WWW.JNEUROSCI.ORG
-
The Journal of Neuroscience
 QUICK SEARCH:   [advanced]


     
-


HOME
  |  
SEARCH  |   ARCHIVE  |   SUBSCRIBE  |   CONTACT  |   HELP

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit an eLetter
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Web of Science (50)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Ren, J.
Right arrow Articles by Wevrick, R.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Ren, J.
Right arrow Articles by Wevrick, R.

 Previous Article  |  Next Article 

The Journal of Neuroscience, March 1, 2003, 23(5):1569

BRIEF COMMUNICATION
Absence of Ndn, Encoding the Prader-Willi Syndrome-Deleted Gene necdin, Results in Congenital Deficiency of Central Respiratory Drive in Neonatal Mice

Jun Ren1, *, Syann Lee2, *, Silvia Pagliardini1, Matthieu Gérard3, Colin L. Stewart4, John J. Greer1, and Rachel Wevrick2

1 Centre for Neuroscience, Department of Physiology and 2 Department of Medical Genetics, University of Alberta, Edmonton, Alberta, Canada T6G 2M7, 3 Division of Biochemistry and Molecular Genetics, Commissariat à l'Énergie Atomique Saclay, 91191 Gif-sur-Yvette Cedex, France, and 4 Laboratory of Cancer and Developmental Biology, National Cancer Institute-Frederick Center Research and Development Center, Frederick, Maryland 21702


    ABSTRACT

TOP
ABSTRACT
Introduction
Materials and Methods
Results
Discussion
REFERENCES

necdin (Ndn) is one of a cluster of genes deleted in the neurodevelopmental disorder Prader-Willi syndrome. necdin is upregulated during neuronal differentiation and is thought to play a role in cell cycle arrest in terminally differentiated neurons. Most necdin-deficient Ndntm2Stw mutant pups carrying a targeted replacement of Ndn with a lacZ reporter gene die in the neonatal period of apparent respiratory insufficiency. We now demonstrate that the defect can be explained by abnormal neuronal activity within the putative respiratory rhythm-generating center, the pre-Bötzinger complex. Specifically, the rhythm is unstable with prolonged periods of depression of respiratory rhythmogenesis. These observations suggest that the developing respiratory center is particularly sensitive to loss of necdin activity and may reflect abnormalities of respiratory rhythm-generating neurons or conditioning neuromodulatory drive. We propose that necdin deficiency may contribute to observed respiratory abnormalities in individuals with Prader-Willi syndrome through a similar suppression of central respiratory drive.

Key words: Prader-Willi; apnea; necdin; medulla; breathing; newborn


    Introduction

TOP
ABSTRACT
Introduction
Materials and Methods
Results
Discussion
REFERENCES

necdin (neurally differentiated embryonal carcinoma-cell derived factor) is one of four known protein-coding genes that are deficient in people with Prader-Willi syndrome (PWS) (Jay et al., 1997; MacDonald and Wevrick, 1997; Sutcliffe et al., 1997). PWS is a developmental neurobehavioral disorder (Online Mendelian Inheritance in Man entry number 176270) that occurs sporadically at a frequency of ~1 in 15,000 (Holm et al., 1993). The major manifestations of PWS include neonatal hypotonia and failure to thrive, followed by childhood-onset developmental delay and obesity. Infants with PWS have significant respiratory abnormalities, including sleep-related central and obstructive apneas and reduced response to changes in oxygen and CO2 levels (Arens et al., 1994; Clift et al., 1994; Gozal et al., 1994; Wharton and Loechner, 1996; Schluter et al., 1997; Menendez, 1999; Manni et al., 2001; Nixon and Brouillette, 2002). A subset of genes in the region deleted in PWS, including the NDN gene encoding necdin, are active only on the paternally inherited allele and silenced by imprinting on the maternal allele (Nicholls, 2000). The relative contribution of the loss of each gene to the complex PWS phenotype is as yet unknown, and there are no known cases of PWS attributable to deficiency of only one protein-encoding gene.

necdin was originally identified as a gene upregulated during the retinoic acid-induced differentiation of postnatal day 19 embryonic carcinoma cells into neurons (Maruyama et al., 1991). The expression of necdin in mouse development mirrors the cultured cell system, because necdin is expressed in many but not all postdifferentiation stage neurons. necdin is a member of the MAGE (melanoma antigen-encoding gene)/necdin gene family that also includes MAGEL2, also deficient in PWS (Boccaccio et al., 1999; Lee et al., 2000).

Three necdin-deficient mouse strains were independently generated by homologous recombination in embryonic stem cells (Gerard et al., 1999; Tsai et al., 1999; Muscatelli et al., 2000). In all three strains, heterozygous mice that inherit the mutated allele maternally are indistinguishable from their wild-type littermates, because of imprinting that normally silences the maternal allele. Two necdin-deficient mouse strains carrying a paternally inherited Ndn deletion allele are affected by postnatal lethality. Deficiency of necdin in these mice causes neonatal respiratory distress that is usually fatal, and surviving mice exhibit mildly abnormal behavior (Gerard et al., 1999; Muscatelli et al., 2000). In the original targeted allele of Gérard et al. (1999), there is ~70% lethality in the first 30 postnatal hours. Deletion of the phosphoglycerate kinase-neo cassette present in the original targeted allele increased the lethality to 98% in the Ndntm2Stw necdin-deficient strain (Gerard et al., 1999), possibly because of an effect on nearby genes of the neomycin promoter.

