The Journal of Neuroscience, August 20, 2003, 23(20):7516-7524
Previous Article | Next Article 
Deafness Disrupts Chloride Transporter Function and Inhibitory Synaptic Transmission
Carmen Vale,1
Jon Schoorlemmer,2 and
Dan H. Sanes3
1School of Medicine and Centro Regional de
Investigaciones Biomedicas, University of Castilla-La Mancha, Albacete 02071,
Spain, 2Department of Biochemistry and Molecular
Biology, Mount Sinai School of Medicine, New York, New York 10029, and
3Center for Neural Science and Department of Biology,
New York University, New York, New York 10003
 |
Abstract
|
|---|
Loss of sensory function leads to atrophy or death within the developing
CNS, yet little is known about the physiology of remaining synapses. After
bilateral deafening, gramicidin-perforated-patch recordings were obtained from
gerbil inferior colliculus neurons in a brain slice preparation.
Afferent-evoked IPSPs had a diminished ability to block current-evoked action
potentials in deafened neurons. This change could be attributed, in part, to a
loss of potassium-dependent chloride transport function, with little change in
K-Cl cotransporter expression. Treatments that suppressed chloride cotransport
(bumetanide, cesium, and genistein) had little or no effect on neurons from
deafened animals. These same treatments depolarized the
EIPSC of control neurons. Semiquantitative RT-PCR and
immunohistochemical staining indicated no change in the expression of chloride
cotransporter mRNA or protein after deafness. Therefore, profound hearing loss
leads rapidly to the disruption of chloride homeostasis, which is likely
attributable to the dysfunction of the potassium-dependent chloride
cotransport mechanism, rather than a downregulation of its expression. This
results in inhibitory synapses that are less able to block excitatory
events.
Key words: inferior colliculus; gerbil; auditory; inhibition; development; KCC2; plasticity
 |
Introduction
|
|---|
The function of central synapses after blindness, deafness, or comparable
forms of deafferentation is mostly unknown. However, in vivo results
suggest that synaptic strength is adversely affected
(Sherman and Spear, 1982
;
Klinke et al., 1999
). An
understanding of these changes seems particularly important in light of the
compensatory changes that accompany peripheral injury
(Pallas et al., 1999
;
Gold and Knudsen, 2000
;
Syka, 2002
) and the potential
to restore stimulation with prosthetic devices
(Klinke et al., 1999
;
Kral et al., 2002
). One
crucial question is whether the balance between inhibitory and excitatory
synaptic drive is altered by hearing loss. For example, some in vivo
studies show an apparent decrease of inhibition in the adult inferior
colliculus (IC) or cortex after partial hearing loss
(Kitzes and Semple, 1985
;
Rajan, 1998
;
Mossop et al., 2000
). Until
recently, there was no direct evidence that inhibitory synapses themselves
undergo a change in function after deafness (Vale and Sanes,
2000
,
2002
), and the molecular loci
of these changes remain unexplored. The goal of the present study was to
measure inhibitory synaptic strength after deafness and determine whether any
loss of strength was attributable to a decline in chloride cotransporter
expression or loss of transport function.
Synaptic inhibition mediated by GABAA or glycine receptors
involves activation of a Cl- conductance
(Bormann et al., 1987
).
Intracellular chloride ([Cl-]i) is regulated primarily
by two cation-chloride cotransporter family members: an Na-K-2Cl cotransporter
(NKCC1) leads to cytoplasmic accumulation of chloride, and a K-Cl
cotransporter (KCC2) extrudes chloride
(Delpire et al., 1994
; Payne
et al., 1996
,
2003
;
Payne, 1997
). During early
development, [Cl-]i is relatively high because of NKCC1
activity (Plotkin et al.,
1997
; Clayton et al.,
1998
; Kanaka et al.,
2001
). As KCC2 expression increases, [Cl-]i
drops below the electrochemical equilibrium
(Lu et al., 1999
;
DeFazio et al., 2000
;
Hübner et al., 2001
),
leading to a transition from inhibitory synapse-evoked depolarizations to
hyperpolarizations (Wang et al.,
1994
; Owens et al.,
1996
; Ehrlich et al.,
1999
; Kakazu et al.,
1999
; Rivera et al.,
1999
).
Two recent studies demonstrate that synaptic or electrical activity can
influence chloride homeostatic mechanisms. GABAA receptor
activation facilitates KCC2 expression and the appearance of
GABAA-mediated hyperpolarizations in hippocampal cultures
(Ganguly et al., 2001
). In
contrast, axonal injury to motor neurons decreases KCC2 expression, resulting
in GABAA-mediated depolarizing responses
(Nabekura et al., 2002
). There
is some indication that epilepsy is also associated with improper chloride
balance (Cohen et al.,
2002
).
Because deafness leads to a depolarization of the inhibitory synaptic
reversal potential (Kotak and Sanes,
1996
; Vale and Sanes,
2000
,
2002
), we now examine both the
expression and functional status of chloride transport mechanisms in control
and deafened gerbils. In control neurons, chloride transport could be blocked
by three different pharmacological treatments, whereas the weak inhibitory
synapses from deaf animals were unaffected. RT-PCR and immunohistochemical
analyses both showed that chloride cotransporters were well expressed in deaf
animals, leading to the conclusion that chloride extrusion mechanisms are
functionally disrupted. These results suggest that normal auditory activity
regulates inhibitory synaptic strength through the functional status of a
chloride cotransporter.
 |
Materials and Methods
|
|---|
Cochlear ablation. All of the protocols were reviewed and approved
by the New York University Institutional Animal Care and Use Committee. Both
cochleas were removed in postnatal day 7 (P7) gerbils (Meriones
unguiculatus), using a method described previously
(Sanes et al., 1992
;
Vale and Sanes, 2000
).
Briefly, P7 pups were anesthetized with hypothermia until respiration ceased
and animals did not respond to nociceptive stimuli. A small hole was made in
the cochlear wall, and the contents were removed with a forceps. A piece of
Gelfoam was placed in the cavity, and the wound was closed. After surgery,
animals were warmed on a heating pad and returned to the litter when
respiration and motor activity recovered. Successful ablations were confirmed
before each brain slice experiment. Experiments were performed 1-7 d after
surgery.
Brain slice preparation. Control and bilaterally ablated P8-P14
gerbils were anesthetized with chloral hydrate (350 mg/kg). After
decapitation, coronal slices of 300 µm containing the rostral IC were
obtained as described previously (Vale and
Sanes, 2000
). The tissue was cut in cold oxygenated artificial CSF
(ACSF) containing (in mM): 123 NaCl, 4 KCl, 1.2
KH2PO4, 1.3 MgSO4, 28 NaHCO3, 15
glucose, 2.4 CaCl2, and 0.4 L-ascorbic acid, pH 7.3 when
oxygenated with 95% O2-5% CO2. After 2 hr, slices
containing the rostral IC were placed in a recording chamber and superfused
with oxygenated ACSF (7 ml/min) at room temperature (22-24°C).
Electrophysiology. Gramicidin-perforated-patch recordings in
voltage- and current-clamp mode (PC-501A; Warner Instruments, Hamden, CT) were
obtained as described previously (Rhee et
al., 1994
; Vale and Sanes,
2000
,
2002
). Recording electrodes
were fabricated from borosilicate glass microcapillaries (outer diameter, 1.5
mm), and the tip resistance was 5-10 M
. Gramicidin (Sigma, St. Louis,
MO) was used as the membrane-perforating agent to allow recording without
influencing the [Cl-]i. The internal pipette solution
contained (in mM): 132.5 KCl, 0.6 EGTA, 10 HEPES, 2
MgCl2, 2 ATP, 0.3 GTP, and 5
N-(2,6-dimethylphenylcarbamoylmethyl)triethylammonium bromide
(QX-314), pH 7.2. The integrity of the perforation was verified by adding
QX-314 (Alamone, Jerusalem, Israel) to the intracellular pipette solution. The
presence of depolarization-evoked breakaway action potentials (APs) was taken
as indication of the integrity of the gramicidin perforation. The progress of
perforation was evaluated by monitoring the decrease in membrane resistance.
