 |
Previous Article | Next Article 
The Journal of Neuroscience, March 1, 2003, 23(5):1569
BRIEF COMMUNICATION
Absence of Ndn, Encoding the Prader-Willi
Syndrome-Deleted Gene necdin, Results in Congenital
Deficiency of Central Respiratory Drive in Neonatal Mice
Jun
Ren1, *,
Syann
Lee2, *,
Silvia
Pagliardini1,
Matthieu
Gérard3,
Colin L.
Stewart4,
John J.
Greer1, and
Rachel
Wevrick2
1 Centre for Neuroscience, Department of Physiology and
2 Department of Medical Genetics, University of Alberta,
Edmonton, Alberta, Canada T6G 2M7, 3 Division of
Biochemistry and Molecular Genetics, Commissariat à
l'Énergie Atomique Saclay, 91191 Gif-sur-Yvette Cedex, France,
and 4 Laboratory of Cancer and Developmental Biology,
National Cancer Institute-Frederick Center Research and Development
Center, Frederick, Maryland 21702
 |
ABSTRACT |
necdin (Ndn) is one of a
cluster of genes deleted in the neurodevelopmental disorder
Prader-Willi syndrome. necdin is upregulated during
neuronal differentiation and is thought to play a role in cell cycle
arrest in terminally differentiated neurons. Most necdin-deficient
Ndntm2Stw mutant pups carrying a
targeted replacement of Ndn with a lacZ reporter gene die in the neonatal period of apparent respiratory insufficiency. We now demonstrate that the defect can be explained by
abnormal neuronal activity within the putative respiratory rhythm-generating center, the pre-Bötzinger complex.
Specifically, the rhythm is unstable with prolonged periods of
depression of respiratory rhythmogenesis. These observations suggest
that the developing respiratory center is particularly sensitive to
loss of necdin activity and may reflect abnormalities of
respiratory rhythm-generating neurons or conditioning neuromodulatory
drive. We propose that necdin deficiency may contribute
to observed respiratory abnormalities in individuals with Prader-Willi
syndrome through a similar suppression of central respiratory
drive.
Key words:
Prader-Willi; apnea; necdin; medulla; breathing; newborn
 |
Introduction |
necdin (neurally
differentiated embryonal carcinoma-cell derived factor) is one of four
known protein-coding genes that are deficient in people with
Prader-Willi syndrome (PWS) (Jay et al., 1997 ; MacDonald and Wevrick,
1997 ; Sutcliffe et al., 1997 ). PWS is a developmental neurobehavioral
disorder (Online Mendelian Inheritance in Man entry number 176270) that
occurs sporadically at a frequency of ~1 in 15,000 (Holm et al.,
1993 ). The major manifestations of PWS include neonatal hypotonia and
failure to thrive, followed by childhood-onset developmental delay and
obesity. Infants with PWS have significant respiratory abnormalities,
including sleep-related central and obstructive apneas and reduced
response to changes in oxygen and CO2 levels
(Arens et al., 1994 ; Clift et al., 1994 ; Gozal et al., 1994 ; Wharton
and Loechner, 1996 ; Schluter et al., 1997 ; Menendez, 1999 ; Manni et
al., 2001 ; Nixon and Brouillette, 2002 ). A subset of genes in the
region deleted in PWS, including the NDN gene encoding
necdin, are active only on the paternally inherited allele
and silenced by imprinting on the maternal allele (Nicholls, 2000 ). The
relative contribution of the loss of each gene to the complex PWS
phenotype is as yet unknown, and there are no known cases of PWS
attributable to deficiency of only one protein-encoding gene.
necdin was originally identified as a gene upregulated
during the retinoic acid-induced differentiation of postnatal day
19 embryonic carcinoma cells into neurons (Maruyama et al.,
1991 ). The expression of necdin in mouse development mirrors
the cultured cell system, because necdin is expressed in
many but not all postdifferentiation stage neurons. necdin
is a member of the MAGE (melanoma antigen-encoding gene)/necdin gene family that also includes
MAGEL2, also deficient in PWS (Boccaccio et al., 1999 ; Lee
et al., 2000 ).
