 |
Previous Article | Next Article 
The Journal of Neuroscience, February 1, 2003, 23(3):816
D5 (Not D1) Dopamine Receptors Potentiate Burst-Firing in Neurons
of the Subthalamic Nucleus by Modulating an L-Type Calcium
Conductance
Jérôme
Baufreton1,
Maurice
Garret1,
Alicia
Rivera3,
Adélaïda
de la
Calle3,
François
Gonon2,
Bernard
Dufy1,
Bernard
Bioulac1, and
Anne
Taupignon1
1 Signalisation Normale et Pathologique, Unité
Mixte de Recherche 5543, and 2 Interactions Neuronales et
Comportement, Unité Mixte de Recherche 5541, Université
Victor Segalen, 33076 Bordeaux Cedex, France, and
3 Department of Cell Biology, Faculty of Sciences,
University of Malaga, Teatinos 29071, Malaga, Spain
 |
ABSTRACT |
Dopamine is a crucial factor in basal ganglia functioning. In
current models of basal ganglia, dopamine is postulated to act on
striatal neurons. However, it may also act on the subthalamic nucleus
(STN), a key nucleus in the basal ganglia circuit. The data presented
here were obtained in brain slices using whole-cell patch clamp. They
reveal that D5 dopamine receptors strengthen electrical activity in the
subset of subthalamic neurons endowed with burst-firing capacity,
resulting in longer discharges of spontaneous or evoked bursts.
To distinguish between D1 and D5 subtypes, the action of agonists in
the D1/D5 receptor family was first investigated on rat subthalamic
neurons. Single-cell reverse transcription-PCR profiling showed that
burst-competent neurons only expressed D5 receptors. Accordingly,
receptors localized in postsynaptic membranes within the STN were
labeled by a D5-specific antibody. Second, agonists in the D1/D5 family
were tested in mouse brain slices. It was found that these agonists
were active in D1 receptor knock-out mice in a similar way to wild-type
mice or rats. This proved that D5 rather than D1 receptors were
involved. Pharmacological tools (dihydropyridines, -conotoxins, and
calciseptine) were used to identify the target of D5 receptors as an
L-type channel. This was reached via G-protein and protein kinase A. The action of dopamine on D5 receptors therefore shapes neuronal
activity. It contributes to normal information processing in basal
ganglia outside striatum. This finding may be useful in drug therapy
for various disorders involving changes in STN activity, such as
Parkinson's disease and related disorders.
Key words:
dopamine; subthalamic nucleus; Parkinson's
disease; burst firing; plateau potential; D5 dopamine receptor
 |
Introduction |
Dopamine is the predominant
catecholamine neurotransmitter in the mammalian brain. It acts on five
receptor subtypes (D1-D5) whose genes have been characterized.
Structural studies show that D1-D5 receptor subtypes fall into two
receptor families: D2, D3, and D4 are classified as D2-like, and D1-D5
are classified as D1-like (Missale et al., 1998 ). The specific function
of many of these receptor subtypes is unknown, including in the
subthalamic nucleus (STN), a key structure in basal ganglia.
The basal ganglia process information relating to motor function. Tonic
dopamine release has a permissive role in movement. It gates the
locomotor loop that links the cortex to the thalamus through basal
ganglia. It has not been clearly established how dopamine controls the
output of basal ganglia. The STN is in a pivotal position because it
receives monosynaptic inputs from the cortex and directly excites the
basal ganglia output nuclei.
In current models of basal ganglia, dopamine is postulated to act in
the striatum, indirectly inhibiting STN firing activity by acting on D2
receptors. However, a growing number of experimental results do not fit
with this postulate (Kreiss et al., 1996 , 1997 ; Hassani and Feger,
1999 ; Mehta et al., 2000 ; Ni et al., 2001 ; Svenningsson and Le Moine,
2002 ). Furthermore, it is well established that dopaminergic terminals
and varicosities are found in the STN of rats, monkeys, and humans
(Brown et al., 1979 ; Hassani et al., 1997 ; Francois et al., 2000 ).
Dopamine receptor expression in the STN is far from being established.
mRNAs for various receptor subtypes have been reported, but there is no
agreement on which of the five subtypes are expressed in the
somatodendritic compartment (Flores et al., 1999 ; Augood et al., 2000 ;
Svenningsson and Le Moine, 2002 ). It is clearly necessary to identify
and understand the role of the dopamine receptors expressed in the STN.
The current models of basal ganglia represent output and input of the
component nuclei as firing rates. However, new experimental studies
imply that patterns of firing activity in the component nuclei
contribute critically to information processing (Allers et al., 2000 ;
Walters et al., 2000 ; Boraud et al., 2001 ; Magill et al., 2001 ; Raz et
al., 2001 ; Levy et al., 2002 ). Subthalamic neurons are endowed with
intrinsic properties enabling oscillatory activity. These neurons
display rhythmic burst-firing in vivo and in
vitro (Beurrier et al., 1999 ; Plenz and Kital, 1999 ; Awad et al.,
2000 ; Magill et al., 2000 , 2001 ; Baufreton et al., 2001 ), the function
of which is unknown.
We investigated the role of receptors in the D1 family. We showed how
they control an intrinsic L-type calcium conductance necessary for
subthalamic neurons to express bursts of firing in vitro.
Using reverse transcription (RT)-PCR profiling from single rat neurons
and slices from D1 receptor knock-out (KO) mice, we established that
only D5 receptors connected by G-proteins to protein kinase A are
involved. Our results provide the first direct demonstration that
dopamine acting on D5 receptors controls the activity of the STN in a
normal state.
 |
Materials and Methods |
Slice preparation. Experiments were performed on
subthalamic neurons in 400-µm-thick coronal slices obtained from 18- to 22-d-old Wistar rats. After cervical dislocation, the rats were
quickly decapitated. Their brains were rapidly removed, and a block of cerebral matter containing the STN was isolated in an ice-cold solution
containing (in mM): 250 sucrose, 26 NaHCO3, 7 MgCl2, 2 KCl,
1.15 NaH2PO4, 0.5 CaCl2, and 11 glucose, bubbled with 95% O2 and 5% CO2, pH 7.4. Three coronal slices containing the STN were prepared from one brain in
the same solution using a vibroslicer (Campden
Instruments, Loughborrough, UK). They were incubated at room
temperature in a Krebs' solution containing (in
mM): 124 NaCl, 26 NaHCO3,
3.6 KCl, 1.3 MgCl2, 2.4 CaCl2, 1.25 HEPES, and 10 glucose, pH 7.4, bubbled with 95% O2 and 5%
CO2, for a 2 hr recovery period.
Electrophysiological recordings. One slice was transferred
to an immersion-type recording chamber (Guerineau et al., 1997 ) and
superfused continuously (3.5 ml/min) with the oxygenated Krebs' solution. The slice was examined under a dissecting microscope; the STN
was readily identified as ovoid gray matter immediately dorsal to the
cerebral peduncle. Recordings were made using the blind patch-clamp
technique in the whole-cell configuration and in current-clamp mode.
Pipettes were filled with a solution containing (in
mM): 140 K-gluconate, 11 EGTA, 10 HEPES, 1 CaCl2, 2 ATP-Mg, and 0.4 Na-GTP. For some
experiments, pipettes were filled with 120 K-gluconate, 10 BAPTA, 10 HEPES, 0.3 CaCl2, 2 Mg-ATP, and 0.4 Na-GTP. In
both intrapipette solutions, free calcium was 16 nM, as calculated with Chelator software
(Stanford, CA). The osmolarity of the intrapipette solutions for
whole-cell recordings was between 280 and 300 mOsm, pH adjusted to
7.25. Electrodes were pulled from borosilicate thin-glass capillaries
(GC150F-15, Harvard Apparatus, Edenbridge, UK) on a
vertical puller (PP-830, Narishige, Tokyo, Japan) and had
a resistance of 10-12 M . Signals were recorded using an Axopatch-1D
amplifier (Axon Instruments, Foster City, CA) with the
amplifier filter set at 5 kHz. The signals were stored on a video tape
or digitized at 2.5-20 kHz using a Digidata 1200B. Access resistance
(~20 M ) was monitored regularly. Junction potentials were measured
according to the method described by Neher (1992) , and voltage errors
were corrected off-line.
APV (40 µM), CNQX (10 µM), and bicuculline
(10 µM) were perfused continuously to block rapid
synaptic transmission. Care was taken to avoid possible priming effects
(Lidow et al., 2001 ). All of our records came from naive neurons. Once
a slice had been perfused with any of the dopaminergic agonists listed
below, the slice was discarded, and experiments were performed on
another slice. SKF 81297, SKF 82958, and SKF 38393 were used. The two first drugs were used the most often, and the third was used only on a
few occasions. We found no qualitative difference in the action of the
three drugs. Possible quantitative differences between the three drugs
were not investigated. Unless stated otherwise, the term "D1
agonists" refers to these three drugs.