After the membrane resistance had stabilized, data were obtained. In
experiments to test for intracellular potassium-dependent chloride transport,
KCl was replaced in the internal pipette solution with equimolar cesium
gluconate.
Extracellular stimuli (200 µsec pulses) were delivered to the
ipsilateral lateral lemniscal pathway (LL) through paired Teflon-insulated
platinum electrodes driven by isolated biphasic stimulators (Intronics
Instruments, Ontario, Canada). Data were collected using a Macintosh PPC
running a custom-designed Igor macro (WaveMetrics, Lake Oswego, OR) called
Slice (Kotak et al., 2001
).
Stimuli were delivered, and data were sampled via an ITC-18 computer interface
(Instrutech, Port Washington, NY). Analyses of peak PSC amplitude and reversal
potential were performed off-line using a second Igor macro called Slice
Analysis.
The strength and duration of inhibition was evaluated using current-clamp
gramicidin-perforated recordings in the presence of 5 mM kynurenic
acid (KYN) (Fluka BioChemika, Ronkonkoma, NY). In these recordings, KCl was
used in the internal pipette solution, and QX-314 was retained to confirm the
integrity of the perforation. The ability of inhibitory afferents to inhibit
evoked action potentials was tested by injecting a short depolarizing current
pulse (25-50 msec) that evoked an AP in the postsynaptic neuron, and
simultaneously the LL afferents were stimulated. This process was repeated 10
times. The number of times that the LL-evoked IPSP suppressed the
current-evoked AP was used to calculate the percentage of inhibition. The time
during which the LL-evoked IPSP was able to block the AP was also evaluated by
stimulating the LL afferents with latencies from -200 to 0 msec before the
current-evoked AP (at 10 msec intervals). Each stimulus was delivered twice at
the same latency. The absence of an action potential in two consecutive trials
with the same latency was considered to be inhibition.
When only two groups were compared, a Student's t test was used to
assess whether the differences were significant. When multiple comparisons
were made, a one-way ANOVA was followed by pairwise comparisons (Tukey-Kramer
honest significant difference test) to assess significant differences. All of
the values are expressed as mean ± SEM, with the number of observations
in parentheses. EIPSC values were calculated from linear
fits of the current-voltage curves plotting IPSC amplitude versus membrane
holding potential.
RT-PCR to determine NKCC1 and KCC2 expression. Slices of 600 µm
were obtained from the ICs of P9 and P14 control and BCA animals as described
for brain slice preparation, using RNase-free medium. The central nucleus of
the IC was dissected under the microscope, and the tissue was immediately
frozen in dry ice and kept at -80°C. RNA was isolated from two slices per
experimental sample using TRIzol reagent (Invitrogen, San Diego, CA) and
treated with RNase-free DNase and phenol extracted twice. RT-PCR assays were
performed using the OneSTEP RT-PCR kit (Qiagen, Hilden, Germany). In all of
the cases, successful amplification was dependent on reverse transcription
demonstrating amplification of mRNA templates. Reactions contained test mRNA
(
5 µl), RNAsin (0.5 µl), and 0.8 µM each primer.
Reactions were mixed on ice and cycled as follows: reverse transcription for
30 min at 50°C, heat inactivation for 15 min at 90°C, and 30 PCR
cycles (1 min at 94°C, 2 min at 58°C, and 1 min at 72°C). Aliquots
(10 µl) were removed at several time points during an extended 5 min
incubation at 72°C to monitor exponential amplification. Samples were
analyzed by ethidium bromide staining after separation in a 2%
agarose-Tris-borate-EDTA gel. Primer pairs were chosen to reside in different
exons and within regions of sequence identity between different species, based
on the following GenBank entries (accession number in parentheses): human
NKCC1 cDNA (U30246
[GenBank]
), mouse NKCC1 cDNA (U13174
[GenBank]
), rat NKCC1 cDNA (AF 051561),
rat KCC2 cDNA (U55816
[GenBank]
), and mouse genomic KCC2 sequences (AJ011033
[GenBank]
),
conceptually translated in comparison with the rat cDNA.
Two different primer pairs were used for both NKCC1 (NK5-NK6 and NK7-NK8)
and KCC2 (KCC21-KCC22 and KCC21-KCC23). Sizes of amplified DNA fragments were
as predicted. The primers used were the following: GPDH1,
catcaacgaccccttcattgacctc; GPDH2, atacttggcag gtttctccaggcg; KCC21,
cgcagccaccatgctcaacaac; KCC22, acaccaaagatgt tctgcaggcacg; KCC23,
ggcccagagacctggaaatcatgtagta; NK5, gaatggagtgg gaagcaaaggctc; NK6,
tcctttgggtatggctgactgagg; NK7, ggtggctttttgatgatg gaggtttgac; and NK8,
aaggtaaggacgctctgatgattccc.
The intensity of each PCR band was measured with a fixed-size sampling
area, using the image analysis program Quantity One (Bio-Rad Laboratories,
Hercules, CA). Values were expressed as the ratio of mean intensity for each
cotransporter band divided by the glyceraldehyde 3-phosphate dehydrogenase
(GAPDH) band for each experimental condition.
Immunohistochemical localization of KCC2 protein.
Immunohistochemical localization of KCC2 protein was performed with an
affinity-purified rabbit anti-KCC2 polyclonal antibody (Upstate Biotechnology,
Lake Placid, NY). P14 control and BCA gerbils were deeply anesthetized with
sodium pentobarbital (80 mg/kg). Their vasculature was immediately flushed
with 0.9% saline, followed by 4% paraformaldehyde in PBS. Brains were removed,
postfixed in 4% paraformaldehyde for 2 hr, frozen in 2-methyl butane on dry
ice, embedded in mounting media, and stored at -80°C. A Leica (Nussloch,
Germany) cryostat produced 25 µm frozen coronal sections that were mounted
on slides.
Immunoperoxidase labeling was performed as described previously
(Williams et al., 1999
). IC
sections from control and BCA animals were washed three times in PBS and then
placed in 2% goat serum (GS)-PBS containing 0.2% Triton X-100 for 2 hr at room
temperature. Sections were incubated at 4°C for 48 hr with anti-KCC2
primary antibody diluted 1:100 in GS-PBS. After three PBS washes, sections
were incubated for 2 hr at room temperature with a biotin-conjugated goat
anti-rabbit IgG (1:200 dilution; Vector Laboratories, Burlingame, CA).
Sections were washed three times in PBS and incubated for 3 hr in an
avidin-horseradish peroxidase solution prepared from an ABC kit (Vector
Laboratories). After three washes in PBS, the horseradish peroxidase reaction
was performed using diaminobenzidine (DAB) (0.015% in PBS; Sigma) and 0.001%
hydrogen peroxide. Sections were washed three times in PBS, taken through an
ethanol-xylene dehydration series, and cover-slipped. Photographs of
DAB-stained sections were taken with a Leica microscope. Controls for the
immunohistochemistry experiments were obtained by incubating one of each four
consecutive slides without primary antibody. None of the slides that were run
without primary antibody showed staining.
