 |
Previous Article | Next Article 
The Journal of Neuroscience, February 15, 2003, 23(4):1119
BRIEF COMMUNICATION
The Role of Synaptic GTPase-Activating Protein in Neuronal
Development and Synaptic Plasticity
Jee Hae
Kim,
Hey-Kyoung
Lee,
Kogo
Takamiya, and
Richard
L.
Huganir
Department of Neuroscience, Howard Hughes Medical Institute, Johns
Hopkins University, School of Medicine, Baltimore, Maryland 21205
 |
ABSTRACT |
Synaptic GTPase-activating protein (SynGAP) is a neuronal
RasGAP (Ras GTPase-activating protein) that is selectively
expressed in brain and highly enriched at excitatory synapses,
where it negatively regulates Ras activity and its downstream signaling pathways. To investigate the physiological role of SynGAP in the brain,
we have generated mutant mice lacking the SynGAP protein. These mice
exhibit postnatal lethality, indicating that SynGAP plays a critical
role during neuronal development. In addition, cell biological
experiments show that neuronal cultures from mutant mice have more
synaptic AMPA receptor clusters, suggesting that SynGAP regulates
glutamate receptor synaptic targeting. Moreover, electrophysiological
studies demonstrated that heterozygous mutant mice have a specific
defect in hippocampal long-term potentiation (LTP). These studies show
that the regulation of synaptic Ras signaling by SynGAP is important
for proper neuronal development and glutamate receptor trafficking and
is critical for the induction of LTP.
Key words:
excitatory synapses; glutamate; long-term
potentiation; long-term depression; postsynaptic density; AMPA
receptors; NMDA receptors; Ras signaling
 |
Introduction |
Glutamatergic synapses mediate the
majority of excitatory synaptic transmission in the mammalian
CNS (Hollmann and Heinemann, 1994 ). The study of the physiology
and structure of these synapses has yielded insights into many brain
processes, including neuronal development, learning and memory,
excitotoxicity, and neuropsychiatric diseases (Hollmann and Heinemann,
1994 ). At the excitatory synapse, the presynaptic neurotransmitter
release machinery and endocytic compartments are concentrated at the
nerve terminal, whereas the postsynaptic receptors and signaling
molecules are tightly organized at and beneath the postsynaptic
membrane (Garner et al., 2000 ; Scannevin and Huganir, 2000 ). Recently,
the molecular dissection of synapses has identified many proteins that
are involved in the sorting and targeting of synaptic proteins,
including neurotransmitter receptors and ion channels (Scannevin and
Huganir, 2000 ).
There are two classes of glutamate receptors: ligand-gated ionotropic
glutamate receptors and G-protein-coupled metabotropic glutamate
receptors (Hollmann and Heinemann, 1994 ); the organization and
regulation of these receptors by associated molecules and other
components of the postsynaptic membrane are beginning to be understood
at a molecular level. Of the ligand-gated glutamate receptors, NMDA
receptors have been implicated in many cellular processes contributing
to neuronal development and differentiation, modulation of synaptic
strength, and excitotoxicity. NMDA receptors are a central component of
a large macromolecular complex with the members of the postsynaptic
density-95 (PSD-95)/synapse-associated protein-90 (SAP90) protein
family, recruiting a variety of proteins in close apposition (Scannevin
and Huganir, 2000 ). One of these molecules is synaptic
GTPase-activating protein (SynGAP), a novel neuronal Ras GTPase
activating protein enriched at excitatory synapses (Chen et al., 1998 ;
Kim et al., 1998 ) that may couple NMDA receptor function to synaptic
Ras modulation.
Ras proteins are small G-proteins involved in the regulation of many
important signal transduction processes that affect cellular growth and
differentiation (Bokoch and Der, 1993 ; Marshall, 1996 ). In neurons, Ras
signaling is essential for activation of the mitogen-activated protein
kinase (MAPK) cascade by growth factors such as neurotrophins or
by intracellular Ca2+ (Finkbeiner and
Greenberg, 1996 ; Fukunaga and Miyamoto, 1998 ). The importance of the
MAPK cascade in synaptic plasticity has been shown in several different
systems, including Drosophila and Aplysia, as
well in mammalian nervous systems (Brambilla et al., 1997 ; Kornhauser
and Greenberg, 1997 ; Impey et al., 1999 ). The MAPK cascade has been
shown to be involved in the induction and maintenance of long-term
potentiation (LTP) (Brambilla et al., 1997 ; Sweatt, 2001 ), a common
model of synaptic plasticity (Bliss and Collingridge, 1993 ; Nicoll and
Malenka, 1995 ). The unique molecular and cellular features of SynGAP
suggest that it may modulate Ras signaling at excitatory synapses and
play an important role in synaptic plasticity.