Functional defects of the lungs, respiratory musculature, chemoreception, or central neural control mechanisms could account for the respiratory distress phenotype. In this study, we used in vitro preparations to assess the respiratory neuronal activity at multiple sites along the central neuraxis. Specifically, we test the hypothesis that the hypoventilation results from a defective central respiratory drive in necdin-deficient mice.


    Materials and Methods

TOP
ABSTRACT
Introduction
Materials and Methods
Results
Discussion
REFERENCES

Mouse breeding and genotyping. Procedures for animal care were approved by the Animal Welfare Committee at the University of Alberta. Ndntm2Stw necdin-deficient mice were bred through the maternal line with C57BL/6J male mice. Male offspring carrying a maternally inherited Ndntm2Stw are phenotypically normal and were bred to C57BL/6J females to produce experimental embryos and offspring. In these litters, one-half of the mice are wild type, and one-half carry a paternally inherited necdin deficiency and are functionally null. The timing of pregnancies was determined from the appearance of sperm plugs in the breeding cages [embryonic day 0.5 (E0.5)]. Identification of mutant offspring was performed by PCR genotyping with lacZ oligonucleotide primers (LACZ1942F, 5'GTGTCGTTGCTGCATAAACC; and LACZ2406R, 5'TCGTCTGCTCATCCATGACC) or by histochemical detection of spare tissue. For detection of beta -galactosidase activity, tissue samples were fixed in cold 0.5% paraformaldehyde and 2.5% glutaraldehyde in 0.1 M phosphate buffer, pH 8. The samples were incubated in beta -galactosidase stain until appropriate stain intensity was observed.

Brainstem-spinal cord preparations. Fetal mice (E18.5) were delivered from timed-pregnant mice anesthetized with halothane (1.25-1.5% delivered in 95% O2 and 5% CO2) and maintained at 37°C by radiant heat. Newborn mice were anesthetized by inhalation of metofane (2-3%). Embryos and newborns were decerebrated, and the brainstem-spinal cord with or without the ribcage and diaphragm muscle attached was dissected following procedures similar to those established for perinatal rats (Smith et al., 1990; Greer et al., 1992). The neuraxis was continuously perfused at 27 ± 1°C (perfusion rate of 5 ml/min; chamber volume of 1.5 ml) with mock CSF that contained the following (in mM): 128 NaCl, 3.0 KCl, 1.5 CaCl2, 1.0 MgSO4, 24 NaHCO3, 0.5 NaH2PO4, and 30 D-glucose (equilibrated with 95%O2-5%CO2).

Medullary slice preparations. Details of the preparation have been described previously (Smith et al., 1991). Briefly, the brainstem-spinal cords isolated from perinatal mice as described above were pinned down, ventral surface upward, on a paraffin-coated block. The block was mounted in the vise of a vibratome bath (VT1000S; Leica, Nussloch, Germany). The brainstem was sectioned serially in the transverse plane starting from the rostral medulla to within ~150 µm of the rostral boundary of the pre-Bötzinger complex, as judged by the appearance of the inferior olive. A single transverse slice containing the pre-Bötzinger complex and more caudal reticular formation regions was then cut (~400 µm thick), transferred to a recording chamber, and pinned down onto a Sylgard elastomer. The medullary slice was continuously perfused in physiological solution similar to that used for the brainstem-spinal cord preparation except for the potassium concentration, which was increased to 9 mM to stimulate the spontaneous rhythmic respiratory motor discharge in the medullary slice (Smith et al., 1991).

Recording and analysis. Recordings of hypoglossal (XII) cranial nerve roots, cervical (C4) ventral roots, and diaphragm EMG were made with suction electrodes. Furthermore, suction electrodes were placed into XII nuclei and the pre-Bötzinger complex to record extracellular neuronal population discharge from medullary slice preparations. Signals were amplified, rectified, low-pass filtered, and recorded on a computer using an analog-to-digital converter (Digidata 1200; Axon Instruments, Foster City, CA) and data acquisition software (Axoscope; Axon Instruments). Mean values relative to control for the period and peak integrated amplitude of respiratory motoneuron discharge were calculated. Values given are means, SDs, and coefficients of variability (SD/mean). Statistical significance was tested using paired difference Student's t test; significance was accepted at p values <0.05.

Whole-cell recordings. Recording electrodes were fabricated from thin-wall borosilicate glass (1.5 mm external and 1.12 mm internal diameter; A-M Systems, Everett, WA). The pipette resistances were between 3 and 4 MOmega . The standard pipette solution contained the following (in mM): 130 potassium gluconate, 10 NaCl, 1 CaCl2, 10 BAPTA, 10 HEPES, 5 Mg ATP, and 0.3 NaGTP, pH 7.3 with KOH. Whole-cell current-clamp recordings were initially established in the artificial CSF solution and performed with an NPI Electronics SEC05LX amplifier (NPI Electronics, Tamm, Germany). Liquid junction potentials were corrected before seal formation with the compensation circuitry of the patch-clamp amplifier. Data were digitized with an analog-to-digital interface (Digidata 1322a; Axon Instruments) and analyzed with the use of pClamp 8.0 (Axon Instruments).