To quantify the immunohistochemical staining pattern, a second set of
stains were performed with a biotinylated secondary antibody anti-rabbit IgG
(Vector Laboratories) and streptavidin (Alexa Fluor 488 conjugate; Molecular
Probes, Eugene, OR). The sections were then examined with a confocal
microscope (Leica TCS SP2; 40x objective), and intensity measures were
acquired (Leica PowerScan software). An area of 94 µm 2 was
imaged in the central nucleus from control and BCA tissue sections, and the
mean pixel intensity above background was obtained.
 |
Results
|
|---|
Inhibitory synaptic strength was reduced after complete deafness
Previous reports have demonstrated a deafness-induced change in
EIPSC and inhibitory conductance (Vale and Sanes,
2000
,
2002
). To examine the
effective strength of inhibitory synapses after deafness, we tested the
ability of IPSPs to block current-evoked APs in control and BCA animals. As
shown in Figure 1A,
LL-evoked IPSPs and current-evoked APs were first elicited independently. The
LL-evoked IPSPs were then presented concurrently or at a fixed latency to the
current-evoked action potentials. In control neurons, the evoked IPSPs
suppressed APs in 97 ± 2% (n = 15) of the trials
(Fig. 1B). In BCA
neurons, the IPSPs were able to block APs in only 43 ± 11% (n
= 14) of the trials. Thus, the ability of LL-evoked IPSPs to inhibit
current-evoked APs was reduced considerably in BCA neurons compared with
controls (p < 0.0001; t = -4.859; df = 27). The
functional duration of inhibition was also tested by evoking APs at fixed
latencies to the IPSPs (see Materials and Methods).
Figure 1C shows the
mean duration of inhibition in control and BCA animals. The duration of
inhibition was significantly longer in control neurons (81 ± 13 msec;
n = 10) than in BCA neurons (27 ± 10 msec; n = 13;
p < 0.005; t =-3.245; df = 21). Therefore, both measures
of synaptic strength indicate that inhibitory connections are less able to
suppress suprathreshold excitatory events after deafness.

View larger version (16K):
[in this window]
[in a new window]
|
Figure 1. An evaluation of inhibitory synaptic strength in neurons from control and
BCA animals. A, Traces show examples of LL-evoked IPSPs,
current-evoked action potentials, and the simultaneous presentation of IPSPs
with action potentials (from left to right) in control and BCA animals. The
number of times that the LL-evoked IPSP inhibited the AP in 10 consecutive
trials was counted and used to calculate the percentage of inhibition.
B, Mean IPSP ability to inhibit APs is significantly lower in BCA
neurons compared with controls. n values are in bars
(*p < 0.0001). C, Duration of inhibition was
significantly shorter in BCA neurons compared with controls (measurement
described in Materials and Methods). n values are in bars
(**p < 0.005). Error bars indicate SEM.
|
|
An additional set of experiments were performed in whole-cell current-clamp
mode to assess neuron excitability. Although resting membrane potential did
not differ significantly between groups (control, -53.8 ± 0.8 mV,
n = 16; BCA, -52.3 ± 0.8 mV, n = 14), it was possible
that action potential threshold changed after deafness. To evaluate this
possibility, the action potential threshold was subtracted from resting
membrane potential as an indicator of neuron excitability. Action potential
threshold was 16 ± 3 mV above rest (n = 15) for control
neurons and 18 ± 2 mV above rest (n = 16) for BCA neurons, and
there was not a significant difference between groups (p = 0.417;
t = -0.824; df = 29).
Blockade of chloride transporters had a smaller effect on deafened
neurons
If chloride homeostasis was compromised in deaf animals, then one would
expect the loop diuretic bumetanide
(Russell, 2000
) to have a
relatively modest effect on BCA neuron synaptic physiology. In control
neurons, 100 µM bumetanide depolarized the
EIPSC in all of the neurons tested (12 ± 2 mV;
n = 21). In contrast, bumetanide produced only a small depolarization
in BCA neurons (4 ± 2 mV; n = 13). As shown in
Table 1, the bumetanide-induced
change was significantly smaller in BCA neurons compared with controls
(p < 0.03; t = 2.375; df = 32). This experiment indicates
that bumetanide-sensitive cotransporters, such as KCC2 and NKCC1, participate
in the [Cl-]i regulation of control neurons but are less
active after deafness. Because bumetanide at 20 µM is a
selective antagonist of NKCC (Gillen et
al., 1996
; Payne,
1997
), we examined whether this concentration would cause a
negative shift in the EIPSC of BCA neurons. Although the
average shift of -5 mV (n = 6) suggested such a trend, there was not
a significant difference (p > 0.3; t = 1.07; df = 10),
indicating that NKCC does not contribute significantly to Cl-
regulation in IC neurons at the ages studied.
Potassium-dependent chloride extrusion was decreased in deafened
neurons
To examine the functional role of KCC2 in control and BCA neurons, we
tested the effect of decreasing intracellular K+ concentration
([K+]i)on EIPSC. Because activation
of KCC2 requires the simultaneous presence of K+ and
Cl-, we examined the effect of a Cs+-containing pipette
solution using the gramicidinperforated-patch configuration.
Figure 2A shows IPSCs
from control and BCA neurons under both recording conditions. The control
neuron recorded with Cs+ exhibited a more depolarized
EIPSC than that recorded with K+. In contrast,
the BCA neuron recorded with Cs+ displayed a similar
EIPSC to that recorded with K+. For control
neurons, the average EIPSC obtained with K+ was
-74 ± 1.8 mV (n = 45), and that obtained with Cs+
was -49.5 ± 2.8 mV (n = 19). In BCA neurons, the average
EIPSC obtained with K+ was -49.7 ± 2.2
mV (n = 33), and that obtained with Cs+ was -42.7 ±
2.9 mV (n = 18). An ANOVA indicated that there was a main effect
(p < 0.0001; F = 41.943; df = 3), and pairwise
comparisons showed that there was a large effect of Cs on
EIPSC in control neurons (p < 0.001;
t = 7.601; df = 62), but not in BCA neurons (p > 0.05;
t = 1.815; df = 49). Control and BCA neurons recorded with
Cs+-containing pipette solution did not differ significantly from
each another (p > 0.1; t = 1.671; df = 35).
Figure 2B summarizes
these observations, which indicate that chloride regulation depends on
[K+]i in control neurons, but that this mechanism is
nearly absent after deafness. The effect of cesium on
EIPSC in BCA neurons is similar to that previously
reported in immature auditory neurons
(Kakazu et al., 1999
).

View larger version (18K):
[in this window]
[in a new window]
|
Figure 2. The effect of K+ or Cs+ in the recording pipette on
EIPSC in neurons from control and BCA animals. A,
Representative traces from control and BCA animals at different holding
potentials are shown for recordings with K+- and
Cs+-containing pipettes. B, For control neurons, the mean
EIPSC was significantly more depolarized when the internal
pipette solution contained Cs+. However, for BCA neurons, there was
not a significant difference between K+- and
Cs+-containing pipettes. n values are in bars
(*p < 0.0001 vs K+). Error bars indicate
SEM.
|
|
Phosphorylation-dependent chloride extrusion was decreased in
deafened neurons
KCC2 has a C-terminal protein tyrosine kinase (PTK) consensus site, and
outward transport of chloride requires PTK activity
(Payne, 1997
;
Kelsch et al., 2001
). If
PTK-dependent chloride transport is compromised in deaf animals, then a
membrane-permeable inhibitor of PTK that reduces KCC2-mediated transport
(genistein) should have larger effect on control neurons, compared with BCA
neurons (Akiyama et al., 1987
;
Kelsch et al., 2001
).