In an effort to elucidate the physiological role of SynGAP, we used
gene-targeting techniques to delete the SynGAP gene in mice. The SynGAP
mutant mice die within the first week, indicating an essential role for
SynGAP during early postnatal development. In neuronal cultures from
mutant mice, the number of synaptic AMPA receptor clusters was
increased, suggesting that SynGAP is important in the regulation of
receptor synaptic targeting. Furthermore, electrophysiological studies
in heterozygous mice show that LTP is decreased compared with that of
the wild-type mice. Thus, these results show that SynGAP plays a
critical role during neuronal development and may contribute to the
complex regulation of signal transmission at synapses by affecting the
organization and function of glutamate receptors.
 |
Materials and Methods |
Generation of the SynGAP knock-out mice. A bacterial
artificial chromosome (BAC) genomic clone from the mouse strain 129 was obtained (Genome Systems, St. Louis, MO) using a primer set
(AAGAAGGACAAGGCAGGCTAC and ATACTCCTTTATGGCTTTATG) designed to amplify a
specific fragment between the C2 and GAP domains. The BAC clone 18793 was obtained and was analyzed by restriction mapping. A fragment of
~13 kb digested with BamHI and HindIII
restriction enzymes was chosen for additional analyses and to be used
to make a targeted disruption in the SynGAP gene. After
subcloning the BamHI-HindIII fragment into
pBluescript, the targeting vector was constructed by replacing the
region containing two exons plus intronic sequences, after digestion
with SacII and EcoRI, with the
neoR cassette in the opposite
orientation. Then the thymidine kinase gene was placed at the
BamHI and XhoI sites to aid during embryonic stem
(ES) cell screening for homologous recombination events. The construct
was linearized with HindIII and electroporated into 129 ES
cells (Dr. A. Nagy, Mount Sinai Hospital, Toronto, Canada). Homologous
recombinants were isolated by positive and negative selections with
G418 and ganciclovir (Roche Products, Hertfordshire, UK),
and the targeted allele was detected by PCR and confirmed by Southern
blotting. Southern blotting was performed using two probes (outer and
inner) after KpnI digestion. The wild-type fragment after
KpnI digestion is 1.8 kb shorter than the targeted allele. The Southern blotting was performed using GeneScreen Plus
(DuPont/NEN, Boston, MA) following the protocol provided
by the manufacturer. PCR-based screening was conducted using a pair of
gene-specific primers (GAGCCAGGGTTCACAAAGTA and CACTCCTCTCCAGGTAACAAC)
to detect the wild-type allele and a gene-specific primer
(TGTCCTTTTCCCTTGTGTCTGGCTGTCCTA) and a
neoR gene-specific primer
(TCGTGCTTTACGGTATCGCCGCTCCCGATT) to detect the targeted allele. The
positive ES clones were then injected into C57BL/6 blastocysts
at the Transgenic Facility of the Johns Hopkins University School of Medicine.
Immunoblotting. For protein analyses of the SynGAP in mice,
whole-brain lysate was prepared from mouse pups at postnatal day 4 (P4)
and P5, and an equal amount of protein was loaded and separated by
SDS-PAGE. The gel was transferred to a polyvinylidene difluoride (Millipore, Bedford, MA) membrane, and the membrane was
blocked and immunoblotted as described previously (Lau et al., 1996 ). The anti-GAP antibody of SynGAP was raised against the fusion protein
with a hexa-histidine tag in rabbit and purified using the antigen
coupled to Affi-Gel 10 column (Bio-Rad, Hercules, CA).
Antibodies to NMDA receptor subunits NR1 and NR2B, glutamate receptor 1 (GluR1), SAP102, glutamate receptor-interacting protein (GRIP), and
GRIP-associated proteins (GRASP) were produced similarly and have been
characterized previously (Lau and Huganir, 1995 ; Dong et al.,
1997 ; Kim et al., 1998 ; Ye et al., 2000 ). The anti-PSD-95 antibody was
obtained from Upstate Biotechnology (Lake Placid, NY).
Cortical culture, immunocytochemistry, and statistical
analysis. Cortical cultures were made from mouse brains at P0
using the procedure described by Goslin and Banker (1991) . The
forebrain was isolated from a mouse pup and was prepared and plated
individually; the tail from each pup was prepared for DNA
analysis, and the genotype was analyzed by PCR. After 13-20 d
in culture, the neurons were fixed and stained with affinity-purified
antibodies as described previously (Liao et al., 1999 , 2001 ).
Statistical analysis was performed as described previously (Liao et
al., 1999 , 2001 )
Slice preparation and electrophysiological recordings.
Hippocampal slices were prepared from P90-P120 male wild-type and
heterozygous SynGAP mice as described previously (Lee et al.,
2000 ). The experimenter was kept unaware of the genotype. To
induce LTP, four episodes of theta burst stimulation (TBS) were
delivered at 0.1 Hz, using the baseline stimulation intensity. TBS
consists of 10 stimulus trains delivered at 5 Hz, with each train
consisting of four pulses at 100 Hz. Paired-pulse long-term depression
(PP-LTD) was induced by delivering paired pulses at interstimulus
intervals of 50 msec at 1 Hz for 15 min (PP-1 Hz). The pharmacological
isolation of NMDA receptor-mediated synaptic responses was done by
switching to artificial CSF (ACSF) with 0 mM
Mg2+ and 10 µM
2,3-dihydroxy-6-nitro-7-sulfonyl-benzo[f]quinoxaline (NBQX). To confirm the isolation of NMDA receptor responses, 100 µM D,L-APV was perfused
at the end of each experiment.
An input-output curve was generated by varying the stimulus intensity.
The resulting field potential (FP) slope was then plotted against fiber volley amplitude to control for possible variability in
recruiting presynaptic fibers. In the case of pharmacologically isolated NMDA receptor-mediated responses, FP amplitude was plotted against fiber volley amplitude.
 |
Results |
SynGAP mutant mice die shortly after birth
To explore the possible role of SynGAP in vivo, the
SynGAP gene was disrupted in mice. The genomic DNA containing the 5'
end of the mouse SynGAP gene was isolated and analyzed for targeting vector construction. SynGAP is extensively spliced at the 5' end, leading to splice variants: SynGAP-a, -b, -c, and -d (Chen et al.,
1998 ; Kim et al., 1998 ; Li et al., 2001 ) (Fig.
