component of current that is not inhibited by 10-30 mM TEA (as in
some hippocampal pyramidal cells; Shah et
al., 2002
). In practice, between 80 and 100% of the M current in
small sensory neurons was inhibited at 30 mM TEA, suggesting that
KCNQ3/5 channels contribute very little to the macroscopic somatic current.
Again, this resembles the situation in sympathetic neurons, which also express
all three subunits (KCNQ2, 3, and 5;
Hadley et al., 2003
). The
reason for the unexpectedly small contribution of KCNQ5 or KCNQ3/5 channels to
the somatic currents is not yet clear.
Because the majority of small neurons that exhibited macroscopic M currents
were also activated by capsaicin, M currents were clearly strongly expressed
in nociceptive neurons. However, they were by no means exclusive to VR1
heat-sensitive nociceptive neurons; some small cells with M currents did not
respond to capsaicin, and KCNQ subunits were clearly expressed in both small
and large (non-nociceptive) neurons. However, in the latter cells, M currents
contributed only a minor component to the subthreshold currents, which were
dominated by a larger dendrotoxin-sensitive K+ current and by the
hyperpolarization-activated Ih current. In such cells, the
dendrotoxin-sensitive current is likely to play the major role in determining
excitability and firing behavior
(Stansfeld et al., 1986
), with
the M current playing (at most) a subsidiary role. In contrast, but as in
sympathetic neurons, the M current is the dominant subthreshold current in
small sensory neurons and, as a consequence, exerts a significant effect on
their excitability. Thus, inhibition of IK(M) with
linopirdine or XE991 reduced the threshold for spike generation and favored
the generation of repetitive bursts of action potentials during sustained
depolarization. On the other hand, enhancement of IK(M)
increased resting input conductance, hyperpolarized the neurons, and prevented
spike generation. The increased resting conductance and hyperpolarization
results from a hyper-polarizing shift of the M current I-V curve,
such that IK(M) becomes strongly activated at
Vrest (see Tatulian et al.,
2001
).
Matching changes in the transmission of sensory information on application
of retigabine were obtained on recording from spinal dorsal horn neurons. In
agreement with the observations on sensory neuron somata, nociceptive C
fiber-evoked responses were more susceptible than A
fiber responses.
Furthermore, retigabine exerted a strong depressant effect on the delayed
sensitization of dorsal horn neurons reflected in the recordings of windup.
These effects might be explained most plausibly by the idea that the KCNQ/M
channels identified in sensory neuron somata are also expressed on nociceptive
afferent terminals, such that the enhanced M current shunts the invading
action potentials and thereby reduces evoked transmitter release. There is, as
yet, no direct evidence for this, but the immunofluorescence of cultured
neurons indicated that KCNQ subunits are transported along neuronal
processes.
Retigabine reduced C and A
fiber and windup responses as well as
natural mechanical and thermal responses likely to correspond to A
and
C fiber-evoked activity. The natural responses could relate to the allodynia
and hyperalgesia seen after neuropathy. Overall, retigabine was as effective
in reducing nociceptive dorsal horn responses after spinal nerve ligation as
in the naive animals, suggesting that higher doses may be more effective. One
possible explanation for this is that the density of KCNQ subunits might be
enhanced after nerve injury. In partial agreement with this hypothesis, some
preliminary evidence for an upregulation of KCNQ2/3 subunit proteins in L4/5
dorsal root ganglia 6-8 d after afferent nerve lesion has recently been
reported (Wickenden et al.,
2002
). The maintained inhibitory effect of the drug after nerve
injury deserves comment. The issue is that neuropathic pain is often
refractory to conventional analgesics; for example, morphine is not as
effective after nerve injury (Suzuki et
al., 2002
). Thus it is very important to note that the effects of
retigabine are preserved, making these channels an attractive target for the
treatment of nerve injury pain.
Finally, retigabine effectively and substantially reduced the behavioral
manifestation of nociceptive activity in a model of inflammatory pain. This
can unequivocally be attributed to M current enhancement because it was
prevented by coadministration of the M channel blocker XE991. This accords
with the recent observations of Blackburn-Munro and Jensen
(2003
) and suggests that
enhancement of KCNQ/M channel activity might provide a novel approach to the
treatment of neuropathic and other pain states.
 |
Footnotes
|
|---|
Received Feb. 24, 2003;
revised Jun. 2, 2003;
accepted Jun. 6, 2003.