Three necdin-deficient mouse strains were independently
generated by homologous recombination in embryonic stem cells
(Gerard et al., 1999 ; Tsai et al., 1999 ; Muscatelli et al., 2000 ). In all three strains, heterozygous mice that inherit the mutated allele
maternally are indistinguishable from their wild-type littermates, because of imprinting that normally silences the maternal allele. Two
necdin-deficient mouse strains carrying a paternally
inherited Ndn deletion allele are affected by postnatal
lethality. Deficiency of necdin in these mice causes
neonatal respiratory distress that is usually fatal, and surviving mice
exhibit mildly abnormal behavior (Gerard et al., 1999 ; Muscatelli et
al., 2000 ). In the original targeted allele of Gérard et al.
(1999) , there is ~70% lethality in the first 30 postnatal hours.
Deletion of the phosphoglycerate kinase-neo cassette present in
the original targeted allele increased the lethality to 98% in the
Ndntm2Stw necdin-deficient
strain (Gerard et al., 1999 ), possibly because of an effect on nearby
genes of the neomycin promoter.
Functional defects of the lungs, respiratory musculature,
chemoreception, or central neural control mechanisms could account for
the respiratory distress phenotype. In this study, we used in
vitro preparations to assess the respiratory neuronal activity at
multiple sites along the central neuraxis. Specifically, we test the
hypothesis that the hypoventilation results from a defective central
respiratory drive in necdin-deficient mice.
 |
Materials and Methods |
Mouse breeding and genotyping. Procedures for animal
care were approved by the Animal Welfare Committee at the University of
Alberta. Ndntm2Stw
necdin-deficient mice were bred through the maternal line
with C57BL/6J male mice. Male offspring carrying a maternally inherited Ndntm2Stw are phenotypically normal and
were bred to C57BL/6J females to produce experimental embryos and
offspring. In these litters, one-half of the mice are wild type, and
one-half carry a paternally inherited necdin deficiency and
are functionally null. The timing of pregnancies was determined from
the appearance of sperm plugs in the breeding cages [embryonic day 0.5 (E0.5)]. Identification of mutant offspring was performed by PCR
genotyping with lacZ oligonucleotide primers
(LACZ1942F, 5'GTGTCGTTGCTGCATAAACC; and LACZ2406R,
5'TCGTCTGCTCATCCATGACC) or by histochemical detection of spare tissue.
For detection of -galactosidase activity, tissue samples were fixed
in cold 0.5% paraformaldehyde and 2.5% glutaraldehyde in 0.1 M phosphate buffer, pH 8. The samples were
incubated in -galactosidase stain until appropriate stain intensity
was observed.
Brainstem-spinal cord preparations. Fetal mice (E18.5) were
delivered from timed-pregnant mice anesthetized with halothane (1.25-1.5% delivered in 95% O2 and 5%
CO2) and maintained at 37°C by radiant heat.
Newborn mice were anesthetized by inhalation of metofane (2-3%).
Embryos and newborns were decerebrated, and the brainstem-spinal cord
with or without the ribcage and diaphragm muscle attached was dissected
following procedures similar to those established for perinatal rats
(Smith et al., 1990 ; Greer et al., 1992 ). The neuraxis was continuously
perfused at 27 ± 1°C (perfusion rate of 5 ml/min; chamber
volume of 1.5 ml) with mock CSF that contained the following (in
mM): 128 NaCl, 3.0 KCl, 1.5 CaCl2, 1.0 MgSO4, 24 NaHCO3, 0.5 NaH2PO4, and 30 D-glucose (equilibrated with
95%O2-5%CO2).
Medullary slice preparations. Details of the preparation
have been described previously (Smith et al., 1991 ). Briefly, the brainstem-spinal cords isolated from perinatal mice as described above
were pinned down, ventral surface upward, on a paraffin-coated block.