1A). Therefore, the
exon cassette containing the first common methionine present in the
shortest splice variant, SynGAP-c, was chosen for deletion, along with
an adjacent exon encoding a portion of the C2 domain by replacing it
with a neoR gene cassette in the reverse
orientation (Fig. 1B). The normal splicing events in
the targeted SynGAP gene are predicted to yield transcripts with
premature stop codons. The targeted and the wild-type alleles can be
differentiated by performing Southern blotting after the
KpnI digestion using the inner and outer probes (Fig. 1B), and the genotyping result can also be confirmed
by PCR using the primers shown (Fig. 1C,
right).

View larger version (34K):
[in this window]
[in a new window]
|
Figure 1.
SynGAP splice variants and domain structure and
gene targeting strategy. A, N-terminal splicing leads to
different start sites and sequences in SynGAP-a, -b, -c, and -d. SynGAP
protein contains a pleckstrin homology (PH)
domain, a phospholipid-dependent Ca2+ binding motif
(C2) domain, a Ras GTPase-activation protein
(RasGAP) domain, and a C-terminal sequence PSD-95/discs
large/zona occludens-1 domain binding motif
(QTRV). Alternative splicing occurs also at the C
terminal with C-terminal sequences other than QTRV.
B, The SynGAP gene structure is shown (not drawn to
scale) of the region analyzed for gene targeting. Targeting of the
SynGAP gene was performed by replacing the SacII and
EcoRI fragments of the SynGAP gene containing two exons
with the neoR cassette. The targeting
construct spanning the XhoI and HindIII
fragment of the SynGAP gene is 11.5 kb long. Outer and inner probes
were used for Southern blotting. The PCR primers used for genotyping
and the predicted amplified sizes are shown. TK,
Thymidine kinase. C, Genotype analyses of tail DNA of
second filial generation (F2) mice by PCR and
Southern blotting. The wild-type allele is detected by Southern
blotting after digestion with the KpnI restriction
enzyme (left). The size of the detected wild-type band
is 1.8 kb longer than that of the targeted allele. Two alleles can be
distinguished using PCR primer sets (right).
|
|
The chimeric male mice from two independent ES clones (17.28 and 18.8)
were mated with C57BL/6 female mice to generate heterozygotes, and sibling mating of heterozygotes produced homozygotes. The F2 mice genotypes exhibited a Mendelian ratio of
1:2:1, indicating that there is no embryonic lethality caused by the
null mutation of the SynGAP protein or abnormal segregation of the
gene. A database search revealed that the SynGAP gene is on mouse
chromosome 17. A sample Southern blotting analysis of the
F2 mice is shown in Figure 1C,
left, where the mobility of the targeted allele differs from
that of the wild type after the KpnI digestion because the neoR gene does not contain the restriction
site. The heterozygotes are indistinguishable from the wild types in
their size and activity, and they breed normally. The homozygotes are
indistinguishable from the wild types and the heterozygotes for the
first 2 d after birth. By the third day the mutant mice begin to
show less movement and do not feed from the mother mice. Between P4 and
P6, the pups stay small in size, and they die between P5 and P7.
These observations were confirmed in the two independent mutant mouse lines.
SynGAP gene targeting abolishes the expression of the wild-type
SynGAP protein
Immunoblot analysis of mouse brain homogenates at P5 with the
anti-GAP SynGAP antibody showed that expression of the 130 kDa SynGAP
protein is abolished in the mutant mice (Fig.
2A). However, overexposure of the immunoblot showed that a very low level of a smear
of smaller proteins (~120 kDa) could be detectable using the anti-GAP
antibody. These are most likely protein products of the SynGAP gene
from cryptic start sites downstream of the deleted exons in the
targeted gene. These protein products are present at <2% the level of
the wild-type SynGAP protein. To analyze whether deletion of SynGAP
affected the expression of other neuronal proteins, various synaptic
proteins were surveyed in the SynGAP mice at P5 (Fig.
2B). NMDA receptor subunits, NR1 and NR2B, and associated proteins, PSD-95 and SAP102, were similar in expression level in all genotypes. Also, the level of the AMPA receptor subunit GluR1 and the AMPA receptor-associated proteins GRIP1 and GRASP1 were
indistinguishable in the wild types, heterozygotes, and
homozygotes.

View larger version (21K):
[in this window]
[in a new window]
|
Figure 2.
A proper expression of SynGAP protein is abolished
in the mutant mice, whereas other synaptic proteins are not affected at
P5. A, Mouse brain homogenates were prepared and
immunoblotted with the anti-GAP SynGAP antibodies at P5 and compared
with that of rat brain homogenate at P4. With an equal amount of
protein loaded in each lane, SynGAP protein expression
is absent in the sample from a homozygous (Homoz) mouse.