Drugs. Tetraethylammonium chloride (TEA), barium chloride,
choline chloride, BAPTA, nifedipine, BayK 8644, APV, GDP- -S,
and GTP- -S were purchased from Sigma (Saint Quentin
Fallavier, France); CNQX, SKF 81297, SKF 82958, and SCH 23390 were
purchased from RBI (Saint Quentin Fallavier, France). Bicuculline and
SKF 38393 were obtained from Tocris (Bristol, UK), and TTX
was purchased from Latoxan (Valence, FR). Calciseptine and
-conotoxins GVIA and MVIIC were obtained from Alomone Labs
(Jerusalem, Israel). All were prepared as stock solutions and stored at
80°C. When drugs were prepared in DMSO, the final dilution of the
solvent was always kept below 0.007. Drugs diluted in the oxygenated
Krebs' solution were delivered by means of a multibarrel gravity-feed system (HSSE-2, ALA Scientific Instruments, Sega
Electronique, Paris, France) composed of two capillaries positioned
just above the patch pipette, allowing up to seven solutions to be
tested successively.
Data analysis. Recordings were analyzed using pClamp 6.01 software (Axon Instruments), Origin 5.0 (Microcal, Northampton, MA), and Instat (GraphPad
Software, San Diego, CA). The duration and surface of plateau
potentials were measured from the end of the electrotonic response.
Plateau potentials differed from one neuron to another in rats as well
as mice. Each neuron served as both control and test. Plateau
potentials were always recorded first in control and then in the
presence of a D1 agonist. Percentage changes in duration, number of
action potentials, or surface of plateau potentials were calculated.
They were compared using the Wilcoxon matched-pairs signed ranks
test and the Mann-Whitney U test for paired and unpaired
values, respectively. In multiple comparisons of plateau potential, the
Kruskal-Wallis nonparametric test was used to estimate overall
significance. This was followed by two-by-two comparisons using the
Wilcoxon matched-pairs signed ranks test. Values of p < 0.05 were considered as significant. Box plots were used for graphic
presentation of the data because of the small sample sizes. The box
plot presents the distribution with the median as a central line. The
hinges and edges of the box display the 25th and 75th percentiles,
whereas the "whiskers" display the 5th and 95th percentiles. The
square represents the mean. In the results, values are given as
mean ± SE when means are close to medians. Otherwise, median
values are given
Single-cell RT-PCR procedures. In some experiments, the
cellular content was harvested for reverse transcription after the neurons were held in a whole-cell configuration for 5-20 min. Reverse
transcription and PCR were performed using protocols similar to those
described by Maurice et al. (2001) . The primers were taken from GenBank
rat receptor D1 (accession number M35077) and D5 (NM012768) sequences.
Sense primers were D1for1: AAGCAGCCTTCATCCTGATTAGC; D1for2:
GCATGGACTCTGTCTGTCCTTATA; D5for1: CCATCCTCATCTCCTTCATCCCG; and
D5for2: ACTCAATTGGCACAGAGACAAGG. Antisense primers were D1rev2: ACAGAAGGGCACCATACAGTTCG; D1rev3: GGAGCCAGCAGCACACAAACACC; D5rev1: CAGGATGAAGAAAGGCAACCAGC; and D5rev3: TGCAGAAAGGAACCATACAGTTC. A
two-stage amplification strategy was designed to detect low-abundance dopamine receptor mRNAs. In the first step, 10 µl of a single-cell template cDNA was amplified in a 50 µl PCR reaction mixture using 0.25 µM of D1 and D5 for1 and rev2 primers.
Twenty cycles were performed with 45 sec at 94°C, 45 sec at 60°C,
and 60 sec at 72°C. Then, a 1 µl aliquot of this PCR product was
used as a template for a second round of PCR amplification, with each
pair of specific nested primers (for2 and rev3). PCR amplification was
performed as described above with 35 cycles. PCR products were
sequenced and separated on a 2% agarose gel stained with ethidium
bromide. Control experiments were run with water instead of cDNA and
with cytoplasm samples processed as described above, except that
reverse transcriptase was omitted. No amplification products were found in control experiments (data not shown).
Immunohistochemistry. Five 21-d-old Wistar rats
(Charles River, L'Arbresle, France) were perfused
transcardially with 4% paraformaldehyde in a 0.1 M phosphate buffer, pH 7.4. Their brains were
then removed and postfixed in the same fixative for 2 hr at 4°C,
cryoprotected with a solution of phosphate-buffered sucrose (30%), and
frozen in dry ice. Coronal sections (30 µm thick) were cut with a
freezing microtome (CM 1325; Leica, Wetzlar, Germany) and
processed for immunochemistry. The antibody used here was raised
against a sequence specific to cloned rat D5 receptors. Its specificity
was established as described by Khan et al. (2000) . Incubation in
anti-D5 was performed for 72 hr at 4°C, followed by incubation in
biotinylated goat anti-rabbit IgG (1:500; Vector) and
peroxidase-conjugated streptavidin (1:2000; Sigma).
Reaction was developed with 0.05% DAB, 0.08% nickel ammonium sulfate,
and 0.02% H2O2. For
electron microscopy analysis, animals were perfused with 4%
paraformaldehyde and 0.1% glutaraldehyde. Immediately after fixation,
coronal sections (40 µm thick) were cut with a Vibratome (VT 1000M;
Leica) and processed for immunochemistry as described
above. After DAB reaction, sections were osmicated, dehydrated, and
flat embedded in Durpacan resin (Sigma). The
resin-embedded sections were cut into ultrathin sections on an
ultra-microtome (Reichert) and observed with a Philips
CM100 electron microscope.
Transgenic mice. Mice bearing a null mutation for D1
receptor (D1 / mice) have been generated by Drago et al. (1994) .
The D1 / mutant mice used here were produced by crossing
heterozygous males and females. D1 +/+ mice, referred to as wild-type,
were from the same litter as D1 / mice. The genotype of all mice was assessed by PCR. Slices from D19-D21 mice were prepared and used
in the same way as slices from rats.
 |
Results |
Postsynaptic D1 receptors potentiate spontaneous and
evoked burst-firing
We used SKF 82958 or SKF 81297 (3-5 µM) to activate
receptors in the D1 family. All experiments were performed in the
presence of blockers of fast synaptic transmission (APV, 40 µM; CNQX, 10 µM; bicuculline, 10 µM) to focus our study on postsynaptic effects alone,
without interference from possible presynaptic modulation of afferent
terminals. Whatever the agonist, the most striking effect of D1
receptor activation was potentiation of burst-firing. This was clearly
observed in spontaneously burst-firing neurons. Approximately one
subthalamic neuron in 10 displays spontaneous burst-firing in brain
slices, whether in cell-attached or whole-cell patch-clamp mode
(Beurrier et al., 1999 ; Baufreton et al., 2001 ). D1 agonists were
active on neurons in the whole-cell configuration (Fig.
1A) as well as on
intact neurons in the cell-attached configuration (Fig.
1B). They potentiated burst-firing by increasing the
burst duration by 70% (Fig. 1C). Mean burst duration was
2.1 ± 0.4 sec in control. This value was significantly lower than
in the presence of a D1 agonist (3.9 ± 1.0 sec; n = 8). A significant increase in the number of action potentials fired
per burst (+106%; 106 ± 38 vs 48 ± 17 in control;
n = 8) was also found in the same neuron sample. This
was caused by the increased burst duration, because the mean firing
frequency in the bursts did not change significantly (24 ± 4 vs
22 ± 4 Hz in control; n = 8). Conversely, a
significant decrease in burst frequency ( 36%; 0.09 ± 0.02 vs 0.15 ± 0.03 Hz; n = 8) was measured. Overall, the
mean firing frequency was barely changed (control: 5.3 ± 1.2; D1
agonist: 5.7 ± 1.8 Hz; n = 8).
Afterhyperpolarization was often more pronounced, but there was no
other effect on cell properties, including input resistance, spike
threshold, amplitude, or width (n = 15; data not
shown).

View larger version (24K):
[in this window]
[in a new window]
|
Figure 1.
Activation of receptors in the D1 family
strengthens spontaneous burst-firing. A, Representative
examples of spontaneous burst-firing in a subthalamic neuron. The
recording was made in the presence of synaptic transmission blockers
(APV, 40 µM; CNQX, 10 µM; bicuculline, 10 µM) for this experiment as with all others, and at zero
current level. Burst duration was notably increased during perfusion of
SKF 82958 (5 µM). B, Top,
The duration of spontaneous bursts recorded in the cell-attached
configuration is made longer by SKF 81297 (5 µM).
Calibration: 10 pA, 3 sec. Bottom, Representative bursts
on an expanded time scale. C, A box plot
summary of the changes in typical burst features with SKF 82958 or SKF
81297 (5 µM). The central line in the
box shows the distribution median. The
edges of the box are the interquartiles.
The lines running from the edge of the
box show the distribution extremes. The
square displays the mean. n, Number of
experiments.
|
|
Although burst-firing is displayed spontaneously by only a small
fraction of subthalamic neurons, a larger proportion of subthalamic neurons are nevertheless burst-competent. In vitro,
persistent burst-firing can be induced by activating group I
metabotropic glutamate receptors (Awad et al., 2000 ). This can also be
induced in approximately one neuron in two by continually injecting a small hyperpolarizing current (Fig.