RNA in situ hybridization. A cloned PCR product containing partial open reading frame and 3' untranslated region of mouse Ndn (base positions 162-1235; GenBank accession number M80840) was used as a template for riboprobe synthesis. The digoxygenin-labeled RNA antisense riboprobe was synthesized using T7 RNA polymerase and DIG RNA labeling kit (Roche Products, Hertforshire, UK). Cryostat sections, 60 µm thick, were processed for in situ hybridization essentially as described previously (Wilkinson and Nieto, 1993). Processed sections were hybridized on slides at 68°C overnight. Post-hybridization washes were at 68°C with no ribonuclease A treatment. Levamisole (2 mM) was added to all subsequent steps. Slides were preblocked with 5% blocking reagent (Roche Products) before incubation with preabsorbed antibodies for 6 hr at room temperature.


    Results

TOP
ABSTRACT
Introduction
Materials and Methods
Results
Discussion
REFERENCES

Respiratory rhythms are perturbed in Ndntm2Stw mutant newborn mice

In litters of newborn mice born to a heterozygous Ndntm2Stw male and wild-type female, we observed that a subset of pups gasped for air, turned cyanotic, and died over a postnatal time course of a few hours, as noted previously (Gerard et al., 1999; Muscatelli et al., 2000). Nudging the pups caused a transient increase in respiration and loss of cyanosis. Pups exhibiting normal (n = 7) and abnormal (n = 8) respiration were selected, and brainstem-spinal cord preparations were isolated within 20 min of birth. Among pups with abnormal breathing patterns in vivo, seven of eight failed to generate rhythmic motor bursts from cervical or hypoglossal nerve roots in vitro. The remaining pups generated a severely irregular rhythmic motor output. Subsequent genotyping confirmed that preparations with markedly perturbed respiratory rhythms were Ndntm2Stw mutants. Although these data were informative, the fact that newborns with respiratory dysfunction were hypoxic and stressed during the early postnatal period could have been a confounding factor. For instance, the central neural control mechanisms could have been compromised secondarily to a primary defect of lung function or peripheral respiratory afferent input. Therefore, we proceeded to assess the central drive in embryos delivered via cesarean section at E18.5.

Respiratory discharge in Ndntm2Stw mutant embryos at E18.5

Simultaneous suction electrode recordings of inspiratory motor discharge were made from diaphragm muscle and/or hypoglossal (XII) nerve roots in brainstem-spinal cord preparations with the ribcage and diaphragm attached. A total of 36 putative necdin-deficient (abnormal respiratory rhythm) and 22 wild-type E18.5 embryonic mice were subsequently selected for detailed analyses. In each case, postexperimental genotyping confirmed the identity of wild-type and Ndntm2Stw mutant mice. In Ndntm2Stw mutant mice, the rhythms were consistently irregular, with prominent bouts of respiratory depression characterized by burst frequencies of one to three bursts per 10 min period and central apneas persisting for up to several minutes (Fig. 1A). The bouts of suppressed respiratory rhythmic discharge were interspersed with periods of inspiratory motor bursts close to frequencies observed in wild-type preparations (Table 1). There were no marked differences in the amplitude or duration of inspiratory bursts. These recordings demonstrate that the defect in rhythmic motor discharge is present in both cranial and spinal motoneuron populations.



View larger version (63K):
[in this window]
[in a new window]
 
Figure 1.   necdin-deficient Ndntm2Stw mice have irregular respiratory rhythms with prolonged periods of central apnea. A, Sample rectified and integrated suction electrode recordings of diaphragm EMG were made from brainstem-spinal cord-diaphragm preparations isolated from E18.5 wild-type (left) and Ndntm2Stw mutant (right) mice. Recordings of 80 min duration demonstrate the regularity of respiratory discharge frequency (~4-5 sec interspike interval) in wild-type preparations. In contrast, the respiratory frequency is very unstable in mutant preparations over time. B, Defects in respiratory rhythm are observed within the putative respiratory rhythm-generating center. Sample rectified and integrated suction electrode recordings were made from inspiratory neurons located in the pre-Bötzinger complex (PBC) and neurons within the hypoglossal (XII) nucleus in medullary slice preparations isolated from E18.5 wild-type (left) and Ndntm2Stw mutant (right) mice.


                              
View this table:
[in this window]
[in a new window]
 
Table 1.   Characterization of inspiratory bursts in wild-type and mutant embryonic mouse preparations

We selected 18 of the Ndntm2Stw mutant mouse preparations and removed the ribcage and diaphragm musculature. The rhythmic discharge pattern recorded from the fourth cervical root was similar to that recorded from the diaphragm EMG in 7 of 18 preparations. The other 11 Ndntm2Stw mutant mice failed to produce any respiratory motor output from cervical or hypoglossal nerve roots during removal of the ribcage and diaphragm musculature. Presumably, the threshold excitation necessary to achieve rhythmic motor output in these mutants was only achieved with the intact musculature and associated afferent input.

Medullary slice preparations from Ndntm2Stw mutant embryos at E18.5

We recorded rhythmic respiratory discharge from the hypoglossal (XII) motoneuron pool in medullary slice preparations isolated from Ndntm2Stw mutant and wild-type mice (Fig. 1B). The rhythmic neuronal discharge was irregular in all Ndntm2Stw mutant mice (n = 10) but robust and regular in all wild-type (n = 8) preparations. There were no cases in which Ndntm2Stw medullary slice preparations failed to generate some sort of rhythmic motor output. The elevated extracellular K+ (9 mM) provided sufficient excitatory drive to respiratory neuronal populations to reach a threshold for generating a rhythmic, albeit irregular, pattern.