Heteroz, Heterozygous. B, The expression
of proteins at synapses was examined in the SynGAP mice using the
antibodies to the proteins indicated, and no detectable change in the
expression was seen. C, Tissue distribution of SynGAP
protein in the mutant and the wild-type mice at P5 was examined using
the -GAP domain antibody. In wild-type mice, a prominent band of
~130 kDa was detected in the cortex and the cerebellum. In contrast,
the ~130 kDa protein was not detected in the homozygotes or in
non-neuronal tissues.
|
|
Brain development in the SynGAP mutant mice
Examination of the SynGAP mutant mice at a gross anatomical level
reveals typical development of tissues and organs, similar to the
wild-type mice. Because SynGAP protein expression is selectively expressed in the brain (Fig. 2C), it seems likely that the
prenatal development of non-neuronal tissues is not affected by the
absence of SynGAP protein. Brain development at the gross anatomical
level also seems normal in the mutant mice. The formation and
organization of the forebrain appears to be similar in mice of all
three genotypes at P5, as revealed by Nissl staining (data not shown).
However, the size of the mutant mouse brain is significantly smaller,
indicating that SynGAP may be crucial to the proliferation and
development of neuronal tissues after birth, especially around P3. It
is not clear why the SynGAP mutant mice die (see Discussion).
Decreased number of silent synapses in neurons cultured from
homozygous mice
To investigate the role of SynGAP during synaptogenesis,
cortical neuronal cultures were prepared from SynGAP mice and analyzed after 18-20 d in vitro (DIV). The neurons were fixed, and
immunocytochemistry was performed using an anti-synaptophysin antibody
to identify synapses, anti-GluR1 and anti-GluR2/3 antibodies to
identify AMPA receptors, and anti-NR1 antibody for NMDA receptors. In
heterozygote and homozygous neurons, synapses, identified by the
anti-synaptophysin antibody, were present in similar numbers
[heterozygote mice, 94.1 ± 4.7 (SD) of wild-type mice,
p < 0.68; homozygote mice 109.4 ± 4.9%,
p < 0.49 of wild-type mice] and pattern to those in
wild-type neurons. Interestingly, AMPA receptor clusters, identified by the anti-GluR1 antibody, were present in a greater number in the homozygotes than in the heterozygotes and the wild-types (Fig. 3A). A similar result was
obtained using the anti-GluR2/3 antibody. Quantitation of the number of
AMPA receptor puncta is shown in Figure 3B. The number of
GluR1-positive clusters was increased in the homozygotes by 32.1 ± 9.0% (p < 0.05; ANOVA) compared with the
wild types (Fig. 3) and was also higher in the heterozygotes (21.4 ± 8.6%). There was a slight increase in the number of NMDA receptor
puncta, although this was not statistically significant (p > 0.05; ANOVA; data not shown). Because the
number of AMPA receptor clusters increased more than the number of NMDA
receptor clusters, we determined whether the number of morphological
silent synapses (synapses that contain NMDA receptors but not AMPA
receptors) (Liao et al., 1999 , 2001 ) was increased in the mutant mouse.
The cultures from the SynGAP mutant mice had significantly fewer
morphological silent synapses than their wild-type littermates (Fig.
3C).

View larger version (86K):
[in this window]
[in a new window]
|
Figure 3.
The number of AMPA receptor clusters in the SynGAP
mutant mice is increased. A, Primary cortical cultures
from the SynGAP mutant mice and their wild-type and heterozygous
littermates were immunostained with anti-GluR1 antibodies after 18-20
DIV. There was an increase in the number of GluR1-positive clusters in
the cultures prepared from the homozygous pups. B,
Quantitation of GluR1-positive puncta in SynGAP mouse neuronal cultures
at 18-20 DIV (n = 14, n = 19, and n = 13, respectively; p < 0.05; ANOVA; F = 3.52). C, The
number of morphological silent synapses in the cultures was quantitated
by comparing the number of AMPA receptor cluster/NMDA receptor cluster
puncta (n = 9, n = 13, and
n = 7, respectively) at 18-20 DIV.
|
|
Synaptic plasticity in SynGAP knock-out mice
We tested the role of SynGAP in hippocampal synaptic
plasticity by comparing the magnitude of LTP and LTD in the CA1 region of adult wild-type and heterozygous mice. LTP induced by TBS was significantly decreased in slices from heterozygous mice (140 ± 6% of baseline at 1 hr after TBS; n = 20 slices from
five animals) compared with their wild-type littermates (174 ± 9% of baseline; n = 16 slices from five animals;
p < 0.01; Student's t test) (Fig. 4A). Next we tested
whether LTD is affected in the SynGAP heterozygotes. To examine LTD, we
used paired pulses at an interstimulus interval of 50 msec repeated at
1 Hz for 15 min (PP-1 Hz), which has been used previously to induce LTD
in hippocampal slices from adult rats (Kemp et al., 2000 ). As shown in
Figure 4B, there was no difference in the magnitude
of LTD in the heterozygous animals (80 ± 3% of baseline measured
1 hr after the start of PP-1 Hz; n = 21 slices from
four animals) compared with wild-type littermates (82 ± 4% of
baseline; n = 18 slices from four animals;
p > 0.4; Student's t test). In mice, LTD
induced by the PP-1 Hz protocol is completely blocked by bath
application of the NMDA receptor antagonist APV (data not shown).

View larger version (24K):
[in this window]
[in a new window]
|
Figure 4.
A, Schaffer collateral to CA1 LTP
in adult SynGAP heterozygotes ( ; n = 20 slices
from 5 animals) are significantly reduced compared with wild-type
littermates ( ; n = 16 slices from 5 animals). FP
traces taken just before and 1 hr after TBS for wild types and
heterozygotes are shown to the right. B,
No significant difference in PP-LTD (PP-1Hz) in SynGAP
heterozygotes ( ; n = 21 slices from 4 animals)
and wild types ( ; n = 18 slices from 4 animals).