2A). Burst-competent
neurons give specific responses, called plateau potentials, to short
current pulses given at hyperpolarized levels (Nakanishi et al., 1987 ; Beurrier et al., 1999 ; Bevan et al., 2000 , 2002 ; Baufreton et al.,
2001 ; Otsuka et al., 2001 ). These responses always outlast the stimuli
and resemble evoked bursts. The term "plateau potential" refers to
the long-lasting regenerative depolarization, which maintains the
membrane in the voltage range that allows firing of action potentials
at high frequency. Plateau potentials were significantly lengthened by
D1 agonists, in the same way as bursts. The median increase was +30%
for responses evoked by depolarizing (Fig. 2B) or
hyperpolarizing pulses (Fig. 2C). This resulted in a marked
increase in the number of spikes (median increase: +50%). Coapplication of an antagonist of D1-like receptors, SCH 23390 (10 µM), reversed these changes, indicating that
receptors in the D1 family were specifically activated. Because all of
these results were obtained with inhibitors of glutamatergic and
GABAergic receptors (Figs. 1, 2) and by direct intracellular
stimulation (Fig. 2), it can be concluded that presynaptic D1 receptors
were not involved.

View larger version (23K):
[in this window]
[in a new window]
|
Figure 2.
Action of agonists of receptors in the D1 family
on burst-competent neurons. A, Burst-competent neurons
switch from regular, single-spike firing mode at zero current level to
burst-firing with negative current injection. B,
C, Depolarizing or hyperpolarizing stimuli trigger
plateau potentials. The two regenerative discharges markedly outlast
the stimulus. They are potentiated by SKF 81297 (3 µM).
Potentiation is reversed by the D1-like receptor-specific antagonist,
SCH 23390 (10 µM).
|
|
Similar results were obtained in the vast majority of burst-competent
neurons tested (48 of 53). The other five neurons did not respond to
D1-like receptor activation. D1 agonists either were inactive on
neurons that only displayed tonic and regular discharge of single
spikes (n = 2) or induced an increase in firing frequency (n = 6) (data not shown). In no case
did any of the D1 agonists change regular, single-spike firing
into irregular or burst-firing.
Plateau potentials are lengthened by D1 agonists
Various mechanisms underlie plateau potentials, depending on the
neuronal type (Fraser and MacVicar, 1996 ; Mattia et al., 1997 ; Morisset
and Nagy, 1999 ; Brumberg et al., 2000 ; Alaburda et al., 2002 ). In the
STN, plateau potentials do not rely on fast sodium channels because the
underlying long-lasting regenerative depolarizations are TTX resistant
(Nakanishi et al., 1987 ; Beurrier et al., 1999 ; Otsuka et al., 2001 ).
By contrast, they are facilitated by the replacement of external
Ca2+ by Ba2+.
Indeed, plateau potentials have been shown to involve two types of
Ca2+-activated channels:
Ca2+-activated
K+ (KCa) channels
and Ca2+-activated nonspecific channels in
addition to Ca2+ channels (Beurrier et
al., 1999 ; Otsuka et al., 2001 ). In the presence of TTX (1 µM), and with Ba2+ as the
divalent charge carrier instead of Ca2+, a
short depolarizing pulse induced a large plateau potential (Fig.
3A, inset). Under
these conditions, D1 agonists (SKF 82958, SKF 81297, 3-5
µM) potentiated plateau potentials by
increasing their duration, as exemplified by the action of SKF 82958 (Fig. 3A). SKF 81297 at 1 µM was
active in the same way (data not shown). The values of depolarization
sustained in control and in the presence of the D1 agonists were not
significantly different. There was no change in resting potential. Full
action of D1 agonists, reached in ~3 min, resulted in a dramatic
increase of the plateau surface. On average, the surface of plateau
potentials increased by 150%. This increase specifically involved
receptors in the D1 family because it was fully blocked in all neurons
by coapplication of the D1 antagonist, SCH 23390, whereas coapplication
of raclopride, a D2-selective antagonist, had no effect (Fig.
3C).

View larger version (16K):
[in this window]
[in a new window]
|
Figure 3.
Agonists of receptors in the D1 family
increase the duration of the regenerative depolarization.
A, Superimposed records of plateau potentials in the
presence of TTX (1 µM) and with Ba2+
replacing Ca2+. Washing off of SKF 82958 partially
restored the surface of the plateau. The inset shows a
plateau potential recorded in normal Ringer's solution, in addition to
that recorded during bath perfusion of TTX, with
Ba2+ instead of Ca2+.
B, Time course of the action of D1-like agonists (SKF
81297 and 82958; 3-5 µM). The bar shows
the addition of agonists to bath perfusion. *Significantly different
from pretest values. C, The D1 receptor antagonist, SCH
23390, reversed the action of SKF 81297, whereas the selective D2
receptor antagonist, raclopride, had no effect, as illustrated by
representative traces of plateau potentials. Box plots
of the changes in the plateau potential surface induced by D1-like
agonists (3-5 µM) together with SCH 23390 (10 µM) or raclopride (5 µM) substantiate this
finding.
|
|
Ba2+ cannot replace
Ca2+ for activating calcium-activated
channels, whereas it has a greater current-carrying ability than
Ca2+ itself through
Ca2+ channels (Tsien et al., 1988 ; Gola
and Crest, 1993 ; Marrion and Tavalin, 1998 ). Our data therefore suggest
that the primary target of D1 receptors was not calcium-activated
channels but Ca2+ channels themselves. To
further support this view, we assayed the changes in plateau potential
induced by activating D1 receptors while we blocked
Ca2+-activated channels in two ways.
First, we inhibited ionic flux through the channels by using the
impermeant cation TEA (20 mM) to block
KCa channels or by replacing
Na+, the main charge carrier trough
Ca2+-activated nonspecific channels, by
impermeant choline ions. Second, we buffered intracellular
Ca2+ by chelating intracellular
Ca2+ ions by using a pipette medium
containing 10 mM BAPTA. As described previously (Beurrier
et al., 1999 ; Otsuka et al., 2001 ), the above procedures affected
plateau potentials, as expected from procedures interfering with
conductances involved in plateau potentials. However, D1 agonists still
increased plateau potential surface under any of these three conditions
(Fig.
4A,B).
These results strengthened the conclusion we drew from our experiments
with Ba2+ instead of
Ca2+, i.e., that the primary target of D1
receptors were Ca2+ channels.

View larger version (15K):
[in this window]
[in a new window]
|
Figure 4.
Calcium-activated channels are not involved in
potentiation of plateau potential. A, Activation of
receptors in the D1 family still increases plateau potential when free
cytosolic Ca2+ is heavily buffered by BAPTA (10 µM) in the intrapipette solution. TEA (20 mM)
and TTX (1 µM) were added to the recording solution.
B, Box plots present the changes in
plateau potential surface induced by D1 agonists (3-5
µM) in three experimental conditions designed to inhibit
Ca2+-activated channels: top, with 20 mM TEA in the perfusion solution, to block
calcium-activated potassium current; middle, with 10 mM BAPTA in the intrapipette medium; bottom,
with choline replacing Na+, to block
Ca2+-activated nonspecific channels, in addition to
TEA (20 mM).
|
|
D1 receptors target on L-type calcium channels
Subthalamic neurons have been shown to express the same wide
repertoire of Ca2+ channels as many other
neuronal preparations (Beurrier et al., 1999 ; Song et al., 2000 ). We
sought to distinguish which Ca2+ channel
subtype was involved in plateau potentiation by D1 receptors. Given the
time properties of subthalamic plateau potentials, T channels were
unlikely to play a role because one of their primary properties is
their fast steady-state inactivation. Accordingly, Ni2+ (40 µM), which inhibits
T channels, was found to have no effect on plateaus (data not shown).
By contrast, slowly or noninactivating Ca2+ channels such as L, N, P, or Q
channels were plausible candidates for generating and maintaining
plateau potentials.
To test this assumption, we first recorded plateau potentials while
perfusing nifedipine, a dihydropyridine that specifically binds to and
inhibits voltage-dependent L-type channels. These experiments were made
in the presence of TTX (1 µM) and TEA (20 mM). It must be remembered that D1 agonists augmented
plateau potential surface by 19% (median value) in this condition, as shown in Figure 4B. In all cases, nifedipine (3 µM) strongly reduced plateau potentials (Fig.
5A). Activating D1 receptors
by SKF 81297 did not reverse the inhibitory action of nifedipine. In
addition, when D1 receptors were first activated by SKF 81297, the
plateau potential increase was reversed by perfusing nifedipine (Fig. 5B). Plateau potentials were then potently inhibited by 6 µM nifedipine, so that on average, little
regenerative depolarization outlasted the electrotonic response to the
current pulse. Larger plateau potentials could not be evoked, even if
the amplitude or duration of stimuli increased. Nifedipine-sensitive
Ca2+ channels are also sensitive to other
dihydropyridines, such as BayK 8644, which stabilize them in an open
state. BayK 8644 (5 µM) strongly potentiated
plateau potentials, the median surface of which increased by 60% (Fig.
5). Moreover, SKF 81297 failed to increase plateau potential surface in
the presence of BayK 8644, as illustrated in Figure 5C.