The work was supported by United Kingdom Medical Research Council Grant PG
7909913, Wellcome Trust Grant 038170, and European Union Grant
QL-G3-CT-1999-00827. We thank Dr. D McKinnon (State University of New York,
Stony Brook, NY) for the KCNQ2 and KCNQ3 cDNAs and Dr. A. Villarroel and Dr.
E. Yus. Nájera (Instituto Cajal-Consejo Superior de Investigaciones
Científicas, Madrid, Spain) for the KCNQ5 antibody. This manuscript is
dedicated to Dr. Alexander Selyanko, who started this piece of research but
died before its completion.
Correspondence should be addressed to Prof. David. A. Brown, Department of
Pharmacology, University College London, Gower Street, London WC1E 6BT, UK.
E-mail:
d.a.brown{at}ucl.ac.uk.
Copyright © 2003 Society for Neuroscience
0270-6474/03/237227-10$15.00/0
Deceased September 23, 2001. 
 |
References
|
|---|
Adams PR, Brown DA, Constanti A (1982) M-currents and
other potassium currents in bullfrog sympathetic neurones. J Physiol
(Lond) 330:
537-572.[Abstract/Free Full Text]
Aiken SP, Lampe BJ, Murphy PA, Brown BS (1995)
Reduction of spike frequency adaptation and blockade of M-current in rat CA1
pyramidal neurones by linopirdine (Du 996), a neurotransmitter release
enhancer. Br J Pharmacol 115:
1163-1168.[Web of Science][Medline]
Blackburn-Munro G, Jensen BS (2003) The anticonvulsant
retigabine attenuates nociceptive behaviours in rat models of persistent and
neuropathic pain. Eur J Pharmacol 460:
109-116.[Web of Science][Medline]
Boettger MK, Till S, Chen MX, Anand U, Otto WR, Plumpton C, Trezise
DJ, Tate SJ, Bountra C, Coward K, Birch R, Anand P (2002)
Calcium-activated potassium channel SK1- and IK1-like immunoreactivity in
injured human sensory neurones and its regulation by neurotrophic factors.
Brain 125:
252-263.[Abstract/Free Full Text]
Brown DA (1988) M-currents. In: Ion
channels, Vol 1 (Narahashi T, ed), pp
55-94. New York: Plenum.[Medline]
Brown DA, Adams PR (1980) Muscarinic suppression of a
novel voltage-sensitive K+ current in a vertebrate neurone.
Nature 283:
673-676.[Medline]
Clayton NM, Oakley I, Thompson S, Wheeldon A, Sargent B, Bountra C
(1997) Validation of the dual channel weight averager as an
instrument for the measurement of inflammatory pain. Br J
Pharmacol 120:
219P.
Clayton N, Marshall FH, Bountra C, O'Shaughnessy CT
(2002) CB1 and CB2 cannabinoid receptors are implicated in
inflammatory pain. Pain 96:
253-260.[Web of Science][Medline]
Dickenson AH (1995) Spinal cord pharmacology of pain.