FP traces taken just before and 1 hr after the initiation of
PP-1 Hz are shown to the right. C, AMPA
receptor-mediated synaptic transmission measured as the initial FP
slope plotted against fiber volley amplitude. Plots of both wild types
( ; n = 32 slices from 8 animals) and
heterozygotes ( ; n = 33 slices from 8 animals)
essentially overlap, suggesting that synaptic transmission is normal in
heterozygotes. D, No difference was observed in
presynaptic function as monitored by paired-pulse facilitation between
wild types ( ; n = 14 slices from 5 animals) and
heterozygotes ( ; n = 14 slices from 5 animals).
Paired pulses were given at interstimulus intervals of 25, 50 100, 200, 400, 800, and 1600 msec at baseline stimulus intensity.
E, Pharmacologically isolated NMDA receptor-mediated
synaptic transmission does not differ much between SynGAP heterozygous
and wild-type littermates. NMDA receptor-mediated synaptic responses
were pharmacologically isolated by bath application of ACSF with 0 mM Mg2+ and 10 µM NBQX. An
input-output curve was generated by plotting the amplitude of NMDA
receptor (NR)-mediated FP against fiber volley
amplitude. At the end of each experiment, 100 µM
D,L-APV was added to the bath, completely abolishing the
responses (data not shown). Dashed lines indicate normalized
FP and paired-pulse facilitation ratio.
|
|
The phenotype seen in heterozygotes was not attributable to changes in
AMPA receptor-mediated synaptic transmission, because there were no
detectable differences in the input-output curve (Fig. 4C).
Presynaptic function measured by the paired-pulse facilitation ratio at interstimulus intervals ranging from 25 to 1600 msec were also
normal in the heterozygotes (Fig. 4D). To rule out
the possibility that the reduced LTP in the SynGAP heterozygotes is attributable to alterations in NMDA receptor-mediated synaptic responses, we pharmacologically isolated NMDA receptor-mediated components of synaptic transmission by recording in ACSF with 0 mM Mg2+ and 10 µM NBQX. The magnitude of the NMDA
receptor-mediated response was measured by generating an input-output
curve. We plotted NMDA receptor-mediated FP amplitude against the fiber
volley amplitude to correct for variability in recruiting presynaptic
fibers. As shown in Figure 4E, there is no
significant effect on NMDA receptor-mediated responses in the heterozygotes.
 |
Discussion |
SynGAP is a neuron-specific RasGAP that interacts with PSD-95 and
SAP102, members of the PSD-95 protein family. The PSD-95/SAP90 protein
family is composed of proteins with an organized domain structure that
forms complexes at synapses with many proteins, including NMDA
receptors (Scannevin and Huganir, 2000 ). The family of PSD-95
proteins is thought to serve various functions at the synapse,
including providing a scaffold for stabilizing NMDA and AMPA receptors
at the synapse and for the recruitment of other synaptic signaling
proteins such as neuronal nitric oxide synthase and SynGAP
(Scannevin and Huganir, 2000 ). Mice with mutations in the PSD-95
protein have been shown to have normal synaptic transmission but have a
larger LTP compared with wild-type mice (Migaud et al., 1998 ),
suggesting that PSD-95 could modulate synaptic plasticity by regulating
downstream signaling complexes. SynGAP is associated with PSD-95 and is
in close apposition to NMDA receptors; thus, it is well poised to
regulate synaptic transmission and plasticity.
To test this hypothesis, we used conventional gene disruption methods
to generate SynGAP null mutant mice. This was confirmed by the altered
structure of the SynGAP gene using Southern blotting and PCR analyses
and the absence of SynGAP protein expression using SynGAP antibodies. A
survey of other synaptic proteins at P5 revealed no difference in the
pattern of expression in the heterozygotes and the homozygotes.
SynGAP mutant mice are born with no gross anatomical abnormality but
become sickly by P4 and die by P7. Gross examination of the brain
structure and development showed that the brain formation in the mutant
mice is similar to that of the wild-type mice, although the mutant
brains were significantly smaller than the wild-type brains. Together,
these results suggest that SynGAP is critical for the survival of the
animal during early development, but the exact cause of death is not known.
One possibility is that SynGAP is important for NMDA receptor
signaling pathways involved in postnatal development. Genetic analyses
of NMDA receptor subunits in mice have highlighted the importance of
NMDA receptor function for mouse development. In particular, mice with
an NR1 null mutation, which leads to an absence of functional NMDA
receptors, die perinatally with no obvious morphological abnormalities
in the brain (Forrest et al., 1994 ; Li et al., 1994 ). Also, a null
mutation in NR2B leads to death shortly after birth (Kutsuwada et al.,
1996 ). A specific deletion of the intracellular domain of NR2B also
leads to perinatal death, indicating that the intracellular domain is
required for proper function of the receptors, which is critical for
survival in neonates (Sprengel et al., 1998 ). The similarity in
phenotypes between the NMDA receptor and SynGAP mutants suggests that
SynGAP present in the NMDA receptor complex at excitatory synapses may mediate NMDA receptor-dependent signal transduction pathways important for proper neuronal development.