View larger version (39K):
[in this window]
[in a new window]
|
Figure 5.
Potentiation of plateau potential involves L-type
calcium channels. A, Time course of the action of the
dihydropyridine, L-type channel antagonist, nifedipine. Nifedipine
prevented the action of SKF 81297. The inset displays
superimposed sample traces taken from positions
1-3. Calibration: 10 mV, 500 msec. TEA
(20 mM) and TTX (1 µM) were present.
B, The increase in the surface of plateau potential by
SKF 81297 (3-5 µM) is reversed by perfusion of
nifedipine. Note that nifedipine (6 µM) abolishes the
plateau potential. Inset, Superimposed
traces taken from positions 1-3.
Calibration: 10 mV, 500 msec. C, The dihydropyridine,
L-type channel agonist, BayK 8644, occluded the effect of SKF 81297, as
illustrated by representative traces of plateau
potentials obtained successively in control, during perfusion of BayK
8644 alone, and during perfusion of BayK 8644 with SKF 81297. Box plots summarize the changes in the surface of
plateau potential induced by BayK 8644 and by nifedipine (data from
A and B). D, Coapplication
of N- and P/Q-type calcium channel blockers, -conotoxin MVIIC (250 nM) and -conotoxin GVIA (500 nM), reduced
plateau potential. However, addition of 3 µM SKF 81297 in
presence of both toxins significantly increased plateau potential
(trace 3), indicating that N- and P/Q-type
Ca2+ channels were not involved. Perfusion of
calciseptine (200 nM), a specific L-type channel
antagonist, occluded the action of SKF 81297 and abolished the plateau
potential (trace 4). Box charts
summarize the results from several tests (*significant at
p < 0.05).
|
|
Second, we used two toxins, -conotoxin GVIA and -conotoxin MCIIV,
which bind with high affinity to N (Cav2.2) and P/Q (Cav2.1) channels,
respectively, to assess a possible complementary involvement of these
two channel subtypes in potentiation of plateau potential. By contrast
to nifedipine, -conotoxin GVIA (500 nM) and
-conotoxin MCIIV (250 nM) did not inhibit plateau
potentials to a large extent (Fig. 5D). The coapplication of
the two toxins reduced their median surface by only 45%, indicating
that although N and P/Q channels contributed to plateau potentials in
addition to L channels, their involvement was not decisive.
Accordingly, in the presence of the two -conotoxins, activation of
D1 receptors was still effective. On average, SKF 81297 induced a
significant increase (45%) in plateau potential surface in the
presence of the two toxins. This value was not significantly different
from that obtained without blocking the N and P channels
(p > 0.05; median value: +22% with the two
-conotoxins vs +19% in control).
We finally explored the action of calciseptine, a novel L-type
Ca2+ channel blocker that specifically
binds to L-type Ca2+ channels with high
specificity (De Weille et al., 1991 ; Hernandez-Lopez et al., 1997 ). As
with nifedipine, calciceptine (200 nM) not only reversed
the action of SKF 81297, but also powerfully inhibited plateau
potentials (Fig. 5D). In a similar way to nifedipine, calciceptine retained little of the depolarization outlasting the stimulus.
In summary, activating D1 receptors resulted in marked changes in
plateau potential surface under all conditions, except with the three
drugs that specifically bond voltage-dependent L-type Ca2+ channels, i.e., with nifedipine,
calciceptine, and BayK 8644. Potentiation of plateau potentials
therefore crucially relies on L-type Ca2+
channels. BayK 8644 can be seen as defining the upper limit of the
possible increase in plateau potential by D1 receptors, whereas nifedipine and calciceptine demonstrate that no plateau potential can
be produced if L-type Ca2+ channels are
blocked. Taken together, our results indicate that L-type
Ca2+ channels are (1) necessary for
plateau potential generation, (2) sufficient for its maintenance, and
(3) the primary target of D1 receptors.
D5 (not D1) receptors are involved in burst potentiation
D5 receptors have a high homology with D1 receptors. There are
currently no drugs to discriminate between D1-class receptors. The
response described above could thus be mediated by either of the D1 and
D5 receptor subtypes. To determine which of them was responsible for
the potentiation of burst-firing, whole-cell recordings were followed
by single-cell reverse transcription (scRT)-PCR analysis. D1 and D5
receptor mRNAs were probed by scRT-PCR from subthalamic neurons showing
a robust potentiation of plateau potential when challenged with SKF
81297. Figure 6A
(left) shows the response to SKF 81297 and the scRT-PCR
amplicons from a subthalamic neuron. When RT-PCR analysis was limited
to mRNAs of a single subthalamic neuron, only the D5 isoform was
detected. This was true for all of the nine neurons that were tested.
However, mRNAs of the two isoforms were detected from whole-brain
tissue (Fig. 6A, right panel).

View larger version (123K):
[in this window]
[in a new window]
|
Figure 6.
Expression of D5 receptor in subthalamic neurons.
A, Left, Sample records of plateau
potentials and PCR amplicons from an SKF 81297-sensitive,
burst-competent neuron. Right, RT-PCR products obtained
from whole-brain RNA extract. D5 receptor mRNA was only detected by
single cell-RT PCR amplification, whereas both D1 and D5 receptor mRNAs
were detected from whole-brain tissue. Ethidium bromide-stained
products of RT-PCR amplifications were resolved by electrophoresis. The
positions of standard nucleotide bands of molecular weight markers
(M) are indicated to the
right of the gels. B, Dopamine D5
receptor immunoperoxidase staining of a coronal section of rat brain
shows immunoreactivity in many neuronal cell bodies within the STN.
C, Electron micrograph revealing labeling of D5
receptors (top arrow) in a dendrite
(d) making asymmetric synapse
(arrowheads) with an axon (a).
Labeling (bottom arrows) is also associated with
microtubules and endoplasmic reticulum. Scale bars: B,
200 µm; C, 500 nm.
|
|
We then looked for the D5 protein in the STN from rats of the same
strain and age as those used for our patch-clamp and scRT-PCR work. We
used an antibody raised against a peptide sequence of cloned D5
receptor, the specificity of which was established by Khan et al.
(2000) . Immunoreactivity was detected in the cell bodies (Fig.
6B) using light microscopy. Using electron microscopy (Fig. 6C), immunoreactivity was located mainly in
postsynaptic structures. Labeling was generally found in dendrites and
was associated with endoplasmic reticulum and microtubules. D5
immunolabeling in the inner layer of the plasma membrane was generally
associated with asymmetric synapses.
Both sets of data suggested that potentiation of burst-firing was
mediated by D5 rather than D1 receptors. To test this possibility directly, we examined whether potentiation of plateau potential was
still produced by D1-class agonists in D1 receptor KO mice. First, we
checked that subthalamic neurons in slices from wild-type mice had the
same specific properties as neurons from rats, i.e., that they showed
regular, single-spike, and burst-firing patterns, because there are no
data on electrical activity of subthalamic neurons in slices from mice.
As shown in Figure 7A, we
found that most neurons from mice fired single, regular spikes (five of
nine). Of these, 11% (one of nine) were able to switch to sustained
burst-firing when hyperpolarized by a few millivolts, as described for
rat neurons, whereas 62% (13 of 21) displayed plateau potentials. Cell
and firing properties of neurons from wild-type mice are summarized in
Table 1. Neurons from D1 receptor null
mice had essentially the same properties (Table 1). Furthermore,
activation of D1 receptors by SKF 81297 (3 µM)
in slices from D1 / mice did potentiate plateau potentials (Fig.
7B). The median surface of plateau potential was increased by 20% in
the D1 KO mice, whereas this increased by 25% in the wild-type mice,
the difference being nonsignificant (Mann-Whitney; n = 5). This result establishes that potentiation of plateau potential does
not rely on D1 receptors but does rely on D5 receptors.

View larger version (21K):
[in this window]
[in a new window]
|
Figure 7.
Potentiation of plateau potential is caused by D5,
not D1, receptors. A, Mouse subthalamic burst-competent
neurons display firing properties similar to that of rat neurons.