Figure 3A shows
representative IPSCs from control and BCA neurons, and demonstrates the effect
of genistein exposure. In the control neuron, a 10 min perfusion of 50
µM genistein caused a significant depolarization of the
EIPSC, whereas the same treatment had no effect on the BCA
neuron. As shown in Figure
3B, the average EIPSC depolarization
for control neurons was 15 ± 4 mV (n = 10), and this was a
significant effect (p < 0.006; t = 3.165; df = 18). In
contrast, genistein led to an average EIPSC depolarization
of only 2 ± 1mV(n = 6) in BCA neurons, and this was not a
significant change (p > 0.7; t = 0.273; df = 10). The
average genistein-induced EIPSC depolarization was
significantly smaller for BCA neurons compared with controls (p =
0.040; t = 2.266; df = 14). Increasing the genistein concentration to
100 µM and perfusion of genistein for 30 min did not heighten
the effect on EIPSC in BCA neurons (data not shown).

View larger version (19K):
[in this window]
[in a new window]
|
Figure 3. The effect of genistein on EIPSC in neurons from
control and BCA animals. A, Representative traces from control and
BCA animals at different holding potentials are shown for recordings obtained
in ACSF and after exposure to 50 µM genistein. KYN was present
throughout these recordings. B, The mean EIPSC
for control neurons was significantly depolarized in the presence of
genistein. However, for BCA neurons, there was not a significant difference.
n values are in bars (*p = 0.005 vs
EIPSC in ACSF). Error bars indicate SEM.
|
|
Chloride cotransporter expression in control and deafened
animals
The EIPSC depolarization observed in BCA animals could
be caused by reduced expression of an outward chloride cotransporter, such as
KCC2, or increased expression of an inward chloride cotransporter, such as
NKCC1. To examine this hypothesis, the level of mRNAs encoding both chloride
cotransporters in the ICs of control and BCA animals was measured by RT-PCR.
In the absence of published DNA sequences for KCC2 and NKCC1 in gerbil,
primers were designed in regions of rodent (and human) sequence identity,
assuming cross-species sequence identity in those same regions. Indeed, NKCC1,
KCC2, and GAPDH sequences were readily amplified after reverse transcription
of gerbil mRNA (Fig.
4A). This was true using two different primer pairs for
both NKCC1 (either NK5-NK6 or NK7-NK8) and KCC2 (either KCC21-KCC22 or
KCC21-KCC23). The gerbil template yielded bands identical in size to their rat
counterparts (Fig.
4A), as expected in case of rodent sequence identity.

View larger version (31K):
[in this window]
[in a new window]
|
Figure 4. Chloride cotransporter mRNA expression in the ICs from control and BCA
animals. A, Amplification of NKCC1, KCC2, and GAPDH sequences in
gerbil and rat yielded bands of identical size. Primers used were specific for
either NKCC1 (top) or KCC2 (bottom), and two different primer sets were used
for each of the genes (described in Materials and Methods). GAPDH mRNA was
amplified from the same samples as an input control. The number of PCR cycles
was 30. B, NKCC1 mRNA expression in control (Con) and BCA gerbils.
RNA was isolated from gerbils at days 9 (P9) and 14 (P14) and was subjected to
RT-PCR. Sizes of amplified DNA fragments are indicated on the left, and the
number of PCR cycles is indicated on the right. C, KCC2 mRNA
expression in control and BCA gerbils. RNA was isolated from gerbils at P9 and
P14 and was subjected to RT-PCR. Sizes of amplified DNA fragments are
indicated on the left, and number of PCR cycles is indicated on the right.
|
|
The levels of mRNA encoding either NKCC1
(Fig. 4B) or KCC2
(C) were unchanged in BCA animals compared with controls. This was
true at both survival ages examined, P9 and P14. Expression levels of GAPDH
showed that mRNA input levels from P9 and P14 samples taken from control or
BCA animals were nearly identical (Fig.
3B,C, lanes marked GAPDH). Moreover, the exponential
increase in DNA content with cycle number suggested amplification was
semiquantitative, satisfying a condition to reliably measure differences in
mRNA levels. The ratio of cotransporter band intensity to GAPDH was assessed
after 30 cycles for each animal, and this ratio did not exhibit a significant
difference among groups for any of the four primers (KCC21-KCC22, p
> 0.9, F = 0.103, df = 3; KCC21-KCC23, p > 0.88,
F = 0.226, df = 3; NK5-NK6, p > 0.9, F = 0.053,
df = 3; and NK7-NK8, p > 0.9, F = 0.007, df = 3). Nor
were significant differences observed after 22 or 25-26 cycles. These results
indicate that expression of the mRNAs encoding two major chloride
cotransporters in the IC is not affected by deafening.
KCC2 protein is similarly localized in control and deafened
animals
To determine whether the EIPSC depolarization observed
in deaf animals was attributable to reduced translation of the KCC2 protein,
the immunohistochemical staining pattern was assessed.
Figure 5 shows images of a
control section (top), KCC2 staining in the gerbil IC of control (middle), and
BCA (bottom) inferior colliculus. At the level of light microscopy, the
anti-KCC2 antibody appeared to label the plasma membrane of neuronal somata
and neuropil throughout the gerbil IC of both control and BCA animals. There
was no apparent difference in the distribution or intensity of staining
between control and experimental animals. In confirmation of the staining
pattern obtained for the anti-KCC2 antibody in gerbil IC, the
immunohistochemical pattern was also observed for adult rat and gerbil
cerebellum (data not shown), and this conformed to the pattern described
previously (Williams et al.,
1999
). These results suggest that protein translation of KCC2
cannot account for the deafness-induced change in chloride homeostasis.

View larger version (80K):
[in this window]
[in a new window]
|
Figure 5. Immunohistochemical staining with anti-KCC2 polyclonal antibody in the ICs
of control and BCA animals. Top, Control section in which tissue was not
exposed to primary antibody. Middle, KCC2 staining in the IC of control
animal. Bottom, KCC2 staining in the IC of BCA animal. Images were obtained at
a magnification of 630x. Scale bar, 50 µm.
|
|
The immunohistochemical findings were quantified in a separate set of
experiments on fluorescently labeled tissue, using a confocal microscope. The
mean pixel intensity from control sections (123 ± 7) and from BCA
sections (115 ± 7) did not differ significantly (p > 0.3;
t = -0.957; df = 18).
 |
Discussion
|
|---|
The proper balance of excitatory and inhibitory drive is an essential
feature of all of the neuronal computational circuits. The auditory coding
properties that are presumed to underlie sound localization and
spectrotemporal discrimination are each sensitive to manipulations that block
inhibition (Grothe, 1994
;
Suga et al., 1997
;
Carney, 1999
;
Brand et al., 2002
;
Klug et al., 2002
;
Pollak et al., 2002
;
Syka, 2002
). Therefore,
regulation of the molecular mechanisms that control inhibitory synaptic
strength, such as chloride homeostasis, is a fundamental component of most
auditory coding properties. The present study examined the basis for decreased
inhibitory synaptic strength after bilateral deafness. Our results show that
deafening leads to a functional decrease of chloride transport in the central
auditory system without a decrease in the expression of cotransporter mRNA or
protein.
BCA decreases inhibitory postsynaptic strength
Many anatomical studies have shown that reduced neural activity or
deafferentation lead to postsynaptic cell death, atrophy, and altered
metabolism in the central auditory nervous system
(Levi-Montalcini, 1949
;
Webster and Webster, 1979
;
Parks, 1981
;
Deitch and Rubel, 1984
;
Durham and Rubel, 1985
;
Born and Rubel, 1988
;
McMullen et al., 1988
;
Hashisaki and Rubel, 1989
;
Hyson and Rubel, 1989
).
However, in vivo electrophysiology studies show that the remaining
synapses do function and may undergo physiological alterations. After
unilateral deafness, the remaining ear elicits greater-than-normal excitatory
responses in the ipsilateral IC (Kitzes
and Semple, 1985
; McAlpine et
al., 1997
), and GAD levels decline rapidly
(Mossop et al., 2000
). In
vivo experiments on bilaterally deafened animals suggest that inhibition
becomes weaker in that fewer IC neurons are suppressed by auditory nerve
stimulation, and GABA release declines
(Bledsoe et al., 1995
). Partial
hearing loss is also associated with decreased inhibitory strength in the
auditory cortex (Rajan, 1998
).