Because the mutant animals die perinatally, before the glutamatergic
synapses are forming, we prepared dissociated cortical neuronal
cultures to assess whether synapses are affected in the absence of
SynGAP protein expression. Using various antibodies to mark
glutamatergic synapses, we observed that the formation and organization
of synapses in the mutant neuronal cultures are different. AMPA
receptors and NMDA receptors were seen in clusters and colocalized with
synaptophysin staining in mutant cultures, but the number of AMPA
receptor clusters was increased compared with the wild-type
littermates. How does the null mutation of SynGAP affect glutamatergic
synapse organization? In mutant mice, without proper regulation of Ras
by SynGAP, activated Ras at synapses may lead to increased Ras
signaling, including activation of the MAPK cascade. Interestingly, a
recent study has shown that NMDA receptor-regulated RAS activation
affects the synaptic trafficking of AMPA receptors (Zhu et al., 2002 ).
Also, PSD-95 has been shown to accelerate the maturation of excitatory
synapses, corroborating the potential role of PSD-95 and SynGAP in
their functional contribution to synaptic receptor organization
(El-Husseini et al., 2000 ). We have tried to look at the regulation of
Ras and MAPK activity in cultured neurons and in brain
homogenates from the mutant mice, but see no consistent changes in the
Ras-MAPK signaling. This may be attributable to the fact that SynGAP
is exclusively found at excitatory synapses and may not affect the
total cellular Ras and MAPK activity. In future experiments we plan to
try to selectively measure synaptic Ras and MAPK activity in the mutant animals.
Electrophysiological analyses of the heterozygous SynGAP mutant mice
show that LTP is dramatically decreased compared with the wild-type
littermates. In contrast, basal transmission, LTD, and AMPA and NMDA
receptor function appear normal in heterozygote hippocampal slices. The
lack of a detectable increase in AMPA receptor function in the
heterozygote hippocampal slices is unexpected, because increases in
GluR1 puncta were observed in cultures from the mutant mice. However,
this may be attributable to differences in the developmental stage of
synapses in culture and in the slice. Future studies will clarify this
issue and will focus on the role of SynGAP in the regulation of
synaptic plasticity at the developing and mature synapse.
In conclusion, these results illustrate a functional contribution of
SynGAP in the regulation of synaptic plasticity. The MAPK cascade is a
major signaling pathway activated by Ras and also has been demonstrated
to be important in LTP. Recent studies have shown that AMPA receptor
trafficking may play important roles in LTP (Scannevin and Huganir,
2000 ), and it is likely that the regulation of SynGAP activity through
its effects on Ras and the MAPK pathway may regulate AMPA receptor
delivery to synapses during LTP.
 |
FOOTNOTES |
Received Oct. 21, 2002; revised Nov. 22, 2002; accepted Nov. 29, 2002.
Correspondence should be addressed to Dr. Richard L. Huganir, Howard
Hughes Medical Institute/Johns Hopkins University, 904A Preclinical
Teaching Building, 725 North Wolfe Street, Baltimore, MD 21205. E-mail: rhuganir{at}jhmi.edu.
J. Kim's present address: The Rockefeller University, Developmental
Biology, 1230 York Avenue, New York, NY 10021.
 |
References |
-
Bliss TV,
Collingridge GL
(1993)
A synaptic model of memory: long-term potentiation in the hippocampus.
Nature
361:31-39[Medline].
-
Bokoch GM,
Der CJ
(1993)
Emerging concepts in the Ras superfamily of GTP-binding proteins.
FASEB J
7:750-759[Abstract].
-
Brambilla R,
Gnesutta N,
Minichiello L,
White G,
Roylance AJ,
Herron CE,
Ramsey M,
Wolfer DP,
Cestari V,
Rossi-Arnaud C,
Grant SG,
Chapman PF,
Lipp HP,
Sturani E,
Klein R
(1997)
A role for the Ras signalling pathway in synaptic transmission and long-term memory.
Nature
390:281-286[Medline].
-
Chen HJ,
Rojas-Soto M,
Oguni A,
Kennedy MB
(1998)
A synaptic Ras-GTPase activating protein (p135 SynGAP) inhibited by CaM kinase II.
Neuron
20:895-904[Web of Science][Medline].
-
Dong H,
O'Brien RJ,
Fung ET,
Lanahan AA,
Worley PF,
Huganir RL
(1997)
GRIP: a synaptic PDZ domain-containing protein that interacts with AMPA receptors.
Nature
386:279-284[Medline].
-
El-Husseini AE,
Schnell E,
Chetkovich DM,
Nicoll RA,
Bredt DS
(2000)
PSD-95 involvement in maturation of excitatory synapses.
Science
290:1364-1368[Abstract/Free Full Text].
-
Finkbeiner S,
Greenberg ME
(1996)
Ca2+-dependent routes to Ras: mechanisms for neuronal survival, differentiation, and plasticity?
Neuron
16:233-236[Web of Science][Medline].
-
Forrest D,
Yuzaki M,
Soares HD,
Ng L,
Luk DC,
Sheng M,
Stewart CL,
Morgan JI,
Connor JA,
Curran T
(1994)
Targeted disruption of NMDA receptor 1 gene abolishes NMDA response and results in neonatal death.
Neuron
13:325-338[Web of Science][Medline].
-
Fukunaga K,
Miyamoto E
(1998)
Role of MAP kinase in neurons.
Mol Neurobiol
16:79-95[Web of Science][Medline].
-
Garner CC,
Kindler S,
Gundelfinger ED
(2000)
Molecular determinants of presynaptic active zones.