We next determined whether or not the abnormal respiratory rhythm was present within the pre-Bötzinger complex. Suction electrode recordings of population neuronal activity were performed in the region of the pre-Bötzinger complex. The rhythmic discharge of neurons within the pre-Bötzinger complex of mutant preparations had the same abnormal characteristics as the XII motor discharge (Fig. 1B, Table 1). Next, whole-cell patch-clamp recordings of inspiratory neurons within the pre-Bötzinger complex were performed. As illustrated in Figure 2, the neurons fired with an irregular rhythm with prolonged periods of suppressed rhythmogenesis. The resting membrane potential of inspiratory neurons became more depolarized during epochs of increased respiratory rhythmic frequency. There were also bouts of longer-duration bursting activity that is not of respiratory origin (Greer et al., 1992).



View larger version (47K):
[in this window]
[in a new window]
 
Figure 2.   Abnormal rhythmogenesis is apparent from whole-cell patch-clamp recordings from an inspiratory neuron within the pre-Bötzinger complex. A, Rectified and integrated suction electrode recordings were made from the XII nerve roots of a wild-type E18.5 medullary slice preparation. B, Top shows whole-cell patch-clamp recording from an inspiratory neuron located within the region of the pre-Bötzinger complex. Middle shows the simultaneous recording from the XII nerve root. Bottom shows the whole-cell and nerve root recordings on a shorter time scale. The traces were taken from the areas demarcated in the middle panel with horizontal bars. The rhythmic discharge fluctuates between periods of very slow rhythms (left bottom) to those in which the respiratory rhythm is similar in frequency to wild-type preparations (middle bottom). There are also occurrences of high-frequency nonrespiratory bursts (right bottom). Inset shows whole-cell and integrated nerve recordings during a single inspiratory burst.

necdin mRNA expression in the medulla

Previous investigations of necdin gene expression by RNA in situ hybridization or immunohistochemistry had focused on the cerebrum, cerebellum, and the hypothalamus (Uetsuki et al., 1996; Niinobe et al., 2000). Expression of the Ndntm2Stw lacZ reporter gene had been noted in the medulla, spinal cord, and dorsal root ganglia in E17 embryos (Gerard et al., 1999). We examined the expression of necdin by RNA in situ hybridization in wild-type medullary sections at E15.5, when respiratory activity commences, and E18.5, the stage used for electrophysiological recordings. This experiment was to determine whether only subpopulations of neurons express necdin, as observed in other structures of the nervous system. necdin expression was evident in the ventrolateral medulla in which the respiratory rhythm generator is located, but levels here were not significantly different from in other medullary regions (Fig. 3).



View larger version (54K):
[in this window]
[in a new window]
 
Figure 3.   necdin is expressed in the fetal medulla. A, Expression of Ndn in E18.5 medullary transverse section equivalent to those used for electrophysiological studies. B, Photo of labeling in the ventrolateral medulla (pre-Bötzinger complex area approximated by dashed line). C, Higher-power photo of the pre-Bötzinger complex region. NA, Nucleus ambiguous; X, nucleus of the tenth nerve (vagus); XII, nucleus of the twelfth nerve (hypoglossal). Scale bars: A, 200 µm; B, 50 µm; C, 25 µm.


    Discussion

TOP
ABSTRACT
Introduction
Materials and Methods
Results
Discussion
REFERENCES

necdin-deficient Ndntm2Stw newborn mice hypoventilate, rapidly turn cyanotic, and die. We sought to assess centrally generated respiratory rhythmogenesis and drive transmission in isolation from other aspects of the respiratory system (e.g., lung function and peripheral afferent feedback). The brainstem-spinal cord-diaphragm preparation has been well characterized and shown to generate a complex, coordinated pattern of respiratory activity (Smith et al., 1990). Recordings of diaphragmatic EMG, cervical ventral roots, and hypoglossal roots provide information regarding inspiratory drive transmission to key components of the respiratory motor system. The respiratory motor discharge produced by wild-type mice preparations at E18.5 were regular and at a frequency similar to newborn pups. In marked contrast, the motor patterns generated by the preparations from Ndntm2Stw mice were very irregular, with prominent bouts of depression of respiratory rhythmogenesis that would account for the hypoventilation observed in newborn Ndntm2Stw mice in vivo. The abnormal respiratory discharge pattern was present at the level of the diaphragm, cervical ventral roots, cranial motoneuron pools and within neurons located in the putative respiratory rhythm-generating center, the pre-Bötzinger complex.