Our current findings suggest that a greater net excitatory drive observed in
unilaterally or bilaterally deafened animals may result from decreased
inhibition. IPSPs are less reliable at blocking current-evoked action
potentials, compared with controls (Fig.
1).
Alteration of intracellular chloride regulators after deafness
In the present study, the depolarization of EIPSC was
attributable to a positive shift in ECl-,
because the resting membrane potential was unaltered and extracellular
Cl- was constant. In control conditions, intracellular chloride is
generally lower than expected from passive distribution
(Thompson et al., 1988
;
Thompson and Gahwiler, 1989
),
and several proteins are involved, including KCC2, NKCC1, the
Cl--HCO3- exchanger, and the
Na+-dependent Cl--HCO3- exchanger
(Payne et al., 2003
). Of
these, KCC2 is the primary contributor to maintaining low
[Cl-]i (Thompson et
al., 1988
; Payne et al.,
1996
; Payne, 1997
;
Plotkin et al., 1997
;
Kakazu et al., 1999
;
Lu et al., 1999
;
Rivera et al., 1999
).
In each of three different experimental manipulations, the neurons from
deafened animals were less sensitive to blockade of the chloride homeostatic
mechanism. First, the loop diuretic bumetanide at 100 µM shifted
EIPSC to more positive values in control animals and did
not alter EIPSC in BCA neurons
(Table 1). Both NKCC1 and KCC2
cotransporters are sensitive to the loop diuretics
(Payne, 1997
;
Isenring et al., 1998
;
Russell, 2000
), and the net
depolarization of EIPSC in control neurons suggests that
KCC2 activity was attenuated. Second, substitution of Cs+ for
K+ in the internal pipette solution depolarized
EIPSC by 25 mV in control neurons, but did not modify
EIPSC in BCA neurons
(Fig. 2). A lack of effect of
cesium on intracellular chloride concentration has been reported previously on
immature lateral superior olivary neurons
(Kakazu et al., 1999
). Third,
the PTK inhibitor that blocks KCC2 activity, genistein, depolarized
EIPSC in control neurons, but did not alter
EIPSC in BCA neurons
(Fig. 3). These experiments
left open the possibility that either KCC2 expression or function had
declined.
A second nonexclusive hypothesis was that NKCC activity was upregulated
after deafness. NKCC transports Cl- into the cell, particularly in
immature neurons (Plotkin et al.,
1997
; Kakazu et al.,
1999
). However, 20 µM bumetanide did not
significantly affect EIPSC in BCA neurons, suggesting that
NKCC activity is low in IC neurons at the ages studied
(Gillen et al., 1996
;
Payne, 1997
;
Kakazu et al., 2000
). Because
other chloride transport mechanisms do not maintain low
[Cl-]i in the absence of KCC2
(Rivera et al., 2002
), we did
not assess their function in deafened animals.
Deafness does not affect KCC2 or NKCC1 expression
Our initial hypothesis was that the expression of KCC2 was decreased by
deafening. This seemed reasonable, because the manipulation was occurring
during early postnatal development, and increased KCC2 expression is commonly
observed during this period with an attendant switch to hyperpolarizing
response (Ehrlich et al.,
1999
; Kakazu et al.,
1999
; Rivera et al.,
1999
).
Changes in chloride cotransporter expression are observed during normal
development and also after injury. For example, a decrease in KCC2 expression
occurs after axotomy in vagus motor neurons
(Nabekura et al., 2002
), and
an increase or decrease of KCC2 expression can be elicited in hippocampal
cultures by exposure to a GABAA agonist or antagonist, respectively
(Ganguly et al., 2001
). In
fact, depolarizing GABAergic synaptic responses have recently been observed in
temporal lobe tissue obtained from human epilepsy patients
(Cohen et al., 2002
).
Because chloride extrusion was clearly diminished in neurons from deaf
animals (Figs. 2 and
3,
Table 1), we examined
cotransporter expression in two ways. Bilateral deafening did not alter the
mRNA levels of KCC2 or NKCC1 in IC neurons as assessed by semiquantitative
RT-PCR (Fig. 4B,C).
Furthermore, immunohistochemical visualization of the KCC2 protein revealed
that it was abundant in the ICs of both control and BCA animals.
Brain-derived neurotrophin (BDNF) signaling has been shown to downregulate
KCC2 expression by 50% in hippocampal slices, and this is associated with a
depolarization of EIPSP
(Rivera et al., 2002
).
Compared with these results, the present findings differ in an interesting
way: the EIPSP is depolarized to a similar degree, but
there is no indication that KCC2 expression has changed, and certainly not by
50% (Fig. 4). Interestingly,
BDNF-dependent expression of KCC2 has also been reported in mice that
overexpress the BDNF, but the effect is opposite to that reported in
vitro (Aguado et al.,
2003
). Therefore, the depolarization of EIPSC
and loss of inhibitory synaptic strength in deaf animals is attributable to a
change in the functional status of potassium-dependent chloride extrusion.
Hypothetical basis for loss of K-Cl cotransport function
Because the present results indicate that KCC2 and NKCC1 expression were
unaltered by deafness (Figs. 4
and 5), we propose that the
functional status of K-Cl cotransporter(s) was affected. This is somewhat
surprising in that published reports on developing systems, as well as models
of injury, have associated a depolarized EIPSP with KCC2
expression levels only (Ehrlich et al.,
1999
; Kakazu et al.,
1999
; Rivera et al.,
1999
,
2002
;
Ganguly et al., 2001
;
Nabekura et al., 2002
).
Although there is little information on the regulation of KCC2 in neural
tissue, there is a broad literature on the functional modulation of other
cation-chloride cotransporter family members. In particular, the normal
physiology of KCC1 is closely linked to the cytoplasmic domains; removal of 8
C-terminal or 89 N-terminal amino acids can abolish function without affecting
surface expression of the protein in Xenopus oocytes
(Casula et al., 2001
). In
erythrocytes, KCC activation involves a dephosphorylation event, and Src
family kinases have been shown to negatively regulate K-Cl
cotransporter-activating phosphatases
(Jennings and Schulz, 1991
;
Lauf et al., 1992
;
Flatman et al., 1996
;
De Franceschi et al., 1997
).
In a related manner, potassium-chloride cotransport is regulated by protein
kinase G in vascular smooth muscle cells, although mRNA expression is not
affected (Adragna et al.,
2002
).
In contrast to the ubiquitously expressed KCC1, neuron-specific KCC2 has a
tyrosine phosphorylation consensus site
(Payne, 1997
), and a single
amino acid substitution is sufficient to reduce transporter activity in
oocytes (Strange et al.,
2000
). Furthermore, KCC2 function can be deactivated by
membrane-permeable protein tyrosine kinase inhibitors in cultured hippocampal
neurons (Kelsch et al., 2001
).
It has been suggested that PTK phosphorylation of KCC2 may be part of the
overall maturation of GABAergic synapses
(Kelsch et al., 2001).
Together, the findings from other systems suggest that deafness leads to an
alteration in the KCC2 phosphorylation state, possibly at the tyrosine
residue. This is supported by the finding that genistein can depolarize
EIPSC in control, but not deaf, neurons
(Fig. 3). Auditory-evoked
synaptic transmission in the IC could modulate KCC2 phosphorylation via many
receptor systems. One viable possibility is that afferent terminals contain
and release neurotrophins that elicit postsynaptic KCC2 phosphorylation.