Curr Opin Neurobiol
10:321-327[Web of Science][Medline].
-
Goslin K,
Banker G
(1991)
In: Culturing nerve cells. Cambridge, MA: MIT.
-
Hollmann M,
Heinemann S
(1994)
Cloned glutamate receptors.
Annu Rev Neurosci
17:31-108[Web of Science][Medline].
-
Impey S,
Obrietan K,
Storm DR
(1999)
Making new connections: role of ERK/MAP kinase signaling in neuronal plasticity.
Neuron
23:11-14[Web of Science][Medline].
-
Kemp N,
McQueen J,
Faulkes S,
Bashir ZI
(2000)
Different forms of LTD in the CA1 region of the hippocampus: role of age and stimulus protocol.
Eur J Neurosci
12:360-366[Web of Science][Medline].
-
Kim JH,
Liao D,
Lau LF,
Huganir RL
(1998)
SynGAP: a synaptic RasGAP that associates with the PSD-95/SAP90 protein family.
Neuron
20:683-691[Web of Science][Medline].
-
Kornhauser JM,
Greenberg ME
(1997)
A kinase to remember: dual roles for MAP kinase in long-term memory.
Neuron
18:839-842[Web of Science][Medline].
-
Kutsuwada T,
Sakimura K,
Manabe T,
Takayama C,
Katakura N,
Kushiya E,
Natsume R,
Watanabe M,
Inoue Y,
Yagi T,
Aizawa S,
Arakawa M,
Takahashi T,
Nakamura Y,
Mori H,
Mishina M
(1996)
Impairment of suckling response, trigeminal neuronal pattern formation, and hippocampal LTD in NMDA receptor
2 subunit mutant mice.
Neuron
16:333-344[Web of Science][Medline]. -
Lau LF,
Huganir RL
(1995)
Differential tyrosine phosphorylation of N-methyl-D-aspartate receptor subunits.
J Biol Chem
270:20036-20041[Abstract/Free Full Text].
-
Lau LF,
Mammen A,
Ehlers MD,
Kindler S,
Chung WJ,
Garner CC,
Huganir RL
(1996)
Interaction of the N-methyl-D-aspartate receptor complex with a novel synapse-associated protein, SAP102.
J Biol Chem
271:21622-21628[Abstract/Free Full Text].
-
Lee HK,
Barbarosie M,
Kameyama K,
Bear MF,
Huganir RL
(2000)
Regulation of distinct AMPA receptor phosphorylation sites during bidirectional synaptic plasticity.
Nature
405:955-959[Medline].
-
Li W,
Okano A,
Tian QB,
Nakayama K,
Furihata T,
Nawa H,
Suzuki T
(2001)
Characterization of a novel synGAP isoform, synGAP-
.
J Biol Chem
276:21417-21424[Abstract/Free Full Text]. -
Li Y,
Erzurumlu RS,
Chen C,
Jhaveri S,
Tonegawa S
(1994)
Whisker-related neuronal patterns fail to develop in the trigeminal brainstem nuclei of NMDAR1 knockout mice.
Cell
76:427-437[Web of Science][Medline].
-
Liao D,
Zhang X,
O'Brien R,
Ehlers MD,
Huganir RL
(1999)
Regulation of morphological postsynaptic silent synapses in developing hippocampal neurons.
Nat Neurosci
2:37-43[Web of Science][Medline].
-
Liao D,
Scannevin R,
Huganir RL
(2001)
Activation of silent synapses by rapid activity-dependent synaptic insertion of AMPA receptors.
J Neurosci
21:6008-6017[Abstract/Free Full Text].
-
Marshall CJ
(1996)
Ras effectors.
Curr Opin Cell Biol
8:197-204[Web of Science][Medline].
-
Migaud M,
Charlesworth P,
Dempster M,
Webster LC,
Watabe AM,
Makhinson M,
He Y,
Ramsay MF,
Morris RG,
Morrison JH,
O'Dell TJ,
Grant SG
(1998)
Enhanced long-term potentiation and impaired learning in mice with mutant postsynaptic density-95 protein.
Nature
396:433-439[Medline].
-
Nicoll RA,
Malenka RC
(1995)
Contrasting properties of two forms of long-term potentiation in the hippocampus.
Nature
377:115-118[Medline].
-
Scannevin RH,
Huganir RL
(2000)
Postsynaptic organization and regulation of excitatory synapses.
Nat Neurosci
1:133-141.
-
Sprengel R,
Suchanek B,
Amico C,
Brusa R,
Burnashev N,
Rozov A,
Hvalby O,
Jensen V,
Paulsen O,
Andersen P,
Kim JJ,
Thompson RF,
Sun W,
Webster LC,
Grant SG,
Eilers J,
Konnerth A,
Li J,
McNamara JO,
Seeburg PH
(1998)
Importance of the intracellular domain of NR2 subunits for NMDA receptor function in vivo.
Cell
92:279-289[Web of Science][Medline].
-
Sweatt JD
(2001)
The neuronal MAP kinase cascade: a biochemical signal integration system subserving synaptic plasticity and memory.
J Neurochem
76:1-10[Web of Science][Medline].
-
Ye B,
Liao D,
Zhang X,
Zhang P,
Dong H,
Huganir RL
(2000)
GRASP-1: a neuronal RasGEF associated with the AMPA receptor/GRIP complex.
Neuron
26:603-617[Web of Science][Medline].