Br J Anaesth 75:
193-200.[Free Full Text]
Dickenson AH, Sullivan AF (1986) Electrophysiological
studies on the effects of intrathecal morphine on nociceptive neurones in the
rat dorsal horn. Pain 24:
211-222.[Web of Science][Medline]
Hadley JK, Noda M, Selyanko AA, Wood IC, Abogadie FC, Brown DA
(2000) Differential tetraethylammonium sensitivity of KCNQ1-4
potassium channels. Br J Pharmacol 129:
413-415.[Web of Science][Medline]
Hadley JK, Passmore GM, Tatulian L, Al-Qatari M, Ye F, Wickenden
AD, Brown DA (2003) Stoichiometry of expressed KCNQ2/KCNQ3
channels and subunit composition of native ganglionic M-currents deduced from
block by tetraethylammonium (TEA). J Neurosci
23: 5012-5019.[Abstract/Free Full Text]
Hunt SP, Mantyh PW (2001) The molecular dynamics of
pain control. Nat Rev Neurosci 2:
83-91.[Web of Science][Medline]
Ishikawa K, Tanaka M, Black JA, Waxman SG (1999)
Changes in expression of voltage-gated potassium channels in dorsal root
ganglion neurons following axotomy. Muscle Nerve
22: 502-507.[Web of Science][Medline]
Jensen TS, Gottrup H, Kasch H, Nikolajsen L, Terkelsen AJ, Witting
N (2001) Has basic research contributed to chronic pain
treatment? Acta Anaesthesiol Scand 45:
1128-1135.[Web of Science][Medline]
Jentsch TJ (2000) Neuronal KCNQ potassium channels:
physiology and role in disease. Nat Rev Neurosci
1: 21-30.[Web of Science][Medline]
Kaczorowski GJ, Garcia ML (1999) Pharmacology of
voltage-gated and calcium-activated potassium channels. Curr Opin Chem
Biol 3:
448-458.[Web of Science][Medline]
Karchewski L, Burbidge SA, Woolf CJ (2001)
Localization of KCNQ potassium channels in primary sensory neurons. Soc
Neurosci Abstr 27:
2167.
Kim SH, Chung JM (1992) An experimental model for
peripheral neuropathy produced by segmental spinal nerve ligation in the rat.
Pain 50:
355-363.[Web of Science][Medline]
Kubisch C, Schroeder BC, Friedrich T, Lutjohann B, El-Amraoui A,
Marlin S, Petit C, Jentsch TJ (1999) KCNQ4, a novel potassium
channel expressed in sensory outer hair cells, is mutated in dominant
deafness. Cell 96:
437-446.[Web of Science][Medline]
Lamas JA, Selyanko AA, Brown DA (1997) Effects of a
cognition-enhancer, linopirdine (DuP 996), on M-type potassium currents
(IK(M)) and some other voltage- and ligand-gated membrane currents
in rat sympathetic neurons. Eur J Neurosci
9: 605-616.[Web of Science][Medline]
Lerche C, Scherer CR, Seebohm G, Derst C, Wei AD, Busch AE,
Steinmeyer K (2000) Molecular cloning and functional expression
of KCNQ5, a potassium channel subunit that may contribute to neuronal
M-current diversity. J Biol Chem 275:
22395-22400.[Abstract/Free Full Text]
Main MJ, Cryan JE, Dupere JRB, Cox B, Clare JJ, Burbidge SA
(2000) Modulation of KCNQ2/3 potassium channels by the novel
anticonvulsant retigabine. Mol Pharmacol
58: 253-262.[Abstract/Free Full Text]
Marrion NV (1997) Control of M-current. Annu
Rev Physiol 59:
483-504.[Web of Science][Medline]
Matthews EA, Dickenson AH (2001) Effects of spinally
delivered N- and P-type voltage-dependent calcium channel antagonists on
dorsal horn neuronal responses in a rat model of neuropathy.