The block was mounted in the vise of a vibratome bath (VT1000S; Leica, Nussloch, Germany). The brainstem was
sectioned serially in the transverse plane starting from the rostral
medulla to within ~150 µm of the rostral boundary of the
pre-Bötzinger complex, as judged by the appearance of the
inferior olive. A single transverse slice containing the
pre-Bötzinger complex and more caudal reticular formation regions
was then cut (~400 µm thick), transferred to a recording chamber,
and pinned down onto a Sylgard elastomer. The medullary slice was
continuously perfused in physiological solution similar to that used
for the brainstem-spinal cord preparation except for the potassium
concentration, which was increased to 9 mM to
stimulate the spontaneous rhythmic respiratory motor discharge in the
medullary slice (Smith et al., 1991 ).
Recording and analysis. Recordings of hypoglossal (XII)
cranial nerve roots, cervical (C4) ventral roots, and diaphragm EMG were made with suction electrodes. Furthermore, suction electrodes were
placed into XII nuclei and the pre-Bötzinger complex to record
extracellular neuronal population discharge from medullary slice
preparations. Signals were amplified, rectified, low-pass filtered, and
recorded on a computer using an analog-to-digital converter (Digidata
1200; Axon Instruments, Foster City, CA) and data
acquisition software (Axoscope; Axon Instruments). Mean
values relative to control for the period and peak integrated amplitude of respiratory motoneuron discharge were calculated. Values given are
means, SDs, and coefficients of variability (SD/mean).
Statistical significance was tested using paired difference Student's
t test; significance was accepted at p values
<0.05.
Whole-cell recordings. Recording electrodes were fabricated
from thin-wall borosilicate glass (1.5 mm external and 1.12 mm internal
diameter; A-M Systems, Everett, WA). The pipette
resistances were between 3 and 4 M . The standard pipette solution
contained the following (in mM): 130 potassium
gluconate, 10 NaCl, 1 CaCl2, 10 BAPTA, 10 HEPES,
5 Mg ATP, and 0.3 NaGTP, pH 7.3 with KOH. Whole-cell current-clamp
recordings were initially established in the artificial CSF solution
and performed with an NPI Electronics SEC05LX amplifier (NPI
Electronics, Tamm, Germany). Liquid junction potentials were corrected
before seal formation with the compensation circuitry of the
patch-clamp amplifier. Data were digitized with an analog-to-digital
interface (Digidata 1322a; Axon Instruments) and analyzed
with the use of pClamp 8.0 (Axon Instruments).
RNA in situ hybridization. A cloned PCR product
containing partial open reading frame and 3' untranslated region of
mouse Ndn (base positions 162-1235; GenBank accession
number M80840) was used as a template for riboprobe synthesis. The
digoxygenin-labeled RNA antisense riboprobe was synthesized using T7
RNA polymerase and DIG RNA labeling kit (Roche Products,
Hertforshire, UK). Cryostat sections, 60 µm thick, were processed for
in situ hybridization essentially as described previously
(Wilkinson and Nieto, 1993 ). Processed sections were hybridized on
slides at 68°C overnight. Post-hybridization washes were at 68°C
with no ribonuclease A treatment. Levamisole (2 mM) was added to all subsequent steps. Slides
were preblocked with 5% blocking reagent (Roche Products) before incubation with preabsorbed antibodies for 6 hr at room temperature.