Neurotrophin expression is observed in the developing rat IC, and the cognate
receptors for BDNF and neurotrophin-3 are expressed at the postsynaptic
junctions in gerbil (Hafidi et al.,
1996
; Hafidi,
1999
). Such a modulatory role would complement that long-lasting
effect of neurotrophins on KCC2 expression
(Rivera et al., 2002
;
Aguado et al., 2003
).
In summary, our results suggest that modulation of KCC2 physiology may help
to explain certain CNS pathologies, as well as the physiological set point of
normal inhibitory synapses (Golding and
Oertel, 1996
; Vardi et al.,
2000
, Kanaka et al.,
2001
; Ueno et al.,
2002
). This mechanism differs from the many cases in which KCC2
expression is modified. Although the activity-dependent modulation of KCC2 has
yet to be studied, it is known that NMDA receptor activation can stimulate an
NKCC cotransporter (Sun and Murali,
1998
). Therefore, it may be possible to restore inhibitory
synaptic strength by examining how KCC2 depends on ionotropic and metabotropic
signaling at the synapse.
 |
Footnotes
|
|---|
Received May. 23, 2003;
revised Jun. 23, 2003;
accepted Jun. 23, 2003.
This work was supported by National Institutes of Health Grant DC00540
(D.H.S.).
Correspondence should be addressed to Dr. Dan H. Sanes, Center for Neural
Science, 4 Washington Place, York University, New York, NY 10003. E-mail:
sanes{at}cns.nyu.edu.
Copyright © 2003 Society for Neuroscience
0270-6474/03/237516-09$15.00/0
 |
References
|
|---|
Adragna NC, Zhang J, Di Fulvio M, Lincoln TM, Lauf PK
(2002) KCl cotransport regulation and protein kinase G in
cultured vascular smooth muscle cells. J Membr Biol
187: 157-165.[Web of Science][Medline]
Aguado F, Carmona MA, Pozas E, Aguiló A,
Martiínez-Guijarro FJ, Alcantara S, Borrell V, Yuste R, Ibañez
CF, Soriano E (2003) BDNF regulates spontaneous correlated
activity at early developmental stages by increasing synaptogenesis and
expression of the K+/Cl- co-transporter KCC2.
Development 130:
1267-1280.[Abstract/Free Full Text]
Akiyama T, Ishida J, Nakagawa S, Ogawara H, Watanabe S, Itoh N,
Shibuya M, Fukami Y (1987) Genistein, a specific inhibitor of
tyrosine-specific protein kinases. J Biol Chem
262: 5592-5595.[Abstract/Free Full Text]
Bledsoe SC, Nagase S, Miller JM, Altschuler RA (1995)
Deafness-induced plasticity in the mature central auditory system.
NeuroReport 7:
225-229.[Web of Science][Medline]
Bormann J, Hamill OP, Sakmann B (1987) Mechanism of
anion permeation through channels gated by glycine and
-aminobutyric
acid in mouse cultured spinal neurones. J Physiol (Lond)
385: 243-286.[Abstract/Free Full Text]
Born DE, Rubel EW (1988) Afferent influences on brain
stem auditory nuclei of the chicken: presynaptic action potentials regulate
protein synthesis in nucleus magnocellularis neurons. J
Neurosci 8:
901-919.[Abstract]
Brand A, Behrend O, Marquardt T, McAlpine D, Grothe B
(2002) Precise inhibition is essential for microsecond interaural
time difference coding. Nature 417:
543-547.[Medline]
Carney LH (1999) Temporal response properties of
neurons in the auditory pathway. Curr Opin Neurobiol
9: 442-446.[Medline]
Casula S, Shmukler BE, Wilhelm S, Stuart-Tilley AK, Su W, Chernova
MN, Brugnara C, Alper SL (2001) A dominant negative mutant of the
KCC1 K-Cl cotransporter: both N- and C-terminal cytoplasmic domains are
required for K-Cl cotransport activity. J Biol Chem
276: 41870-41878.[Abstract/Free Full Text]
Clayton GH, Owens GC, Wolff JS, Smith RL (1998)
Ontogeny of cation-Cl- cotransporter expression in rat neocortex.
Brain Res Dev Brain Res 109:
281-292.[Medline]
Cohen I, Navarro V, Clemenceau S, Baulac M, Miles R
(2002) On the origin of interictal activity in human temporal
lobe epilepsy in vitro. Science
298: 1418-1421.[Abstract/Free Full Text]
DeFazio RA, Keros S, Quick MW, Hablitz JJ (2000)
Potassium-coupled chloride cotransport controls intracellular chloride in rat
neocortical pyramidal neurons. J Neurosci
20: 8069-8076.[Abstract/Free Full Text]
De Franceschi L, Fumagalli L, Olivieri O, Corrocher R, Lowell CA,
Berton G (1997) Deficiency of Src family kinases Fgr and Hck
results in activation of erythrocyte K/Cl cotransport. J Clin
Invest 99:
220-227.[Web of Science][Medline]
Deitch JS, Rubel EW (1984) Afferent influences on
brain stem auditory nuclei of the chicken: time course and specificity of
dendritic atrophy following deafferentation. J Comp Neurol
229: 66-79.[Web of Science][Medline]
Delpire E, Rauchman MI, Beier DR, Hebert SC, Gullans SR
(1994) Molecular cloning and chromosome localization of a
putative basolateral Na+-K+-2Cl-
cotransporter from mouse inner medullary collecting duct (mIMCD-3) cells.
J Biol Chem 269:
25677-25683.[Abstract/Free Full Text]
Durham D, Rubel EW (1985) Afferent influences on brain
stem auditory nuclei of the chicken: succinate dehydrogenase activity
following cochlea removal. J Comp Neurol
231: 446-456.[Web of Science][Medline]
Ehrlich I, Lohrke S, Friauf E (1999) Shift from
depolarizing to hyperpolarizing glycine action in rat auditory neurones is due
to age-dependent Cl- regulation. J Physiol (Lond)
520: 121-137.[Abstract/Free Full Text]
Flatman PW, Adragna NC, Lauf PK (1996) Role of protein
kinases in regulating sheep erythrocyte K+-Cl-
cotransport. Am J Physiol 271:
C255-C263.
Ganguly K, Schinder AF, Wong ST, Poo M (2001) GABA
itself promotes the developmental switch of neuronal GABAergic responses from
excitation to inhibition. Cell 105:
521-532.[Web of Science][Medline]
Gillen CM, Brill S, Payne JA, Forbush B (1996)
Molecular cloning and functional expression of the K-Cl cotransporter from
rabbit, rat and human. A new member of the cation-chloride cotransporter
family. J Biol Chem 271:
16237-16244.[Abstract/Free Full Text]
Gold JI, Knudsen EI (2000) Abnormal auditory
experience induces frequency-specific adjustments in unit tuning for binaural
localization cues in the optic tectum of juvenile owls. J
Neurosci 20:
862-877.[Abstract/Free Full Text]
Golding NL, Oertel D (1996) Context-dependent synaptic
action of glycinergic and GABAergic inputs in the dorsal cochlear nucleus.
J Neurosci 16:
2208-2219.[Abstract/Free Full Text]
Grothe B (1994) Interaction of excitation and
inhibition in processing of pure tone and amplitude-modulated stimuli in the
medial superior olive of the mustached bat. J Neurophysiol
71: 706-721.[Abstract/Free Full Text]
Hafidi A (1999) Distribution of BDNF, NT-3 and NT-4 in
the developing auditory brainstem. Int J Dev Neurosci
17: 285-294.[Web of Science][Medline]
Hafidi A, Moore T, Sanes DH (1996) Regional
distribution of neurotrophin receptors in the developing auditory brainstem.