Pain 92:
235-246.[Web of Science][Medline]
McCleskey EW, Gold MS (1999) Ion channels of
nociception. Annu Rev Physiol 61:
835-856.[Web of Science][Medline]
Owen DG, Marsh SJ, Brown DA (1990) M-current noise and
putative M-channels in cultured rat sympathetic ganglion cells. J
Physiol (Lond) 431:
269-290.[Abstract/Free Full Text]
Pan Z, Selyanko AA, Hadley JK, Brown DA, Dixon JE, McKinnon D
(2001) Alternative splicing of KCNQ2 potassium channel
transcripts contributes to the functional diversity of M-currents. J
Physiol (Lond) 531:
347-358.[Abstract/Free Full Text]
Rae J, Cooper K, Gates P, Watsky M (1991) Low access
resistance perforated patch recordings using amphotericin B. J Neurosci
Methods 37:
15-26.[Web of Science][Medline]
Rundfeldt C, Netzer R (2000) The novel anticonvulsant
retigabine activates M-currents in Chinese hamster ovary-cells transfected
with human KCNQ2/3 subunits. Neurosci Lett
282: 73-76.[Web of Science][Medline]
Schroeder BC, Hechenberger M, Weinreich F, Kubisch C, Jentsch TJ
(2000) KCNQ5, a novel potassium channel broadly expressed in
brain, mediates M-type currents. J Biol Chem
275: 24089-24095.[Abstract/Free Full Text]
Schwake M, Pusch M, Kharkovets T, Jentsch TJ (2000)
Surface expression and single channel properties of KCNQ2/KCNQ3, M-type
K+ channels involved in epilepsy. J Biol Chem
275: 13343-13348.[Abstract/Free Full Text]
Selyanko AA, Hadley JK, Wood IC, Abogadie FC, Delmas P, Buckley NJ,
London B, Brown DA (1999) Two types of K+ channel
subunit, Erg1 and KCNQ2/3, contribute to the M-like current in a mammalian
neuronal cell. J Neurosci 19:
7742-7756.[Abstract/Free Full Text]
Selyanko AA, Hadley JK, Wood IC, Abogadie FC, Jentsch TJ, Brown DA
(2000) Inhibition of KCNQ1-4 potassium channels expressed in
mammalian cells via M1 muscarinic acetylcholine receptors. J
Physiol (Lond) 522
3:349-355.[Abstract/Free Full Text]
Selyanko AA, Passmore GM, Brown TA, Burbidge SA, Main M, Brown DA
(2001) Identification and nociceptive significance of M current
in small dorsal root ganglion neurons. Soc Neurosci Abstr
27: 711.
Shah MM, Mistry M, Marsh SJ, Brown DA, Delmas P (2002)
Molecular correlates of the M-current in cultured rat hippocampal neurons.
J Physiol (Lond) 544.
1:29-37.[Free Full Text]
Shapiro MS, Roche JP, Kaftan EJ, Cruzblanca H, Mackie K, Hille B
(2000) Reconstitution of muscarinic modulation of the KCNQ2/KCNQ3
K+ channels that underlie the neuronal M current. J
Neurosci 20:
1710-1721.[Abstract/Free Full Text]
Stansfeld CE, Marsh SJ, Halliwell JV, Brown DA (1986)
4-Aminopyridine and dendrotoxin induce repetitive firing in rat visceral
sensory neurones by blocking a slowly inactivating outward current.
Neurosci Lett 64:
299-304.[Web of Science][Medline]
Suzuki R, Dickenson AH (2000) Neuropathic pain: nerves
bursting with excitement. NeuroReport
11: R17-R21.[Web of Science][Medline]
Suzuki R, Matthews EA, Dickenson AH (2002)
Neurobiology of neuropathic pain: mode of action of anticonvulsants.
Eur J Pain 6:
51-60.
Tatulian L, Delmas P, Abogadie FC, Brown DA (2001)
Activation of expressed KCNQ potassium currents and native neuronal M-type
potassium currents by the anti-convulsant drug retigabine. J
Neurosci 21:
5535-5545.[Abstract/Free Full Text]
Tinel N, Lauritzen I, Chouabe C, Lazdunski M, Borsotto M
(1998) The KNCQ2 potassium channel: splice variants, functional
and developmental expression. Brain localization and comparison with KCNQ3.
FEBS Lett 438:
171-176.[Web of Science][Medline]
Tokimasa T, Akasu T (1990) ATP regulates
muscarine-sensitive potassium current in dissociated bull-frog primary
afferent neurones. J Physiol (Lond) 426:
241-264.[Abstract/Free Full Text]
Wang HS, Pan Z, Shi W, Brown BS, Wymore RS, Cohen IS, Dixon JE,
McK-innon D (1998) KCNQ2 and KCNQ3 potassium channel subunits:
molecular correlates of the M-channel. Science
282: 1890-1893.[Abstract/Free Full Text]
Watanabe H, Nagata E, Kosakai A, Nakamura M, Yokoyama M, Tanaka K,
Sasai H (2000) Disruption of the epilepsy KCNQ2 gene results in
neural hyperexcitability. J Neurochem
75: 28-33.[Web of Science][Medline]
Waxman SG, Dib-Haji S, Cummins TR, Black JA (1999)
Sodium channels and pain. Proc Natl Acad Sci USA
96: 7635-7639.[Abstract/Free Full Text]
Wickenden AD, Yu W, Zou A, Jegla T, Wagoner PK (2000)
Retigabine, a novel anti-convulsant, enhances activation of KCNQ2/Q3 potassium
channels. Mol Pharmacol 58:
591-600.[Abstract/Free Full Text]
Wickenden AD, Ye F, Liu Y, McNaughton-Smith G, Roeloffs R, Rigdon
GC (2002) KCNQ channel expression in rat DRG following nerve
ligation. Soc Neurosci Abstr
454.7.