Burst-firing is induced by injecting a negative current. Depolarizing
(+80 pA; 200 msec) and hyperpolarizing ( 80 pA, 1 sec) stimuli produce
long-lasting plateau potential and postinhibitory rebound burst,
respectively. B, Sample records of plateau potentials
from mouse neurons in the presence of TTX (1 µM) and TEA
(20 mM). Wild-type and D1 receptor null mutant (D1 / )
mice displayed strong plateau potentials when stimulated by short
current pulses (+80 pA, 200 msec). The agonist of receptors in the D1
family, SKF 81297 (3-5 µM), was active in neurons from
the D1 / mice as well as in neurons from wild-type mice. The
increase in surface of the plateau potential measured in D1 / mice
was not significantly different (p = 0.99;
Mann-Whitney U test) from that measured in their
wild-type counterpart, as summarized by the box
plots.
|
|
Protein kinase A as a transduction pathway for D1-like, presumably
D5, receptors in the STN
Very little is known regarding the transduction pathways
specifically activated by D5 receptors, except those explored in recombinant systems. In such systems, activation of D5 receptors often
leads to elevation of cAMP through a cascade initiated by several
G-proteins (Sidhu, 1998 ; Wang et al., 2001 ). If the potentiation of
plateau potentials by D1-like agonists is mediated by the same cascade,
analogs of GTP should mimic the receptor-driven potentiation, whereas
inhibitors of protein kinase A (PKA), the major cellular target of
cAMP, should prevent receptor-driven potentiation. To test this
hypothesis, GTP- -S was included in the intrapipette solution. As
shown in Figure 8A,
GTP- -S (100 µM) always potentiated plateau
potentials (n = 3). In keeping with this result,
GDP- -S (100 µM) reduced the plateau
potentials. The membrane-permeant PKA inhibitor H-89 and the cAMP
analog 8-bromo-cAMP were used to determine whether the cellular effects
of the D1 agonists were mediated by PKA. Application of H-89 (1-3
µM) per se significantly reduced the surface of
plateau potentials. H-89 prevented the response to SKF 81297 (3 µM) (Fig. 8B), because there
was no significant difference in plateau potential surface with or
without SKF 81297. Median values of changes were 26% in both
instances. By contrast, application of 8-bromo-cAMP alone increased the
plateau potential surface by 40%.

View larger version (33K):
[in this window]
[in a new window]
|
Figure 8.
G-protein and protein kinase A are involved in the
action of D1-like, presumably D5, receptor. A, Time
course of changes in plateau potential surface during recording with a
pipette medium containing GTP- -S and GDP- -S. The sample records
1, 2, and 3 were taken at
the beginning and after 6 and 11 min of perfusion, respectively.
B, Representative examples and time course of changes in
plateau potential during perfusion of a membrane-permeant antagonist of
protein kinase A, H-89 (1-3 µM). Addition of SKF 81297 (3 µM) failed to increase plateau potential. Perfusion of
the membrane-permeant cAMP analog, 8-bromo-cAMP (10 µM),
per se potentiated plateau potentials. Box plots
summarize the results of the trials with H-89 and 8-bromo-cAMP.
|
|
 |
Discussion |
Our results show that subthalamic burst-competent neurons have
functional postsynaptic receptors in the D1 family. They establish that
these receptors control a Ca2+ conductance
that is necessary for neurons to express burst-firing. Because D5
receptors are expressed in the STN and the
Ca2+ conductance is controlled in a
similar way in D1 receptor null mice, our data provide the first
evidence supporting the possibility that dopamine acting on D5
receptors contributes to shaping firing pattern.
Functional D5 receptors in subthalamic neurons
The continued lack of subtype-selective ligands limits our
understanding of the respective role of D1 and D5 receptors. There are
many discrepancies among autoradiographic studies on the distribution of D1-like receptors in the basal ganglia outside striatum. mRNA encoding D5 receptor has been probed in only one in situ
hybridization study. This found a high level of D5 receptor mRNA in the
STN, whereas mRNA levels for the other dopamine receptors, including D1
receptor, were underneath detection level (Svenningsson and Le Moine,
2002 ). Accordingly, several in situ hybridization studies have failed to detect D1 receptor mRNA in rat or human STN (Boyson et
al., 1986 ; Fremeau et al., 1991 ; Augood et al., 2000 ). These results
agree with our single-cell profiling. In no case was D1 receptor mRNA
amplified from cytoplasm harvested from burst-competent neurons,
whereas mRNA of D5 receptor was detected in the same cytoplasm samples.
The expression profile of D5 receptor in rat, monkey, and human brains
has been reappraised recently using highly selective antibodies raised
against a peptide sequence of cloned receptor (Ciliax et al., 2000 ;
Khan et al., 2000 ). Numerous neurons were markedly labeled within the
STN, as confirmed in our study of the STN from rat pups of the same age
and strain as that used for our patch-clamp work. In addition, at the
subcellular level, D5 receptors were visualized in the soma or
dendritic processes of neurons. In the absence of specific agonists
able to discriminate between D1 and D5 receptors, D1 receptor null
mutant mice offer an alternative approach. We found that burst-firing
of subthalamic neurons from D1 / mice was potentiated by D1
agonists in the same way as that of neurons from wild-type mice and
rats. This establishes that functional D5 (not D1) receptors were being
activated in burst-competent neurons. Taken together with the
aforementioned studies, our results suggest that subthalamic neurons
express D5 but not D1 receptor subtype.
Oscillatory firing pattern is strengthened by D5 receptors
Spontaneous bursts and evoked plateau potentials are caused by the
same Ca2+ and
Ca2+-activated conductances (Beurrier et
al., 1999 ; Otsuka et al., 2001 ). Activation of D5 receptors led to
potentiation of these two types of action potential regenerative
discharges. This activation did not affect the membrane potential,
contrary to activation of group I metabotropic glutamate receptors
(Awad et al., 2000 ); however, it did increase the duration of the
discharge. Using dihydropyridines in addition to specific toxins, we
established that the increase in duration was prevented only when
L-type channels were blocked but not when N, P, and Q channels were
inhibited. It can thus be concluded that D1 agonists increased
Ca2+ current by L-type channels. The
effect of D1 agonists was mimicked by activators of G-proteins. It was
also mimicked by a membrane-permeant analog of cAMP, whereas it was
blocked when protein kinase A was inhibited, suggesting that it
involved the activation of at least adenylate cyclase, as generally
found for D1-like receptors. Interestingly, inhibition of adenylate
cyclase per se reduced the plateau potentials, suggesting that native
D5 receptors have a constitutive action in the absence of ligand as
recombinant receptors do (Tiberi and Caron, 1994 ; Charpentier et al.,
1996 ; Demchyshyn et al., 2000 ). Gating of L-type channels is sensitive
to phosphorylation (Catterall, 2000 ). It can therefore be assumed that
bursts and plateaus were made more robust because of an increased
phosphorylation of L-type channels by protein kinase A.
In vivo, burst-firing is found in the STN in the normal
state, although it is found much more frequently in the
depleted-dopamine state (Bergman et al., 1994 ; Magill et al., 2001 ; Ni
et al., 2001 ; Levy et al., 2002 ). This raises the question of its
involvement in the function of the STN. Our data suggest that
burst-firing per se is not a marker of function impairment in the STN
because it is strengthened by dopaminergic agonists in neurons from
normal animals. It has been proposed that burst-firing relies on
intrinsic membrane properties (Beurrier et al., 1999 ). Alternatively,
burst-firing may be attributable to synaptic properties in the basal
ganglia network (Plenz and Kital, 1999 ; Magill et al., 2001 ; Terman et al., 2002 ). In any case, our results predict significant control of
burst-firing by D5 receptors in the normal state because we show that
not only persistent burst-firing but also plateau potentials are
potentiated. Therefore, the postinhibitory rebound responses evoked by
stimulation of GABAergic terminals (Bevan et al., 2002 ; Terman et al.,
2002 ) and the long-lasting regenerative responses to stimulation of
excitatory terminals (Otsuka et al., 2001 ) will last longer. We suggest
that this will markedly affect information processing in the
subthalamopallidal network and the impact of inputs from the cortex.
Dopamine acts outside striatum in basal ganglia
Patch-clamp studies in rat brain slices have established the
presence of presynaptic and postsynaptic receptors in the D2 family on
subthalamic neurons. Activation of presynaptic receptors reduced the
impact of the main two inputs of the STN, cortex, and globus pallidus
(Shen and Johnson, 2000 ). The postsynaptic receptors reduced intrinsic
K+ conductance. This resulted in increased
frequency of regular, single-spike firing (Zhu et al., 2002 ). We now
present evidence that postsynaptic D5 receptors are expressed in
the STN and control burst-firing. Dopamine action in the STN is thus
two-faceted. On one hand, its presynaptic receptors reinforce the
filter role of the STN. On the other hand, its postsynaptic receptors
make the two intrinsic firing modes (single-spike, burst-firing) more distinct; however, another major factor has yet to be defined. No data
are available on the modulation of GABA and glutamate receptors in the
STN by postsynaptic receptors in the D1 family. Specific modulation of
fast synaptic transmission by D1 and D5 receptor subtypes has been
described in many other parts of the brain (Radnikow and Misgeld, 1998 ;
Brunig et al., 1999 ; Chergui and Lacey, 1999 ; Flores-Hernandez et al.,
2000 ; Liu et al., 2000 ; Kerr and Wickens, 2001 ; Seamans et al., 2001 ).
It also presumably takes place in the STN. Identification and
subcellular localization of the dopamine receptor subtypes expressed in
the STN are clearly required to shed light on the origin of various
motor impairments produced in animals when dopamine agonists or
antagonists with various specificities and efficacies are infused
locally in the STN. The discovery that D1 agonists locally infused in
the STN induce dyskinesia is of particular interest, however, because this action is potentiated in an animal model of Parkinson's disease (Mehta et al., 2000 ).