 |
Results |
Respiratory rhythms are perturbed in
Ndntm2Stw mutant newborn mice
In litters of newborn mice born to a heterozygous
Ndntm2Stw male and wild-type female, we
observed that a subset of pups gasped for air, turned cyanotic, and
died over a postnatal time course of a few hours, as noted previously
(Gerard et al., 1999 ; Muscatelli et al., 2000 ). Nudging the pups caused
a transient increase in respiration and loss of cyanosis. Pups
exhibiting normal (n = 7) and abnormal
(n = 8) respiration were selected, and
brainstem-spinal cord preparations were isolated within 20 min of
birth. Among pups with abnormal breathing patterns in vivo,
seven of eight failed to generate rhythmic motor bursts from cervical
or hypoglossal nerve roots in vitro. The remaining pups
generated a severely irregular rhythmic motor output. Subsequent
genotyping confirmed that preparations with markedly perturbed
respiratory rhythms were Ndntm2Stw
mutants. Although these data were informative, the fact that newborns
with respiratory dysfunction were hypoxic and stressed during the early
postnatal period could have been a confounding factor. For instance,
the central neural control mechanisms could have been compromised
secondarily to a primary defect of lung function or peripheral
respiratory afferent input. Therefore, we proceeded to assess the
central drive in embryos delivered via cesarean section at E18.5.
Respiratory discharge in Ndntm2Stw
mutant embryos at E18.5
Simultaneous suction electrode recordings of inspiratory motor
discharge were made from diaphragm muscle and/or hypoglossal (XII)
nerve roots in brainstem-spinal cord preparations with the ribcage and
diaphragm attached. A total of 36 putative necdin-deficient (abnormal respiratory rhythm) and 22 wild-type E18.5 embryonic mice
were subsequently selected for detailed analyses. In each case,
postexperimental genotyping confirmed the identity of wild-type and
Ndntm2Stw mutant mice. In
Ndntm2Stw mutant mice, the rhythms were
consistently irregular, with prominent bouts of respiratory depression
characterized by burst frequencies of one to three bursts per 10 min
period and central apneas persisting for up to several minutes (Fig.
1A). The bouts of
suppressed respiratory rhythmic discharge were interspersed with
periods of inspiratory motor bursts close to frequencies observed in
wild-type preparations (Table 1). There
were no marked differences in the amplitude or duration of inspiratory
bursts. These recordings demonstrate that the defect in rhythmic motor
discharge is present in both cranial and spinal motoneuron
populations.

View larger version (63K):
[in this window]
[in a new window]
|
Figure 1.
necdin-deficient
Ndntm2Stw mice have irregular
respiratory rhythms with prolonged periods of central apnea.
A, Sample rectified and integrated suction electrode
recordings of diaphragm EMG were made from brainstem-spinal
cord-diaphragm preparations isolated from E18.5 wild-type
(left) and Ndntm2Stw
mutant (right) mice. Recordings of 80 min duration
demonstrate the regularity of respiratory discharge frequency (~4-5
sec interspike interval) in wild-type preparations. In contrast, the
respiratory frequency is very unstable in mutant preparations over
time. B, Defects in respiratory rhythm are observed
within the putative respiratory rhythm-generating center. Sample
rectified and integrated suction electrode recordings were made from
inspiratory neurons located in the pre-Bötzinger complex
(PBC) and neurons within the hypoglossal
(XII) nucleus in medullary slice preparations
isolated from E18.5 wild-type (left) and
Ndntm2Stw mutant
(right) mice.
|
|
We selected 18 of the Ndntm2Stw mutant
mouse preparations and removed the ribcage and diaphragm musculature.
The rhythmic discharge pattern recorded from the fourth cervical root
was similar to that recorded from the diaphragm EMG in 7 of 18 preparations. The other 11 Ndntm2Stw
mutant mice failed to produce any respiratory motor output from cervical or hypoglossal nerve roots during removal of the ribcage and
diaphragm musculature. Presumably, the threshold excitation necessary
to achieve rhythmic motor output in these mutants was only achieved
with the intact musculature and associated afferent input.
Medullary slice preparations from
Ndntm2Stw mutant embryos at E18.5
We recorded rhythmic respiratory discharge from the hypoglossal
(XII) motoneuron pool in medullary slice preparations isolated from
Ndntm2Stw mutant and wild-type mice (Fig.