These data indicate that the defect in Ndntm2Stw mutant mice can be explained by abnormal respiratory rhythmogenesis emanating from the medulla. Data from in vitro (Smith et al., 1991) and in vivo (Ramirez et al., 1998; Solomon et al., 1999; Gray et al., 2001) models strongly suggest that a well defined region of the ventrolateral medulla, the pre-Bötzinger complex, is a major contributor to the genesis of respiratory rhythm. A detailed understanding of the cellular mechanisms underlying rhythm and pattern generation with the ventrolateral medulla remains to be elucidated. However, there are data to support a pacemaker-network hypothesis, which states that the kernel for rhythm generation consists of a population of neurons with intrinsic pacemaker properties that are embedded within, and modulated by, a neuronal network (Rekling and Feldman, 1998; Smith et al., 2000). It has been postulated that the pacemaker properties arise from intrinsic voltage-dependent conductances that confer increases in burst frequency at depolarized membrane potentials and decreases, to the point of inhibiting rhythmic bursting, at hyperpolarized membrane potentials (Smith et al., 1991; Butera et al., 1999a,b). The primary conditioning excitatory drive that maintains the oscillatory state arises from activation of glutaminergic receptors (Greer et al., 1991; Funk et al., 1993). Additional conditioning is provided by a diverse group of neuromodulators, including GABA, serotonin, noradrenaline, opioids, prostaglandins, substance P, and acetylcholine (Lagercrantz, 1987; Moss and Inman, 1989; Ballanyi et al., 1999). Thus, absence of necdin expression could result in the loss, or perturbation of function, of rhythmogenic neurons in the pre-Bötzinger complex. This is the proposed abnormality in Rnx-deficient mice, which also have a central respiratory defect, possibly attributable to altered cell-fate commitment of respiratory neurons attributable to loss of this homeobox transcription factor (Shirasawa et al., 2000; Qian et al., 2001). Alternatively, necdin expression may be necessary for the proper functioning of neurons providing appropriate conditioning drive impinging on rhythmogenic neurons within the pre-Bötzinger complex.

People with PWS are deficient for multiple genes, including necdin. Although many aspects of PWS can be related to a basic defect in hypothalamic development, development of other systems is probably also compromised in PWS. Abnormal ventilatory responses to hyperoxia, hypoxia, and hypercapnia when awake and sleeping are noted in PWS patients (Arens et al., 1994; Gozal et al., 1994; Schluter et al., 1997; Menendez, 1999). Furthermore, there are reports of sleep-related central and obstructive apnea (Clift et al., 1994; Wharton and Loechner, 1996; Manni et al., 2001; Nixon and Brouillette, 2002). A report of a 29 week premature infant with PWS who required prolonged ventilatory support points to a prenatal onset of respiratory dysfunction in PWS (MacDonald and Camp, 2001). The sleep-related breathing problems likely contribute significantly to the excessive daytime sleepiness in childhood and adulthood that is characteristic of PWS (Hertz et al., 1995). Aside from one report showing reduced number of oxytocin neurons in the hypothalamic paraventricular nucleus, no abnormal pathological findings have been noted in PWS individuals at autopsy (Swaab et al., 1995). Our study now suggests that loss of necdin is implicated in abnormal respiration in PWS infants, and we hypothesize that necdin may be important for normal respiratory activity in the human newborn medulla.


    FOOTNOTES

Received Oct. 23, 2002; revised Nov. 27, 2002; accepted Dec. 6, 2002.

* J.R. and S.L. contributed equally to this work.

This work was supported by the Canadian Institutes of Health Research (CIHR) (J.J.G.), March of Dimes Birth Defects Foundation Research Grant 6-FY00-196 (R.W.), a CIHR-Alberta Sudden Infant Death Syndrome Foundation Fellowship (J.R.), and Graduate Studentships to S.L. and S.P. from the Alberta Heritage Foundation for Medical Research (AHFMR). R.W. is a Scholar of the AHFMR and CIHR, and J.J.G. is a Senior Scholar of the AHFMR. We thank personnel in the Health Science Laboratory Animal Service, particularly Brenda Roszell for mouse handling. We thank Sharee Kuny for technical assistance and Dr. Serguei Kozlov for useful discussions.

Correspondence should be addressed to John Greer at the above address. E-mail: john.greer{at}ualberta.ca.