Functional implications
The main treatment for symptoms of Parkinson's disease is
dopamine replacement therapy. Unfortunately, after the "honeymoon period" of effective response to L-DOPA, long-term
side effects develop. These affect ~50% of all patients within 5 years of therapy. Undesirable effects include disabling dyskinesias. It
has been proposed that L-DOPA-induced dyskinesias
represents a form of pathological learning caused by chronic pulsatile
(nonphysiological) stimulation of D1 receptors by short-lived
L-DOPA, which activates a cascade of molecular and
biochemical events (Calon et al., 2000 ). On the other hand, deep brain
stimulation of the STN also provides anti-Parkinsonian benefits.
Interestingly, this is accompanied by a reduction of
L-DOPA-related motor complications and an attenuation of
the short-duration motor response to an L-DOPA challenge
(Limousin et al., 1998 ; Bejjani et al., 2000 ; Fraix et al., 2000 ). This suggests that in addition to the primary defect in dopaminergic tone,
downstream mechanisms also contribute to aggravating the disease. The
progressive decrease of dopamine during the asymptomatic progression of
the disease and the pulsatile L-DOPA levels during treatment entail long-term changes in the expression of crucial proteins in the D1 transduction pathway in the striatum (Andersson et
al., 2001 ; Westin et al., 2001 ; Gerfen et al., 2002 ). This may also
hold true outside the striatum. Therefore, it may be very useful to
look for dopaminergic agents acting on specific D1 receptor subtypes
outside the striatum. Given the pivotal position of the STN in basal
ganglia, we suggest that selective action on the D5 receptor subtype
might lead to better-targeted drug therapy for dopamine-linked disorders.
 |
FOOTNOTES |
Received Aug. 22, 2002; revised Nov. 7, 2002; accepted Nov. 13, 2002.
This work was funded by the Centre de la Recherche Scientifique,
Bordeaux 2 University, and the Aquitaine Regional Council, as well as
Manchester Innovation Ltd. J.B. received a doctoral fellowship from the
Aquitaine Region. We thank Dr. J. Drago (Monash University) for
allowing us to use the D1 receptor null mice that he generated, as well
as M. Leguet and M. C. Fournier, who bred and genotyped them. We
also thank Dr. F. Nagy (Bordeaux 2 University) for his help with the
analysis of plateau potentials and Dr. M. Bevan (University of
Tennessee) for his helpful suggestions.
Correspondence should be addressed to Anne I. Taupignon, Unité
Mixte de Recherche 5543, Université Victor Segalen, 146 rue Saignat, 33076 Bordeaux Cedex, France. E-mail:
anne.taupignon{at}umr5543.u-bordeaux2.fr.
 |
References |
-
Alaburda A,
Perrier JF,
Hounsgaard J
(2002)
Mechanisms causing plateau potentials in spinal motoneurones.
Adv Exp Med Biol
508:219-226[Web of Science][Medline].
-
Allers KA,
Kreiss DS,
Walters JR
(2000)
Multisecond oscillations in the subthalamic nucleus: effects of apomorphine and dopamine cell lesion.
Synapse
38:38-50[Web of Science][Medline].
-
Andersson M,
Konradi C,
Cenci MA
(2001)
cAMP response element-binding protein is required for dopamine-dependent gene expression in the intact but not the dopamine-denervated striatum.
J Neurosci
21:9930-9943[Abstract/Free Full Text].
-
Augood SJ,
Hollingsworth ZR,
Standaert DG,
Emson PC,
Penney Jr JB
(2000)
Localization of dopaminergic markers in the human subthalamic nucleus.
J Comp Neurol
421:247-255[Web of Science][Medline].
-
Awad H,
Hubert GW,
Smith Y,
Levey AI,
Conn PJ
(2000)
Activation of metabotropic glutamate receptor 5 has direct excitatory effects and potentiates NMDA receptor currents in neurons of the subthalamic nucleus.
J Neurosci
20:7871-7879[Abstract/Free Full Text].
-
Baufreton J,
Garret M,
Dovero S,
Dufy B,
Bioulac B,
Taupignon A
(2001)
Activation of GABA(A) receptors in subthalamic neurons in vitro: properties of native receptors and inhibition mechanisms.
J Neurophysiol
86:75-85[Abstract/Free Full Text].
-
Bejjani BP,
Arnulf I,
Demeret S,
Damier P,
Bonnet AM,
Houeto JL,
Agid Y
(2000)
Levodopa-induced dyskinesias in Parkinson's disease: is sensitization reversible?
Ann Neurol
47:655-658[Web of Science][Medline].
-
Bergman H,
Wichmann T,
Karmon B,
DeLong MR
(1994)
The primate subthalamic nucleus. II. Neuronal activity in the MPTP model of parkinsonism.
J Neurophysiol
72:507-520[Abstract/Free Full Text].
-
Beurrier C,
Congar P,
Bioulac B,
Hammond C
(1999)
Subthalamic nucleus neurons switch from single-spike activity to burst-firing mode.
J Neurosci
19:599-609[Abstract/Free Full Text].
-
Bevan MD,
Wilson CJ,
Bolam JP,
Magill PJ
(2000)
Equilibrium potential of GABA(A) current and implications for rebound burst firing in rat subthalamic neurons in vitro.
J Neurophysiol
83:3169-3172[Abstract/Free Full Text].
-
Bevan MD,
Magill PJ,
Hallworth NE,
Bolam JP,
Wilson CJ
(2002)
Regulation of the timing and pattern of action potential generation in rat subthalamic neurons in vitro by GABA-A IPSPs.
J Neurophysiol
87:1348-1362[Abstract/Free Full Text].
-
Boraud T,
Bezard E,
Bioulac B,
Gross CE
(2001)
Dopamine agonist-induced dyskinesias are correlated to both firing pattern and frequency alterations of pallidal neurones in the MPTP-treated monkey.
Brain
124:546-557[Abstract/Free Full Text].
-
Boyson SJ,
McGonigle P,
Molinoff PB
(1986)
Quantitative autoradiographic localization of the D1 and D2 subtypes of dopamine receptors in rat brain.
J Neurosci
6:3177-3188[Abstract].
-
Brown LL,
Markman MH,
Wolfson LI,
Dvorkin B,
Warner C,
Katzman R
(1979)
A direct role of dopamine in the rat subthalamic nucleus and an adjacent intrapeduncular area.
Science
206:1416-1418[Abstract/Free Full Text].
-
Brumberg JC,
Nowak LG,
McCormick DA
(2000)
Ionic mechanisms underlying repetitive high-frequency burst firing in supragranular cortical neurons.
J Neurosci
20:4829-4843[Abstract/Free Full Text].
-
Brunig I,
Sommer M,
Hatt H,
Bormann J
(1999)
Dopamine receptor subtypes modulate olfactory bulb gamma-aminobutyric acid type A receptors.
Proc Natl Acad Sci USA
96:2456-2460[Abstract/Free Full Text].
-
Calon F,
Hadj TA,
Blanchet PJ,
Morissette M,
Grondin R,
Goulet M,
Doucet JP,
Robertson GS,
Nestler E,
Di Paolo T,
Bedard PJ
(2000)
Dopamine-receptor stimulation: biobehavioral and biochemical consequences.
Trends Neurosci
23:S92-100[Web of Science][Medline].
-
Catterall WA
(2000)
Structure and regulation of voltage-gated Ca2+ channels.
Annu Rev Cell Dev Biol
16:521-555[Web of Science][Medline].
-
Charpentier S,
Jarvie KR,
Severynse DM,
Caron MG,
Tiberi M
(1996)
Silencing of the constitutive activity of the dopamine D1B receptor. Reciprocal mutations between D1 receptor subtypes delineate residues underlying activation properties.
J Biol Chem
271:28071-28076[Abstract/Free Full Text].
-
Chergui K,
Lacey MG
(1999)
Modulation by dopamine D1-like receptors of synaptic transmission and NMDA receptors in rat nucleus accumbens is attenuated by the protein kinase C inhibitor Ro 32-0432.
Neuropharmacology
38:223-231[Web of Science][Medline].
-
Ciliax BJ,
Nash N,
Heilman C,
Sunahara R,
Hartney A,
Tiberi M,
Rye DB,
Caron MG,
Niznik HB,
Levey AI
(2000)
Dopamine D(5) receptor immunolocalization in rat and monkey brain.
Synapse
37:125-145[Web of Science][Medline].
-
Demchyshyn LL,
McConkey F,
Niznik HB
(2000)
Dopamine D5 receptor agonist high affinity and constitutive activity profile conferred by carboxyl-terminal tail sequence.
J Biol Chem
275:23446-23455[Abstract/Free Full Text].
-
De Weille JR,
Schweitz H,
Maes P,
Tartar A,
Lazdunski M
(1991)
Calciseptine, a peptide isolated from black mamba venom, is a specific blocker of the L-type calcium channel.
Proc Natl Acad Sci USA
88:2437-2440[Abstract/Free Full Text].
-
Drago J,
Gerfen CR,
Lachowicz JE,
Steiner H,
Hollon TR,
Love PE,
Ooi GT,
Grinberg A,
Lee EJ,
Huang SP
(1994)
Altered striatal function in a mutant mouse lacking D1A dopamine receptors.
Proc Natl Acad Sci USA
91:12564-12568[Abstract/Free Full Text].