Yang WP, Levesque PC, Little WA, Conder ML, Ramakrishnan P,
Neubauer MG, Blanar MA (1998) Functional expression of two
KvLQT1-related potassium channels responsible for an inherited idiopathic
epilepsy. J Biol Chem 273:
19419-19423.[Abstract/Free Full Text]
Zimmerman M (1983) Ethical guidelines for
investigations of experimental pain in conscious animals. Pain
16: 109-110.[Web of Science][Medline]
This article has been cited by other articles:

|
 |

|
 |
 
S. Oldfield, J. Hancock, A. Mason, S. A. Hobson, D. Wynick, E. Kelly, A. D. Randall, and N. V. Marrion
Receptor-Mediated Suppression of Potassium Currents Requires Colocalization within Lipid Rafts
Mol. Pharmacol.,
December 1, 2009;
76(6):
1279 - 1289.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
L. S. Stone and D. C. Molliver
In Search of Analgesia: Emerging Poles of GPCRs in Pain
Mol. Interv.,
October 1, 2009;
9(5):
234 - 251.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. Bal, J. Zhang, O. Zaika, C. C. Hernandez, and M. S. Shapiro
Homomeric and Heteromeric Assembly of KCNQ (Kv7) K+ Channels Assayed by Total Internal Reflection Fluorescence/Fluorescence Resonance Energy Transfer and Patch Clamp Analysis
J. Biol. Chem.,
November 7, 2008;
283(45):
30668 - 30676.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. E. Linley, K. Rose, M. Patil, B. Robertson, A. N. Akopian, and N. Gamper
Inhibition of M Current in Sensory Neurons by Exogenous Proteases: A Signaling Pathway Mediating Inflammatory Nociception
J. Neurosci.,
October 29, 2008;
28(44):
11240 - 11249.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
B. J. Tunquist, N. Hoshi, E. S. Guire, F. Zhang, K. Mullendorff, L. K. Langeberg, J. Raber, and J. D. Scott
Loss of AKAP150 perturbs distinct neuronal processes in mice
PNAS,
August 26, 2008;
105(34):
12557 - 12562.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
F. Schuetz, S. Kumar, P. Poronnik, and D. J. Adams
Regulation of the voltage-gated K+ channels KCNQ2/3 and KCNQ3/5 by serum- and glucocorticoid-regulated kinase-1
Am J Physiol Cell Physiol,
July 1, 2008;
295(1):
C73 - C80.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. R. Mackie, L. I. Brueggemann, K. K. Henderson, A. J. Shiels, L. L. Cribbs, K. E. Scrogin, and K. L. Byron
Vascular KCNQ Potassium Channels as Novel Targets for the Control of Mesenteric Artery Constriction by Vasopressin, Based on Studies in Single Cells, Pressurized Arteries, and in Vivo Measurements of Mesenteric Vascular Resistance
J. Pharmacol. Exp. Ther.,
May 1, 2008;
325(2):
475 - 483.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C. C. Hernandez, O. Zaika, G. P. Tolstykh, and M. S. Shapiro
Regulation of neural KCNQ channels: signalling pathways, structural motifs and functional implications
J. Physiol.,
April 1, 2008;
586(7):
1811 - 1821.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
F. Maingret, B. Coste, F. Padilla, N. Clerc, M. Crest, S. M. Korogod, and P. Delmas
Inflammatory Mediators Increase Nav1.9 Current and Excitability in Nociceptors through a Coincident Detection Mechanism
J. Gen. Physiol.,
February 25, 2008;
131(3):
211 - 225.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
F. Jow, Ru Shen, P. Chanda, E. Tseng, H. Zhang, J. Kennedy, J. Dunlop, and M. R. Bowlby
Validation of a Medium-Throughput Electrophysiological Assay for KCNQ2/3 Channel Enhancers Using IonWorks HT
J Biomol Screen,
December 1, 2007;
12(8):
1059 - 1067.