-
Zhu JJ,
Qin Y,
Zhao M,
Van Aelst L,
Malinow R
(2002)
Ras and Rap control AMPA receptor trafficking during synaptic plasticity.
Cell
110:443-455[Web of Science][Medline].
Copyright © 2003 Society for Neuroscience 0270-6474/03/2341119-06$05.00/0
This article has been cited by other articles:

|
 |

|
 |
 
F. F. Hamdan, J. Gauthier, D. Spiegelman, A. Noreau, Y. Yang, S. Pellerin, S. Dobrzeniecka, M. Cote, E. Perreault-Linck, L. Carmant, et al.
Mutations in SYNGAP1 in Autosomal Nonsyndromic Mental Retardation
N. Engl. J. Med.,
February 5, 2009;
360(6):
599 - 605.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
H. J. Carlisle, P. Manzerra, E. Marcora, and M. B. Kennedy
SynGAP Regulates Steady-State and Activity-Dependent Phosphorylation of Cofilin
J. Neurosci.,
December 10, 2008;
28(50):
13673 - 13683.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. W. Johnson, H. S. Crombag, K. Takamiya, J. M. Baraban, P. C. Holland, R. L. Huganir, and I. M. Reti
A Selective Role for Neuronal Activity Regulated Pentraxin in the Processing of Sensory-Specific Incentive Value
J. Neurosci.,
December 5, 2007;
27(49):
13430 - 13435.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
I. Ksiazek, C. Burkhardt, S. Lin, R. Seddik, M. Maj, G. Bezakova, M. Jucker, S. Arber, P. Caroni, J. R. Sanes, et al.
Synapse Loss in Cortex of Agrin-Deficient Mice after Genetic Rescue of Perinatal Death
J. Neurosci.,
July 4, 2007;
27(27):
7183 - 7195.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. Iwashita, M. Kobayashi, Y. Kubo, Y. Hinohara, M. Sezaki, K. Nakamura, R. Suzuki-Migishima, M. Yokoyama, S. Sato, M. Fukuda, et al.
Versatile Roles of R-Ras GAP in Neurite Formation of PC12 Cells and Embryonic Vascular Development
J. Biol. Chem.,
February 9, 2007;
282(6):
3413 - 3417.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
G. Rumbaugh, J. P. Adams, J. H. Kim, and R. L. Huganir
Inaugural Article: SynGAP regulates synaptic strength and mitogen-activated protein kinases in cultured neurons
PNAS,
March 21, 2006;
103(12):
4344 - 4351.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. W. Barnett, R. F. Watson, T. Vitalis, K. Porter, N. H. Komiyama, P. N. Stoney, T. H. Gillingwater, S. G. N. Grant, and P. C. Kind
Synaptic Ras GTPase Activating Protein Regulates Pattern Formation in the Trigeminal System of Mice
J. Neurosci.,
February 1, 2006;
26(5):
1355 - 1365.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
L. E. Vazquez, H.-J. Chen, I. Sokolova, I. Knuesel, and M. B. Kennedy
SynGAP Regulates Spine Formation
J. Neurosci.,
October 6, 2004;
24(40):
8862 - 8872.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. Colicelli
Human RAS Superfamily Proteins and Related GTPases
Sci. Signal.,
September 14, 2004;
2004(250):
re13 - re13.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. Zhang, A. Moseley, A. G. Jegga, A. Gupta, D. P. Witte, M. Sartor, M. Medvedovic, S. S. Williams, C. Ley-Ebert, L. M. Coolen, et al.
Neural system-enriched gene expression: relationship to biological pathways and neurological diseases
Physiol Genomics,
July 8, 2004;
18(2):
167 - 183.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. S. Oh, P. Manzerra, and M. B. Kennedy
Regulation of the Neuron-specific Ras GTPase-activating Protein, synGAP, by Ca2+/Calmodulin-dependent Protein Kinase II
J. Biol. Chem.,
April 23, 2004;
279(17):
17980 - 17988.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
T. Tomoda, J. H. Kim, C. Zhan, and M. E. Hatten
Role of Unc51.1 and its binding partners in CNS axon outgrowth
Genes & Dev.,
March 1, 2004;
18(5):
541 - 558.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
K. W. Li, M. P. Hornshaw, R. C. Van der Schors, R. Watson, S. Tate, B. Casetta, C. R. Jimenez, Y. Gouwenberg, E. D. Gundelfinger, K.-H. Smalla, et al.
Proteomics Analysis of Rat Brain Postsynaptic Density: IMPLICATIONS OF THE DIVERSE PROTEIN FUNCTIONAL GROUPS FOR THE INTEGRATION OF SYNAPTIC PHYSIOLOGY
J. Biol. Chem.,
January 9, 2004;
279(2):
987 - 1002.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
L. Cancedda, E. Putignano, S. Impey, L. Maffei, G. M. Ratto, and T. Pizzorusso
Patterned Vision Causes CRE-Mediated Gene Expression in the Visual Cortex through PKA and ERK
J. Neurosci.,
August 6, 2003;
23(18):
7012 - 7020.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C. Thornton, R. Yaka, S. Dinh, and D. Ron
H-Ras Modulates N-Methyl-D-aspartate Receptor Function via Inhibition of Src Tyrosine Kinase Activity
J. Biol. Chem.,
June 20, 2003;
278(26):
23823 - 23829.
[Abstract]
[Full Text]
[PDF]
|
 |
|
|