-
Flores G,
Liang JJ,
Sierra A,
Martinez-Fong D,
Quirion R,
Aceves J,
Srivastava LK
(1999)
Expression of dopamine receptors in the subthalamic nucleus of the rat: characterization using reverse transcriptase-polymerase chain reaction and autoradiography.
Neuroscience
91:549-556[Web of Science][Medline].
-
Flores-Hernandez J,
Hernandez S,
Snyder GL,
Yan Z,
Fienberg AA,
Moss SJ,
Greengard P,
Surmeier DJ
(2000)
D(1) dopamine receptor activation reduces GABA(A) receptor currents in neostriatal neurons through a PKA/DARPP-32/PP1 signaling cascade.
J Neurophysiol
83:2996-3004[Abstract/Free Full Text].
-
Fraix V,
Pollak P,
Van Blercom N,
Xie J,
Krack P,
Koudsie A,
Benabid AL
(2000)
Effect of subthalamic nucleus stimulation on levodopa-induced dyskinesia in Parkinson's disease.
Neurology
55:1921-1923[Abstract/Free Full Text].
-
Francois C,
Savy C,
Jan C,
Tande D,
Hirsch EC,
Yelnik J
(2000)
Dopaminergic innervation of the subthalamic nucleus in the normal state, in MPTP-treated monkeys, and in Parkinson's disease patients.
J Comp Neurol
425:121-129[Web of Science][Medline].
-
Fraser DD,
MacVicar BA
(1996)
Cholinergic-dependent plateau potential in hippocampal CA1 pyramidal neurons.
J Neurosci
16:4113-4128[Abstract/Free Full Text].
-
Fremeau Jr RT,
Duncan GE,
Fornaretto MG,
Dearry A,
Gingrich JA,
Breese GR,
Caron MG
(1991)
Localization of D1 dopamine receptor mRNA in brain supports a role in cognitive, affective, and neuroendocrine aspects of dopaminergic neurotransmission.
Proc Natl Acad Sci USA
88:3772-3776[Abstract/Free Full Text].
-
Gerfen CR,
Miyachi S,
Paletzki R,
Brown P
(2002)
D1 dopamine receptor supersensitivity in the dopamine-depleted striatum results from a switch in the regulation of ERK1/2/MAP kinase.
J Neurosci
22:5042-5054[Abstract/Free Full Text].
-
Gola M,
Crest M
(1993)
Colocalization of active KCa channels and Ca2+ channels within Ca2+ domains in helix neurons.
Neuron
10:689-699[Web of Science][Medline].
-
Guerineau NC,
Bossu JL,
Gahwiler BH,
Gerber U
(1997)
G-protein-mediated desensitization of metabotropic glutamatergic and muscarinic responses in CA3 cells in rat hippocampus.
J Physiol (Lond)
500:487-496[Abstract/Free Full Text].
-
Hassani OK,
Feger J
(1999)
Effects of intrasubthalamic injection of dopamine receptor agonists on subthalamic neurons in normal and 6-hydroxydopamine-lesioned rats: an electrophysiological and c-Fos study.
Neuroscience
92:533-543[Web of Science][Medline].
-
Hassani OK,
Francois C,
Yelnik J,
Feger J
(1997)
Evidence for a dopaminergic innervation of the subthalamic nucleus in the rat.
Brain Res
749:88-94[Web of Science][Medline].
-
Hernandez-Lopez S,
Bargas J,
Surmeier DJ,
Reyes A,
Galarraga E
(1997)
D1 receptor activation enhances evoked discharge in neostriatal medium spiny neurons by modulating an L-type Ca2+ conductance.
J Neurosci
17:3334-3342[Abstract/Free Full Text].
-
Kerr JN,
Wickens JR
(2001)
Dopamine D-1/D-5 receptor activation is required for long-term potentiation in the rat neostriatum in vitro.
J Neurophysiol
85:117-124[Abstract/Free Full Text].
-
Khan ZU,
Gutierrez A,
Martin R,
Penafiel A,
Rivera A,
de la CA
(2000)
Dopamine D5 receptors of rat and human brain.
Neuroscience
100:689-699[Web of Science][Medline].
-
Kreiss DS,
Anderson LA,
Walters JR
(1996)
Apomorphine and dopamine D(1) receptor agonists increase the firing rates of subthalamic nucleus neurons.
Neuroscience
72:863-876[Web of Science][Medline].
-
Kreiss DS,
Mastropietro CW,
Rawji SS,
Walters JR
(1997)
The response of subthalamic nucleus neurons to dopamine receptor stimulation in a rodent model of Parkinson's disease.
J Neurosci
17:6807-6819[Abstract/Free Full Text].
-
Levy R,
Hutchison WD,
Lozano AM,
Dostrovsky JO
(2002)
Synchronized neuronal discharge in the basal ganglia of parkinsonian patients is limited to oscillatory activity.
J Neurosci
22:2855-2861[Abstract/Free Full Text].
-
Lidow MS,
Roberts A,
Zhang L,
Koh PO,
Lezcano N,
Bergson C
(2001)
Receptor crosstalk protein, calcyon, regulates affinity state of dopamine D1 receptors.
Eur J Pharmacol
427:187-193[Web of Science][Medline].
-
Limousin P,
Krack P,
Pollak P,
Benazzouz A,
Ardouin C,
Hoffmann D,
Benabid AL
(1998)
Electrical stimulation of the subthalamic nucleus in advanced Parkinson's disease.
N Engl J Med
339:1105-1111[Abstract/Free Full Text].
-
Liu F,
Wan Q,
Pristupa ZB,
Yu XM,
Wang YT,
Niznik HB
(2000)
Direct protein-protein coupling enables cross-talk between dopamine D5 and gamma-aminobutyric acid A receptors.
Nature
403:274-280[Medline].
-
Magill PJ,
Bolam JP,
Bevan MD
(2000)
Relationship of activity in the subthalamic nucleus-globus pallidus network to cortical electroencephalogram.
J Neurosci
20:820-833[Abstract/Free Full Text].
-
Magill PJ,
Bolam JP,
Bevan MD
(2001)
Dopamine regulates the impact of the cerebral cortex on the subthalamic nucleus-globus pallidus network.
Neuroscience
106:313-330[Web of Science][Medline].
-
Marrion NV,
Tavalin SJ
(1998)
Selective activation of Ca2+-activated K+ channels by co-localized Ca2+ channels in hippocampal neurons.
Nature
29:900-905.
-
Mattia D,
Kawasaki H,
Avoli M
(1997)
In vitro electrophysiology of rat subicular bursting neurons.
Hippocampus
7:48-57[Web of Science][Medline].
-
Maurice N,
Tkatch T,
Meisler M,
Sprunger LK,
Surmeier DJ
(2001)
D1/D5 dopamine receptor activation differentially modulates rapidly inactivating and persistent sodium currents in prefrontal cortex pyramidal neurons.
J Neurosci
21:2268-2277[Abstract/Free Full Text].
-
Mehta A,
Thermos K,
Chesselet MF
(2000)
Increased behavioral response to dopaminergic stimulation of the subthalamic nucleus after nigrostriatal lesions.
Synapse
37:298-307[Web of Science][Medline].
-
Missale C,
Nash SR,
Robinson SW,
Jaber M,
Caron MG
(1998)
Dopamine receptors: from structure to function.
Physiol Rev
78:189-225[Abstract/Free Full Text].
-
Morisset V,
Nagy F
(1999)
Ionic basis for plateau potentials in deep dorsal horn neurons of the rat spinal cord.
J Neurosci
19:7309-7316[Abstract/Free Full Text].
-
Nakanishi H,
Kita H,
Kitai ST
(1987)
Electrical membrane properties of rat subthalamic neurons in an in vitro slice preparation.
Brain Res
437:35-44[Web of Science][Medline].
-
Neher E
(1992)
Correction for liquid junction potentials in patch clamp experiments.
Methods Enzymol
207:123-131[Web of Science][Medline].
-
Ni Z,
Gao D,
Bouali-Benazzouz R,
Benabid AL,
Benazzouz A
(2001)
Effect of microiontophoretic application of dopamine on subthalamic nucleus neuronal activity in normal rats and in rats with unilateral lesion of the nigrostriatal pathway.
Eur J Neurosci
14:373-381[Web of Science][Medline].
-
Otsuka T,
Murakami F,
Song WJ
(2001)
Excitatory postsynaptic potentials trigger a plateau potential in rat subthalamic neurons at hyperpolarized states.
J Neurophysiol
86:1816-1825[Abstract/Free Full Text].
-
Plenz D,
Kital ST
(1999)
A basal ganglia pacemaker formed by the subthalamic nucleus and external globus pallidus.
Nature
400:677-682[Medline].
-
Radnikow G,
Misgeld U
(1998)
Dopamine D1 receptors facilitate GABAA synaptic currents in the rat substantia nigra pars reticulata.
J Neurosci
18:2009-2016[Abstract/Free Full Text].
-
Raz A,
Frechter-Mazar V,
Feingold A,
Abeles M,
Vaadia E,
Bergman H
(2001)
Activity of pallidal and striatal tonically active neurons is correlated in MPTP-treated monkeys but not in normal monkeys.
J Neurosci
21:RC128(1-4).