    References

TOP
ABSTRACT
Introduction
Materials and Methods
Results
Discussion
REFERENCES

  • Arens R, Gozal D, Omlin KJ, Livingston FR, Liu J, Keens TG, Ward SL (1994) Hypoxic and hypercapnic ventilatory responses in Prader-Willi syndrome. J Appl Physiol 77:2224-2230[Abstract/Free Full Text].
  • Ballanyi K, Onimaru H, Homma I (1999) Respiratory network function in the isolated brainstem-spinal cord of newborn rats. Prog Neurobiol 59:583-634[Web of Science][Medline].
  • Boccaccio I, Glatt-Deeley H, Watrin F, Roeckel N, Lalande M, Muscatelli F (1999) The human MAGEL2 gene and its mouse homologue are paternally expressed and mapped to the Prader-Willi region. Hum Mol Genet 8:2497-2505[Abstract/Free Full Text].
  • Butera Jr RJ, Rinzel J, Smith JC (1999a) Models of respiratory rhythm generation in the pre-Botzinger complex. I. Bursting pacemaker neurons. J Neurophysiol 82:382-397[Abstract/Free Full Text].
  • Butera Jr RJ, Rinzel J, Smith JC (1999b) Models of respiratory rhythm generation in the pre-Botzinger complex. II. Populations of coupled pacemaker neurons. J Neurophysiol 82:398-415[Abstract/Free Full Text].
  • Clift S, Dahlitz M, Parkes JD (1994) Sleep apnoea in the Prader-Willi syndrome. J Sleep Res 3:121-126[Web of Science][Medline].
  • Funk GD, Smith JC, Feldman JL (1993) Generation and transmission of respiratory oscillations in medullary slices: role of excitatory amino acids. J Neurophysiol 70:1497-1515[Abstract/Free Full Text].
  • Gerard M, Hernandez L, Wevrick R, Stewart C (1999) Disruption of the mouse necdin gene results in early postnatal lethality: a model for neonatal distress in Prader-Willi syndrome. Nat Genet 23:199-202[Web of Science][Medline].
  • Gozal D, Arens R, Omlin KJ, Ward SL, Keens TG (1994) Absent peripheral chemosensitivity in Prader-Willi syndrome. J Appl Physiol 77:2231-2236[Abstract/Free Full Text].
  • Gray PA, Janczewski WA, Mellen N, McCrimmon DR, Feldman JL (2001) Normal breathing requires preBotzinger complex neurokinin-1 receptor-expressing neurons. Nat Neurosci 4:927-930[Web of Science][Medline].
  • Greer JJ, Smith JC, Feldman JL (1991) Role of excitatory amino acids in the generation and transmission of respiratory drive in neonatal rat. J Physiol (Lond) 437:727-749[Abstract/Free Full Text].
  • Greer JJ, Smith JC, Feldman JL (1992) Respiratory and locomotor patterns generated in the fetal rat brain stem-spinal cord in vitro. J Neurophysiol 67:996-999[Abstract/Free Full Text].
  • Hertz G, Cataletto M, Feinsilver SH, Angulo M (1995) Developmental trends of sleep-disordered breathing in Prader-Willi syndrome: the role of obesity. Am J Med Genet 56:188-190[Web of Science][Medline].
  • Holm VA, Cassidy SB, Butler MG, Hanchett JM, Greenswag LR, Whitman BY, Greenberg F (1993) Prader-Willi syndrome: consensus diagnostic criteria. Pediatrics 91:398-402[Abstract/Free Full Text].
  • Jay P, Rougeulle C, Massacrier A, Moncla A, Mattei MG, Malzac P, Roeckel N, Taviaux S, Lefranc JL, Cau P, Berta P, Lalande M, Muscatelli F (1997) The human necdin gene, NDN, is maternally imprinted and located in the Prader-Willi syndrome chromosomal region. Nat Genet 17:357-361[Web of Science][Medline].
  • Lagercrantz H (1987) Neuromodulators and respiratory control during development. Trends Neurosci 10:368-372[Web of Science].
  • Lee S, Kozlov S, Hernandez L, Chamberlain SJ, Brannan CI, Stewart CL, Wevrick R (2000) Expression and imprinting of MAGEL2 suggest a role in Prader-Willi syndrome and the homologous murine imprinting phenotype. Hum Mol Genet 9:1813-1819[Abstract/Free Full Text].
  • MacDonald HR, Wevrick R (1997) The necdin gene is deleted in Prader-Willi syndrome and is imprinted in human and mouse. Hum Mol Genet 6:1873-1878[Abstract/Free Full Text].
  • MacDonald JT, Camp D (2001) Prolonged but reversible respiratory failure in a newborn with Prader-Willi syndrome. J Child Neurol 16:153-154[Abstract/Free Full Text].
  • Manni R, Politini L, Nobili L, Ferrillo F, Livieri C, Veneselli E, Biancheri R, Martinetti M, Tartara A (2001) Hypersomnia in the Prader Willi syndrome: clinical-electrophysiological features and underlying factors. Clin Neurophysiol 112:800-805[Web of Science][Medline].
  • Maruyama K, Usami M, Aizawa T, Yoshikawa K (1991) A novel brain-specific mRNA encoding nuclear protein (necdin) expressed in neurally differentiated embryonal carcinoma cells. Biochem Biophys Res Commun 178:291-296[Web of Science][Medline].
  • Menendez AA (1999) Abnormal ventilatory responses in patients with Prader-Willi syndrome. Eur J Pediatr 158:941-942[Web of Science][Medline].
  • Moss IR, Inman JG (1989) Neurochemicals and respiratory control during development. J Appl Physiol 67:1-13[Abstract/Free Full Text].
  • Muscatelli F, Abrous DN, Massacrier A, Boccaccio I, Moal ML, Cau P, Cremer H (2000) Disruption of the mouse necdin gene results in hypothalamic and behavioral alterations reminiscent of the human Prader-Willi syndrome. Hum Mol Genet 9:3101-3110[Abstract/Free Full Text].
  • Nicholls RD (2000) The impact of genomic imprinting for neurobehavioral and developmental disorders. J Clin Invest 105:413-418[Web of Science][Medline].
  • Niinobe M, Koyama K, Yoshikawa K (2000) Cellular and subcellular localization of necdin in fetal and adult mouse brain. Dev Neurosci 22:310-319[Web of Science][Medline].
  • Nixon GM, Brouillette RT (2002) Sleep and breathing in Prader-Willi syndrome. Pediatr Pulmonol 34:209-217[Web of Science][Medline].
  • Qian Y, Fritzsch B, Shirasawa S, Chen CL, Choi Y, Ma Q (2001) Formation of brainstem (nor)adrenergic centers and first-order relay visceral sensory neurons is dependent on homeodomain protein Rnx/Tlx3. Genes Dev 15:2533-2545[Abstract/Free Full Text].
  • Ramirez JM, Schwarzacher SW, Pierrefiche O, Olivera BM, Richter DW (1998) Selective lesioning of the cat pre-Botzinger complex in vivo eliminates breathing but not gasping. J Physiol (Lond) 507:895-907[Abstract/Free Full Text].
  • Rekling JC, Feldman JL (1998) PreBotzinger complex and pacemaker neurons: hypothesized site and kernel for respiratory rhythm generation. Annu Rev Physiol 60:385-405[Web of Science][Medline].
  • Schluter B, Buschatz D, Trowitzsch E, Aksu F, Andler W (1997) Respiratory control in children with Prader-Willi syndrome. Eur J Pediatr 156:65-68[Medline].
  • Shirasawa S, Arata A, Onimaru H, Roth KA, Brown GA, Horning S, Arata S, Okumura K, Sasazuki T, Korsmeyer SJ (2000) Rnx deficiency results in congenital central hypoventilation. Nat Genet 24:287-290[Web of Science][Medline].
  • Smith JC, Greer JJ, Liu GS, Feldman JL (1990) Neural mechanisms generating respiratory pattern in mammalian brain stem-spinal cord in vitro. I. Spatiotemporal patterns of motor and medullary neuron activity. J Neurophysiol 64:1149-1169[Abstract/Free Full Text].
  • Smith JC, Ellengerger HH, Ballanyi K, Richter DW, Feldman JL (1991) Pre-Bötzinger complex: a brainstem region that may generate respiratory rhythm in mammals. Science 254:726-728[Abstract/Free Full Text].
  • Smith JC, Butera RJ, Koshiya N, Del Negro C, Wilson CG, Johnson SM (2000) Respiratory rhythm generation in neonatal and adult mammals: the hybrid pacemaker-network model. Respir Physiol 122:131-147[Web of Science][Medline].
  • Solomon IC, Edelman NH, Neubauer JA (1999) Patterns of phrenic motor output evoked by chemical stimulation of neurons located in the pre-Botzinger complex in vivo. J Neurophysiol 81:1150-1161[Abstract/Free Full Text].
  • Sutcliffe JS, Han M, Christian SL, Ledbetter DH (1997) Neuronally-expressed necdin gene: an imprinted candidate gene in Prader-Willi syndrome. Lancet 350:1520-1521[Web of Science][Medline].
  • Swaab DF, Purba JS, Hofman MA (1995) Alterations in the hypothalamic paraventricular nucleus and its oxytocin neurons (putative satiety cells) in Prader-Willi syndrome: a study of five cases. J Clin Endocrinol Metab 80:573-579[Abstract].
  • Tsai TF, Armstrong D, Beaudet AL (1999) Necdin-deficient mice do not show lethality or the obesity and infertility of Prader-Willi syndrome. Nat Genet 22:15-16[Web of Science][Medline].
  • Uetsuki T, Takagi K, Sugiura H, Yoshikawa K (1996) Structure and expression of the mouse necdin gene. Identification of a postmitotic neuron-restrictive core promoter. J Biol Chem 271:918-924[Abstract/Free Full Text].
  • Wharton RH, Loechner KJ (1996) Genetic and clinical advances in Prader-Willi syndrome. Curr Opin Pediatr 8:618-624[Medline].
  • Wilkinson DG, Nieto MA (1993) Detection of messenger RNA by in situ hybridization to tissue sections and whole mounts. Methods Enzymol 225:361-373[Web of Science][Medline].