J Comp Neurol 367:
454-464.[Web of Science][Medline]
Hashisaki GT, Rubel EW (1989) Effects of unilateral
cochlea removal on anteroventral cochlear nucleus neurons in developing
gerbils. J Comp Neurol 283:
465-473.[Web of Science]
Hübner CA, Stein V, Hermans-Borgmeyer I, Meyer T, Ballanyi K,
Jentsch TJ (2001) Disruption of KCC2 reveals an essential role of
K-Cl cotransport already in early synaptic inhibition. Neuron
30: 515-524.[Web of Science][Medline]
Hyson RL, Rubel EW (1989) Transneuronal regulation of
protein synthesis in the brain stem auditory system of the chick requires
synaptic activation. J Neurosci 9:
2835-2845.[Abstract]
Isenring P, Jacoby SC, Payne JA, Forbush B (1998)
Comparison of Na-K-Cl cotransporters. J Biol Chem
273: 11295-11301.[Abstract/Free Full Text]
Jennings ML, Schulz RK (1991) Okadaic acid inhibition
of KCl cotransport. Evidence that protein dephosphorylation is necessary for
activation of transport by either cell swelling or N-ethylmaleimide.
J Gen Physiol 97:
799-817.[Abstract/Free Full Text]
Kakazu Y, Akaike N, Komiyama S, Nabekura J (1999)
Regulation of intracellular chloride by cotransporters in developing lateral
superior olive neurons. J Neurosci 19:
2843-2851.[Abstract/Free Full Text]
Kakazu Y, Uchida S, Takashi N, Akaike N, Nabekura J
(2000) Reversibility and cation selectivity of the
K+-Cl- cotransport in rat central neurons. J
Neurophysiol 84:
281-288.[Abstract/Free Full Text]
Kanaka C, Ohno K, Okabe A, Kuriyama K, Itoh T, Fukuda A, Sato K
(2001) The differential expression patterns of messenger RNAs
encoding K-Cl cotransporters (KCC1, 2) and Na-K-2Cl cotransporter (NKCC1) in
the rat nervous system. Neuroscience
104: 933-946.[Web of Science][Medline]
Kelsch W, Hormuzdi S, Straube E, Lewen A, Monyer H, Misgeld U
(2001) Insulin-like growth factor 1 and a cytosolic tyrosine
kinase activate chloride outward transport during maturation of hippocampal
neurons. J Neurosci 21:
8339-8347.[Abstract/Free Full Text]
Kitzes LM, Semple MN (1985) Single-unit responses in
the inferior colliculus: effects of neonatal unilateral cochlear ablation.
J Neurophysiol 53:
1483-1500.[Abstract/Free Full Text]
Klinke R, Kral A, Heid S, Tillein J, Hartmann R (1999)
Recruitment of the auditory cortex in congenitally deaf cats by long-term
cochlear electro-stimulation. Science
285: 1729-1733.[Abstract/Free Full Text]
Klug A, Bauer EE, Hanson JT, Hurley L, Meitzen J, Pollak GD
(2002) Response selectivity for species-specific calls in the
inferior colliculus of Mexican free-tailed bats is generated by inhibition.
J Neurophysiol 88:
1941-1954.[Abstract/Free Full Text]
Kotak VC, Sanes DH (1996) Developmental influence of
glycinergic transmission: regulation of NMDA receptor-mediated EPSPs. J
Neurosci 16:
1836-1843.[Abstract/Free Full Text]
Kotak VC, DiMattina C, Sanes DH (2001)
GABAB and Trk receptor signaling mediates long-lasting inhibitory
synaptic depression. J Neurophysiol 86:
536-540.[Abstract/Free Full Text]
Kral A, Hartmann R, Tillein J, Heid S, Klinke R (2002)
Hearing after congenital deafness: central auditory plasticity and sensory
deprivation. Cereb Cortex 12:
797-807.[Abstract/Free Full Text]
Lauf PK, Bauer J, Adragna NC, Fujise H, Zade-Oppen AM, Ryu KH,
Delpire E (1992) Erythrocyte K+-Cl-
cotransport: properties and regulation. Am J Physiol
263: C917-C932.
Levi-Montalcini R (1949) The development of the
acoustico-vestibular centers in the chick embryo in the absence of the
afferent root fibers and of descending fiber tracts. J Comp
Neurol 91:
209-241.
Lu J, Karadhed M, Delpire E (1999) Developmental
regulation of the neuronal-specific isoform of K-Cl cotranspoter KCC2 in
postnatal rat brains. J Neurobiol 39:
558-568.[Web of Science][Medline]
McAlpine D, Martin RL, Mossop JE, Moore DR (1997)
Response properties of neurons in the inferior colliculus of the monaurally
deafened ferret to acoustic stimulation of the intact ear. J
Neurophysiol 78:
767-779.[Abstract/Free Full Text]
McMullen NT, Goldberger B, Suter CM, Glaser EM (1988)
Neonatal deafening alters non pyramidal dendrite orientation in auditory
cortex: a computer microscopic study in the rabbit. J Comp
Neurol 267:
92-106.[Web of Science][Medline]
Mossop JE, Wilson MJ, Caspary DM, Moore DR (2000)
Down-regulation of inhibition following unilateral deafening. Hear
Res 147:
183-187.[Web of Science][Medline]
Nabekura J, Ueno T, Okabe A, Furuta A, Iwaki T, Shimizu-Okabe C,
Fukuda A, Akaike N (2002) Reduction of KCC2 expression and
GABAA receptor-mediated excitation after in vivo axonal injury.
J Neurosci 22:
4412-4417.[Abstract/Free Full Text]
Owens DF, Boyce LH, Davis MB, Kriegstein AR (1996)
Excitatory GABA responses in embryonic and neonatal cortical slices
demonstrated by gramicidin perforated-patch recordings and calcium imaging.
J Neurosci 16:
6414-6423.[Abstract/Free Full Text]
Pallas SL, Littman T, Moore DR (1999) Cross-modal
reorganization of callosal connectivity without altering thalamocortical
projections. Proc Natl Acad Sci USA 96:
8751-8756.[Abstract/Free Full Text]
Parks TN (1981) Changes in the length and organization
of nucleus laminaris dendrites after unilateral otocyst ablation in chick
embryos. J Comp Neurol 202:
47-57.[Web of Science][Medline]
Payne JA (1997) Functional characterization of the
neuronal-specific K-Cl cotransporter: implications for
[K+]o regulation. Am J Physiol
273: C1516-C1525.
Payne JA, Stevenson TJ, Donaldson LF (1996) Molecular
characterization of a putative K-Cl cotransporter in rat brain. J Biol
Chem 27:
16245-16252.