-
Seamans JK,
Durstewitz D,
Christie BR,
Stevens CF,
Sejnowski TJ
(2001)
Dopamine D1/D5 receptor modulation of excitatory synaptic inputs to layer V prefrontal cortex neurons.
Proc Natl Acad Sci USA
98:301-306[Abstract/Free Full Text].
-
Shen KZ,
Johnson SW
(2000)
Presynaptic dopamine D2 and muscarine M3 receptors inhibit excitatory and inhibitory transmission to rat subthalamic neurones in vitro.
J Physiol (Lond)
525:331-341[Abstract/Free Full Text].
-
Sidhu A
(1998)
Coupling of D1 and D5 dopamine receptors to multiple G proteins: implications for understanding the diversity in receptor-G protein coupling.
Mol Neurobiol
16:125-134[Web of Science][Medline].
-
Song WJ,
Baba Y,
Otsuka T,
Murakami F
(2000)
Characterization of Ca(2+) channels in rat subthalamic nucleus neurons.
J Neurophysiol
84:2630-2637[Abstract/Free Full Text].
-
Svenningsson P,
Le Moine C
(2002)
Dopamine D1/5 receptor stimulation induces c-fos expression in the subthalamic nucleus: possible involvement of local D5 receptors.
Eur J Neurosci
15:133-142[Web of Science][Medline].
-
Terman D,
Rubin JE,
Yew AC,
Wilson CJ
(2002)
Activity patterns in a model for the subthalamopallidal network of the basal ganglia.
J Neurosci
22:2963-2976[Abstract/Free Full Text].
-
Tiberi M,
Caron MG
(1994)
High agonist-independent activity is a distinguishing feature of the dopamine D1B receptor subtype.
J Biol Chem
269:27925-27931[Abstract/Free Full Text].
-
Tsien RW,
Lipscombe D,
Madison DV,
Bley KR,
Fox AP
(1988)
Multiple types of neuronal calcium channels and their selective modulation.
Trends Neurosci
11:431-438[Web of Science][Medline].
-
Walters JR,
Ruskin DN,
Allers KA,
Bergstrom DA
(2000)
Pre- and postsynaptic aspects of dopamine-mediated transmission.
Trends Neurosci
23:S41-S47[Web of Science][Medline].
-
Wang Q,
Jolly JP,
Surmeier JD,
Mullah BM,
Lidow MS,
Bergson CM,
Robishaw JD
(2001)
Differential dependence of the D1 and D5 dopamine receptors on the G protein gamma 7 subunit for activation of adenylylcyclase.
J Biol Chem
276:39386-39393[Abstract/Free Full Text].
-
Westin JE,
Andersson M,
Lundblad M,
Cenci MA
(2001)
Persistent changes in striatal gene expression induced by long-term L-DOPA treatment in a rat model of Parkinson's disease.
Eur J Neurosci
14:1171-1176[Web of Science][Medline].
-
Zhu Z,
Bartol M,
Shen K,
Johnson SW
(2002)
Excitatory effects of dopamine on subthalamic nucleus neurons: in vitro study of rats pretreated with 6-hydroxydopamine and levodopa.
Brain Res
945:31-40[Web of Science][Medline].
Copyright © 2003 Society for Neuroscience 0270-6474/03/233816-10$05.00/0
This article has been cited by other articles:

|
 |

|
 |
 
C. H. So, V. Verma, M. Alijaniaram, R. Cheng, A. J. Rashid, B. F. O'Dowd, and S. R. George
Calcium Signaling by Dopamine D5 Receptor and D5-D2 Receptor Hetero-Oligomers Occurs by a Mechanism Distinct from That for Dopamine D1-D2 Receptor Hetero-Oligomers
Mol. Pharmacol.,
April 1, 2009;
75(4):
843 - 854.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. Sahu, K. R. Tyeryar, H. O. Vongtau, D. R. Sibley, and A. S. Undieh
D5 Dopamine Receptors are Required for Dopaminergic Activation of Phospholipase C
Mol. Pharmacol.,
March 1, 2009;
75(3):
447 - 453.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. Antri, K. Fenelon, and R. Dubuc
The Contribution of Synaptic Inputs to Sustained Depolarizations in Reticulospinal Neurons
J. Neurosci.,
January 28, 2009;
29(4):
1140 - 1151.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
U. Strauss, F.-W. Zhou, J. Henning, A. Battefeld, A. Wree, R. Kohling, S. J.-P. Haas, R. Benecke, A. Rolfs, and U. Gimsa
Increasing Extracellular Potassium Results in Subthalamic Neuron Activity Resembling That Seen in a 6-Hydroxydopamine Lesion
J Neurophysiol,
June 1, 2008;
99(6):
2902 - 2915.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. Baufreton and M. D. Bevan
D2-like dopamine receptor-mediated modulation of activity-dependent plasticity at GABAergic synapses in the subthalamic nucleus
J. Physiol.,
April 15, 2008;
586(8):
2121 - 2142.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. Ramanathan, T. Tkatch, J. F. Atherton, C. J. Wilson, and M. D. Bevan
D2-Like Dopamine Receptors Modulate SKCa Channel Function in Subthalamic Nucleus Neurons Through Inhibition of Cav2.2 Channels
J Neurophysiol,
February 1, 2008;
99(2):
442 - 459.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
P. Belujon, E. Bezard, A. Taupignon, B. Bioulac, and A. Benazzouz
Noradrenergic Modulation of Subthalamic Nucleus Activity: Behavioral and Electrophysiological Evidence in Intact and 6-Hydroxydopamine-Lesioned Rats
J. Neurosci.,
September 5, 2007;
27(36):
9595 - 9606.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. A. Kliem, N. T. Maidment, L. C. Ackerson, S. Chen, Y. Smith, and T. Wichmann
Activation of Nigral and Pallidal Dopamine D1-Like Receptors Modulates Basal Ganglia Outflow in Monkeys
J Neurophysiol,
September 1, 2007;
98(3):
1489 - 1500.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C. R. Lee and J. M. Tepper
A Calcium-Activated Nonselective Cation Conductance Underlies the Plateau Potential in Rat Substantia Nigra GABAergic Neurons
J. Neurosci.,
June 13, 2007;
27(24):
6531 - 6541.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. Hernandez, O. Ibanez-Sandoval, A. Sierra, R. Valdiosera, D. Tapia, V. Anaya, E. Galarraga, J. Bargas, and J. Aceves
Control of the Subthalamic Innervation of the Rat Globus Pallidus by D2/3 and D4 Dopamine Receptors
J Neurophysiol,
December 1, 2006;
96(6):
2877 - 2888.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. Gillies and D. Willshaw
Membrane Channel Interactions Underlying Rat Subthalamic Projection Neuron Rhythmic and Bursting Activity
J Neurophysiol,
April 1, 2006;
95(4):
2352 - 2365.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
O. Ibanez-Sandoval, A. Hernandez, B. Floran, E. Galarraga, D. Tapia, R. Valdiosera, D. Erlij, J. Aceves, and J. Bargas
Control of the Subthalamic Innervation of Substantia Nigra Pars Reticulata by D1 and D2 Dopamine Receptors
J Neurophysiol,
March 1, 2006;
95(3):
1800 - 1811.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. I. Kass and I. M. Mintz
Silent plateau potentials, rhythmic bursts, and pacemaker firing: Three patterns of activity that coexist in quadristable subthalamic neurons
PNAS,
January 3, 2006;
103(1):
183 - 188.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. Baufreton, Z.-T. Zhu, M. Garret, B. Bioulac, S. W. Johnson, and A. I. Taupignon
Dopamine receptors set the pattern of activity generated in subthalamic neurons
FASEB J,
November 1, 2005;
19(13):
1771 - 1777.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
Y. Yasoshima, N. Kai, S. Yoshida, S. Shiosaka, Y. Koyama, Y. Kayama, and K. Kobayashi
Subthalamic Neurons Coordinate Basal Ganglia Function through Differential Neural Pathways
J. Neurosci.,
August 24, 2005;
25(34):
7743 - 7753.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
T. Otsuka, T. Abe, T. Tsukagawa, and W.-J. Song
Conductance-Based Model of the Voltage-Dependent Generation of a Plateau Potential in Subthalamic Neurons
J Neurophysiol,
July 1, 2004;
92(1):
255 - 264.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C. E. Young and C. R. Yang
Dopamine D1/D5 Receptor Modulates State-Dependent Switching of Soma-Dendritic Ca2+ Potentials via Differential Protein Kinase A and C Activation in Rat Prefrontal Cortical Neurons
J. Neurosci.,
January 7, 2004;
24(1):
8 - 23.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
N. E. Hallworth, C. J. Wilson, and M. D. Bevan
Apamin-Sensitive Small Conductance Calcium-Activated Potassium Channels, through their Selective Coupling to Voltage-Gated Calcium Channels, Are Critical Determinants of the Precision, Pace, and Pattern of Action Potential Generation in Rat Subthalamic Nucleus Neurons In Vitro
J. Neurosci.,
August 20, 2003;
23(20):
7525 - 7542.
[Abstract]
[Full Text]
[PDF]
|
 |
|
|