Copyright © 2003 Society for Neuroscience  0270-6474/03/2351569-05$05.00/0


This article has been cited by other articles:


Home page
Hum Mol GenetHome page
N. L.G. Miller, R. Wevrick, and P. L. Mellon
Necdin, a Prader-Willi syndrome candidate gene, regulates gonadotropin-releasing hormone neurons during development
Hum. Mol. Genet., January 15, 2009; 18(2): 248 - 260.
[Abstract] [Full Text] [PDF]


Home page
J. Neurosci.Home page
K. Hasegawa and K. Yoshikawa
Necdin Regulates p53 Acetylation via Sirtuin1 to Modulate DNA Damage Response in Cortical Neurons
J. Neurosci., August 27, 2008; 28(35): 8772 - 8784.
[Abstract] [Full Text] [PDF]


Home page
J. Appl. Physiol.Home page
C. Gaultier and J Gallego
Neural control of breathing: insights from genetic mouse models
J Appl Physiol, May 1, 2008; 104(5): 1522 - 1530.
[Abstract] [Full Text] [PDF]


Home page
J. Neurosci.Home page
S. Zanella, F. Watrin, S. Mebarek, F. Marly, M. Roussel, C. Gire, G. Diene, M. Tauber, F. Muscatelli, and G. Hilaire
Necdin Plays a Role in the Serotonergic Modulation of the Mouse Respiratory Network: Implication for Prader-Willi Syndrome
J. Neurosci., February 13, 2008; 28(7): 1745 - 1755.
[Abstract] [Full Text] [PDF]


Home page
Hum Mol GenetHome page
J. M. Bischof, C. L. Stewart, and R. Wevrick
Inactivation of the mouse Magel2 gene results in growth abnormalities similar to Prader-Willi syndrome
Hum. Mol. Genet., November 15, 2007; 16(22): 2713 - 2719.
[Abstract] [Full Text] [PDF]