Payne JA, Rivera C, Voipio J, Kaila K (2003)
Cation-chloride cotransporters in neuronal communication, development, and
trauma. Trends Neurosci 26:
199-206.[Web of Science][Medline]
Plotkin MD, Snyder EY, Hebert SC, Delpire E (1997)
Expression of the Na-K-2Cl cotransporter is developmentally regulated in
postnatal rat brains: a possible mechanism underlying GABA's excitatory role
in immature brain. J Neurobiol 33:
781-795.[Web of Science][Medline]
Pollak GD, Burger RM, Park TJ, Klug A, Bauer EE (2002)
Roles of inhibition for transforming binaural properties in the brainstem
auditory system. Hear Res 168:
60-78.[Web of Science][Medline]
Rajan R (1998) Receptor organ damage causes loss of
cortical surround inhibition without topographic map plasticity. Nat
Neurosci 1:
138-143.[Web of Science][Medline]
Rhee JS, Ebihara S, Akaike N (1994) Gramicidin
perforated patch-clamp technique reveals glycine-gated outward chloride
current in dissociated nucleus solitarii neurons of the rat. J
Neurophysiol 72:
1103-1108.[Abstract/Free Full Text]
Rivera C, Voipio J, Payne JA, Ruusuvuori E, Lahtinen H, Lamsa K,
Pirvola U, Saarma M, Kaila K (1999) The
K+/Cl- cotransporter KCC2 renders GABA hyperpolarizing
during neuronal maturation. Nature 397:
251-255.[Medline]
Rivera C, Li H, Thomas-Crusells J, Lahtinen H, Viitanen T,
Nanobashvili A, Kokaia Z, Airaksinen MS, Voipio J, Kaila K, Saarma M
(2002) BDNF-induced TrkB activation down-regulates the
K+-Cl- cotransporter KCC2 and impairs neuronal
Cl- extrusion. J Cell Biol
159: 747-752.[Abstract/Free Full Text]
Russell JM (2000) Sodium-potassium-chloride
cotransport. Physiol Rev 80:
211-276.[Abstract/Free Full Text]
Sanes DH, Markowitz S, Bernstein J, Wardlow J (1992)
The influence of inhibitory afferents on the development of postsynaptic
dendritic arbors. J Comp Neurol 321:
637-644.[Web of Science][Medline]
Sherman SM, Spear PD (1982) Organization of visual
pathways in normal and visually deprived cats. Physiol Rev
62: 738-855.[Free Full Text]
Strange K, Singer TD, Morrison R, Delpire E (2000)
Dependence of KCC2 K-Cl cotransporter activity on a conserved carboxy terminus
tyrosine residue. Am J Physiol 279:
C860-C867.[Web of Science]
Suga N, Zhang Y, Yan J (1997) Sharpening of frequency
tuning by inhibition in the thalamic auditory nucleus of the mustached bat.
J Neurophysiol 77:
2098-2114.[Abstract/Free Full Text]
Sun D, Murali SG (1998) Stimulation of
Na+-K+-2Cl- cotransporter in neuronal cells
by excitatory neurotransmitter glutamate. Am J Physiol
275: C772-C779.[Medline]
Syka J (2002) Plastic changes in the central auditory
system after hearing loss, restoration of function, and during learning.
Physiol Rev 82:
601-636.[Abstract/Free Full Text]
Thompson SM, Gahwiler BH (1989) Activity-dependent
disinhibition. II. Effects of extracellular potassium, furosemide, and
membrane potential on ECl- in hippocampal CA3 neurons. J
Neurophysiol 61:
512-523.[Abstract/Free Full Text]
Thompson SM, Deisz RA, Prince DA (1988) Outward
chloride cation cotransport in mammalian cortical neurons. Neurosci
Lett 89:
49-54.[Web of Science][Medline]
Ueno T, Okabe A, Akaike N, Fukuda A, Nabekura J (2002)
Diversity of neuron-specific K+-Cl- cotransporter
expression and inhibitory postsynaptic potential depression in rat
motoneurons. J Biol Chem 277:
4945-4950.[Abstract/Free Full Text]
Vale C, Sanes DH (2000) Afferent regulation of
inhibitory synaptic transmission in the developing auditory midbrain. J
Neurosci 20:
1912-1921.[Abstract/Free Full Text]
Vale C, Sanes DH (2002) The effect of bilateral
deafness on excitatory and inhibitory synaptic strength in the inferior
colliculus. Eur J Neurosci 16:
2394-2404.[Web of Science][Medline]
Vardi N, Zhang L-L, Payne JA, Sterling P (2000)
Evidence that different cation chloride cotransporters in retinal neurons
allow opposite responses to GABA. J Neurosci
20: 7657-7663.[Abstract/Free Full Text]
Wang J, Reichling DB, Kyrozis A, MacDermott AB (1994)
Developmental loss of GABA- and glycine-induced depolarization and
Ca2+ transients in embryonic rat dorsal horn neurons in culture.
Eur J Neurosci 6:
1275-1280.[Web of Science][Medline]
Webster DB, Webster M (1979) Effects of neonatal
conductive hearing loss on brain stem auditory nuclei. Ann Otol Rhinol
Laryngol 88:
684-688.[Web of Science][Medline]
Williams JR, Sharp JW, Kumari VG, Wilson M, Payne JA
(1999) The neuron-specific K-Cl cotransporter, KCC2. Antibody
development and initial characterization of the protein. J Biol
Chem 274:
12656-12664.[Abstract/Free Full Text]
This article has been cited by other articles:

|
 |

|
 |
 
E. C. Sarro, V. C. Kotak, D. H. Sanes, and C. Aoki
Hearing Loss Alters the Subcellular Distribution of Presynaptic GAD and Postsynaptic GABAA Receptors in the Auditory Cortex
Cereb Cortex,
December 1, 2008;
18(12):
2855 - 2867.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
Y. Lu, J. Zheng, L. Xiong, M. Zimmermann, and J. Yang
Spinal cord injury-induced attenuation of GABAergic inhibition in spinal dorsal horn circuits is associated with down-regulation of the chloride transporter KCC2 in rat
J. Physiol.,
December 1, 2008;
586(23):
5701 - 5715.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
V. C. Kotak, A. E. Takesian, and D. H. Sanes
Hearing Loss Prevents the Maturation of GABAergic Transmission in the Auditory Cortex
Cereb Cortex,
September 1, 2008;
18(9):
2098 - 2108.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
G. Huberfeld, L. Wittner, S. Clemenceau, M. Baulac, K. Kaila, R. Miles, and C. Rivera
Perturbed Chloride Homeostasis and GABAergic Signaling in Human Temporal Lobe Epilepsy
J. Neurosci.,
September 12, 2007;
27(37):
9866 - 9873.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
H. Xu, V. C. Kotak, and D. H. Sanes
Conductive Hearing Loss Disrupts Synaptic and Spike Adaptation in Developing Auditory Cortex
J. Neurosci.,
August 29, 2007;
27(35):
9417 - 9426.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
K. A. Razak and Z. M. Fuzessery
Development of Inhibitory Mechanisms Underlying Selectivity for the Rate and Direction of Frequency-Modulated Sweeps in the Auditory Cortex
J. Neurosci.,
February 14, 2007;
27(7):
1769 - 1781.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C. Jean-Xavier, J.-F. Pflieger, S. Liabeuf, and L. Vinay
Inhibitory Postsynaptic Potentials in Lumbar Motoneurons Remain Depolarizing After Neonatal Spinal Cord Transection in the Rat
J Neurophysiol,
November 1, 2006;
96(5):
2274 - 2281.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. L. Pallas, P. Wenner, C. Gonzalez-Islas, M. Fagiolini, K. A. Razak, G. Kim, D. Sanes, and B. Roerig
Developmental Plasticity of Inhibitory Circuitry
J. Neurosci.,
October 11, 2006;
26(41):
10358 - 10361.
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
P. Blaesse, I. Guillemin, J. Schindler, M. Schweizer, E. Delpire, L. Khiroug, E. Friauf, and H. G. Nothwang
Oligomerization of KCC2 Correlates with Development of Inhibitory Neurotransmission
J. Neurosci.,
October 11, 2006;
26(41):
10407 - 10419.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
B. Walmsley, A. Berntson, R. N. Leao, and R. E. W. Fyffe
Activity-dependent regulation of synaptic strength and neuronal excitability in central auditory pathways
J. Physiol.,
April 15, 2006;
572(2):
313 - 321.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
R. N. Leao, A. Berntson, I. D. Forsythe, and B. Walmsley
Reduced low-voltage activated K+ conductances and enhanced central excitability in a congenitally deaf (dn/dn) mouse
J. Physiol.,
August 15, 2004;
559(1):
25 - 33.
[Abstract]
[Full Text]
[PDF]
|
 |
|