[Abstract]
[PDF]
|
 |
|

|
 |

|
 |
 
M. V. Soldovieri, M. R. Cilio, F. Miceli, G. Bellini, E. Miraglia del Giudice, P. Castaldo, C. C. Hernandez, M. S. Shapiro, A. Pascotto, L. Annunziato, et al.
Atypical Gating Of M-Type Potassium Channels Conferred by Mutations in Uncharged Residues in the S4 Region of KCNQ2 Causing Benign Familial Neonatal Convulsions
J. Neurosci.,
May 2, 2007;
27(18):
4919 - 4928.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. A. Punke and P. Friederich
Amitriptyline Is a Potent Blocker of Human Kv1.1 and Kv7.2/7.3 Channels
Anesth. Analg.,
May 1, 2007;
104(5):
1256 - 1264.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. Ekberg, F. Schuetz, N. A. Boase, S.-J. Conroy, J. Manning, S. Kumar, P. Poronnik, and D. J. Adams
Regulation of the Voltage-gated K+ Channels KCNQ2/3 and KCNQ3/5 by Ubiquitination: NOVEL ROLE FOR Nedd4-2
J. Biol. Chem.,
April 20, 2007;
282(16):
12135 - 12142.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
R. A. Crozier, S. K. Ajit, E. J. Kaftan, and M. H. Pausch
MrgD Activation Inhibits KCNQ/M-Currents and Contributes to Enhanced Neuronal Excitability
J. Neurosci.,
April 18, 2007;
27(16):
4492 - 4496.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
L. I. Brueggemann, C. J. Moran, J. A. Barakat, J. Z. Yeh, L. L. Cribbs, and K. L. Byron
Vasopressin stimulates action potential firing by protein kinase C-dependent inhibition of KCNQ5 in A7r5 rat aortic smooth muscle cells
Am J Physiol Heart Circ Physiol,
March 1, 2007;
292(3):
H1352 - H1363.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. Peretz, A. Sheinin, C. Yue, N. Degani-Katzav, G. Gibor, R. Nachman, A. Gopin, E. Tam, D. Shabat, Y. Yaari, et al.
Pre- and Postsynaptic Activation of M-Channels By a Novel Opener Dampens Neuronal Firing and Transmitter Release
J Neurophysiol,
January 1, 2007;
97(1):
283 - 295.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. George, J. Serra, X. Navarro, and H. Bostock
Velocity recovery cycles of single C fibres innervating rat skin
J. Physiol.,
January 1, 2007;
578(1):
213 - 232.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
K. Vervaeke, N. Gu, C. Agdestein, H. Hu, and J. F. Storm
Kv7/KCNQ/M-channels in rat glutamatergic hippocampal axons and their role in regulation of excitability and transmitter release
J. Physiol.,
October 1, 2006;
576(1):
235 - 256.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
H. H. Hansen, C. Ebbesen, C. Mathiesen, P. Weikop, L. C. Ronn, O. Waroux, J. Scuvee-Moreau, V. Seutin, and J. D. Mikkelsen
The KCNQ Channel Opener Retigabine Inhibits the Activity of Mesencephalic Dopaminergic Systems of the Rat
J. Pharmacol. Exp. Ther.,
September 1, 2006;
318(3):
1006 - 1019.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C. L. Wladyka and D. L. Kunze
KCNQ/M-currents contribute to the resting membrane potential in rat visceral sensory neurons
J. Physiol.,
August 15, 2006;
575(1):
175 - 189.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. Koyama and S. B. Appel
Characterization of M-Current in Ventral Tegmental Area Dopamine Neurons
J Neurophysiol,
August 1, 2006;
96(2):
535 - 543.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
L. Forti, E. Cesana, J. Mapelli, and E. D'Angelo
Ionic mechanisms of autorhythmic firing in rat cerebellar Golgi cells
J. Physiol.,
August 1, 2006;
574(3):
711 - 729.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