Home page
Physiol. GenomicsHome page
N. Lopez-Sanchez, Z. Gonzalez-Fernandez, M. Niinobe, K. Yoshikawa, and J. M. Frade
Single mage gene in the chicken genome encodes CMage, a protein with functional similarities to mammalian type II Mage proteins
Physiol Genomics, July 18, 2007; 30(2): 156 - 171.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
D. A. M. Festen, A. W. de Weerd, R. A. S. van den Bossche, K. Joosten, H. Hoeve, and A. C. S. Hokken-Koelega
Sleep-Related Breathing Disorders in Prepubertal Children with Prader-Willi Syndrome and Effects of Growth Hormone Treatment
J. Clin. Endocrinol. Metab., December 1, 2006; 91(12): 4911 - 4915.
[Abstract] [Full Text] [PDF]


Home page
J. Neurosci.Home page
M. Kurita, T. Kuwajima, I. Nishimura, and K. Yoshikawa
Necdin Downregulates Cdc2 Expression to Attenuate Neuronal Apoptosis.
J. Neurosci., November 15, 2006; 26(46): 12003 - 12013.
[Abstract] [Full Text] [PDF]


Home page
J. Appl. Physiol.Home page
H. V. Forster, P. M. Lalley, J. Greer, E. E. Nattie, A. Li, C. A. D. Negro, P. A. Gray, M. Dutschmann, I. A. Rybak, T. E. Dick, et al.
The parafacial respiratory group (pFRG)/pre-Botzinger complex (preBotC) is the primary site of respiratory rhythm generation in the mammal
J Appl Physiol, June 1, 2006; 100(6): 2103 - 2108.
[Full Text] [PDF]


Home page
J. Neurosci.Home page
T. Kuwajima, I. Nishimura, and K. Yoshikawa
Necdin promotes GABAergic neuron differentiation in cooperation with Dlx homeodomain proteins.
J. Neurosci., May 17, 2006; 26(20): 5383 - 5392.
[Abstract] [Full Text] [PDF]


Home page
J. Physiol.Home page
J. J. Greer, G. D. Funk, and K. Ballanyi
Preparing for the first breath: prenatal maturation of respiratory neural control
J. Physiol., February 1, 2006; 570(3): 437 - 444.
[Abstract] [Full Text] [PDF]


Home page
J. Neurosci.Home page
K.-i. Kuwako, A. Hosokawa, I. Nishimura, T. Uetsuki, M. Yamada, S. Nada, M. Okada, and K. Yoshikawa
Disruption of the Paternal Necdin Gene Diminishes TrkA Signaling for Sensory Neuron Survival
J. Neurosci., July 27, 2005; 25(30): 7090 - 7099.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Pathol.Home page
S. Pagliardini, J. Ren, R. Wevrick, and J. J. Greer
Developmental Abnormalities of Neuronal Structure and Function in Prenatal Mice Lacking the Prader-Willi Syndrome Gene Necdin
Am. J. Pathol., July 1, 2005; 167(1): 175 - 191.
[Abstract] [Full Text] [PDF]


Home page
Hum Mol GenetHome page
M. J. O'Neill
The influence of non-coding RNAs on allele-specific gene expression in mammals
Hum. Mol. Genet., April 15, 2005; 14(suppl_1): R113 - R120.
[Abstract] [Full Text] [PDF]


Home page
Hum Mol GenetHome page
S. Lee, C. L. Walker, B. Karten, S. L. Kuny, A. A. Tennese, M. A. O'Neill, and R. Wevrick
Essential role for the Prader-Willi syndrome protein necdin in axonal outgrowth
Hum. Mol. Genet., March 1, 2005; 14(5): 627 - 637.
[Abstract] [Full Text] [PDF]


Home page
Hum Mol GenetHome page
S. J. Chamberlain, K. A. Johnstone, A. J. DuBose, T. A. Simon, M. S. Bartolomei, J. L. Resnick, and C. I. Brannan
Evidence for genetic modifiers of postnatal lethality in PWS-IC deletion mice
Hum. Mol. Genet., December 1, 2004; 13(23): 2971 - 2977.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
T. Kuwajima, H. Taniura, I. Nishimura, and K. Yoshikawa
Necdin Interacts with the Msx2 Homeodomain Protein via MAGE-D1 to Promote Myogenic Differentiation of C2C12 Cells
J. Biol. Chem., September 24, 2004; 279(39): 40484 - 40493.
[Abstract] [Full Text] [PDF]


Home page
GeneticsHome page
B. M. Cattanach, C. V. Beechey, and J. Peters
Interactions Between Imprinting Effects in the Mouse
Genetics, September 1, 2004; 168(1): 397 - 413.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
K.-i. Kuwako, H. Taniura, and K. Yoshikawa
Necdin-related MAGE Proteins Differentially Interact with the E2F1 Transcription Factor and the p75 Neurotrophin Receptor
J. Biol. Chem., January 16, 2004; 279(3): 1703 - 1712.
[Abstract] [Full Text] [PDF]


Home page
J. Neurosci.Home page
S. Pagliardini, J. Ren, and J. J. Greer
Ontogeny of the Pre-Botzinger Complex in Perinatal Rats
J. Neurosci., October 22, 2003; 23(29): 9575 - 9584.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit an eLetter
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Web of Science (50)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Ren, J.
Right arrow Articles by Wevrick, R.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Ren, J.
Right arrow Articles by Wevrick, R.

-
-

Home  |   Search  |   Archive  |   Subscribe  |   Contact  |   Help

-
Copyright 2009 by Society for Neuroscience ONLINE ISSN: 1529-2401
-