H. J. Chung, Y. N. Jan, and L. Y. Jan
Polarized axonal surface expression of neuronal KCNQ channels is mediated by multiple signals in the KCNQ2 and KCNQ3 C-terminal domains
PNAS,
June 6, 2006;
103(23):
8870 - 8875.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. R. Schwarz, G. Glassmeier, E. C. Cooper, T.-C Kao, H. Nodera, D. Tabuena, R. Kaji, and H. Bostock
KCNQ channels mediate IKs, a slow K+ current regulating excitability in the rat node of Ranvier
J. Physiol.,
May 15, 2006;
573(1):
17 - 34.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. Piccinin, A. D. Randall, and J. T. Brown
KCNQ/Kv7 Channel Regulation of Hippocampal Gamma-Frequency Firing in the Absence of Synaptic Transmission
J Neurophysiol,
May 1, 2006;
95(5):
3105 - 3112.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. F. Otto, Y. Yang, W. N. Frankel, H. S. White, and K. S. Wilcox
A Spontaneous Mutation Involving Kcnq2 (Kv7.2) Reduces M-Current Density and Spike Frequency Adaptation in Mouse CA1 Neurons
J. Neurosci.,
February 15, 2006;
26(7):
2053 - 2059.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. Shahidullah, L. C. Santarelli, H. Wen, and I. B. Levitan
Expression of a calmodulin-binding KCNQ2 potassium channel fragment modulates neuronal M-current and membrane excitability
PNAS,
November 8, 2005;
102(45):
16454 - 16459.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
W. Shen, S. E. Hamilton, N. M. Nathanson, and D. J. Surmeier
Cholinergic Suppression of KCNQ Channel Currents Enhances Excitability of Striatal Medium Spiny Neurons
J. Neurosci.,
August 10, 2005;
25(32):
7449 - 7458.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. M. Cuellar, P. X. Montesano, J. F. Antognini, and E. Carstens
Application of Nucleus Pulposus to L5 Dorsal Root Ganglion in Rats Enhances Nociceptive Dorsal Horn Neuronal Windup
J Neurophysiol,
July 1, 2005;
94(1):
35 - 48.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. P. G. Korsgaard, B. P. Hartz, W. D. Brown, P. K. Ahring, D. Strobaek, and N. R. Mirza
Anxiolytic Effects of Maxipost (BMS-204352) and Retigabine via Activation of Neuronal Kv7 Channels
J. Pharmacol. Exp. Ther.,
July 1, 2005;
314(1):
282 - 292.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. Vydyanathan, Z.-Z. Wu, S.-R. Chen, and H.-L. Pan
A-Type Voltage-Gated K+ Currents Influence Firing Properties of Isolectin B4-Positive But Not Isolectin B4-Negative Primary Sensory Neurons
J Neurophysiol,
June 1, 2005;
93(6):
3401 - 3409.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. Peretz, N. Degani, R. Nachman, Y. Uziyel, G. Gibor, D. Shabat, and B. Attali
Meclofenamic Acid and Diclofenac, Novel Templates of KCNQ2/Q3 Potassium Channel Openers, Depress Cortical Neuron Activity and Exhibit Anticonvulsant Properties
Mol. Pharmacol.,
April 1, 2005;
67(4):
1053 - 1066.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
H. Chen and S. R. Ikeda
Modulation of Ion Channels and Synaptic Transmission by a Human Sensory Neuron-Specific G-Protein-Coupled Receptor, SNSR4/mrgX1, Heterologously Expressed in Cultured Rat Neurons
J. Neurosci.,
May 26, 2004;
24(21):
5044 - 5053.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C. Yue and Y. Yaari
KCNQ/M Channels Control Spike Afterdepolarization and Burst Generation in Hippocampal Neurons
J. Neurosci.,
May 12, 2004;
24(19):
4614 - 4624.
[Abstract]
[Full Text]
[PDF]
|
 |
|