1B). The rhythmic neuronal discharge was irregular in
all Ndntm2Stw mutant mice
(n = 10) but robust and regular in all wild-type (n = 8) preparations. There were no cases in which
Ndntm2Stw medullary slice preparations
failed to generate some sort of rhythmic motor output. The elevated
extracellular K+ (9 mM) provided sufficient excitatory drive to
respiratory neuronal populations to reach a threshold for generating a
rhythmic, albeit irregular, pattern.
We next determined whether or not the abnormal respiratory rhythm was
present within the pre-Bötzinger complex. Suction electrode recordings of population neuronal activity were performed in the region
of the pre-Bötzinger complex. The rhythmic discharge of neurons
within the pre-Bötzinger complex of mutant preparations had the
same abnormal characteristics as the XII motor discharge (Fig.
1B, Table 1). Next, whole-cell patch-clamp recordings
of inspiratory neurons within the pre-Bötzinger complex were
performed. As illustrated in Figure 2,
the neurons fired with an irregular rhythm with prolonged periods of
suppressed rhythmogenesis. The resting membrane potential of
inspiratory neurons became more depolarized during epochs of increased
respiratory rhythmic frequency. There were also bouts of
longer-duration bursting activity that is not of respiratory origin
(Greer et al., 1992 ).

View larger version (47K):
[in this window]
[in a new window]
|
Figure 2.
Abnormal rhythmogenesis is apparent from
whole-cell patch-clamp recordings from an inspiratory neuron within the
pre-Bötzinger complex. A, Rectified and integrated
suction electrode recordings were made from the XII nerve roots of a
wild-type E18.5 medullary slice preparation. B,
Top shows whole-cell patch-clamp recording from an
inspiratory neuron located within the region of the pre-Bötzinger
complex. Middle shows the simultaneous recording from
the XII nerve root. Bottom shows the whole-cell and
nerve root recordings on a shorter time scale. The
traces were taken from the areas demarcated in the
middle panel with horizontal bars. The
rhythmic discharge fluctuates between periods of very slow rhythms
(left bottom) to those in which the respiratory rhythm
is similar in frequency to wild-type preparations (middle
bottom). There are also occurrences of high-frequency
nonrespiratory bursts (right bottom).
Inset shows whole-cell and integrated nerve recordings
during a single inspiratory burst.
|
|
necdin mRNA expression in the medulla
Previous investigations of necdin gene expression by
RNA in situ hybridization or immunohistochemistry had
focused on the cerebrum, cerebellum, and the hypothalamus (Uetsuki et
al., 1996 ; Niinobe et al., 2000 ). Expression of the
Ndntm2Stw lacZ reporter gene
had been noted in the medulla, spinal cord, and dorsal root ganglia in
E17 embryos (Gerard et al., 1999 ). We examined the expression of
necdin by RNA in situ hybridization in wild-type
medullary sections at E15.5, when respiratory activity commences, and
E18.5, the stage used for electrophysiological recordings. This
experiment was to determine whether only subpopulations of neurons
express necdin, as observed in other structures of the
nervous system. necdin expression was evident in the
ventrolateral medulla in which the respiratory rhythm generator is
located, but levels here were not significantly different from in other medullary regions (Fig. 3).

View larger version (54K):
[in this window]
[in a new window]
|
Figure 3.
necdin is expressed in the fetal
medulla. A, Expression of Ndn in E18.5
medullary transverse section equivalent to those used for
electrophysiological studies. B, Photo of labeling in
the ventrolateral medulla (pre-Bötzinger complex area
approximated by dashed line). C,
Higher-power photo of the pre-Bötzinger complex region.
NA, Nucleus ambiguous; X, nucleus of the
tenth nerve (vagus); XII, nucleus of the twelfth nerve
(hypoglossal). Scale bars: A, 200 µm;
B, 50 µm; C, 25 µm.
|
|
 |
Discussion |
necdin-deficient Ndntm2Stw
newborn mice hypoventilate, rapidly turn cyanotic, and die. We sought
to assess centrally generated respiratory rhythmogenesis and drive
transmission in isolation from other aspects of the respiratory system
(e.g., lung function and peripheral afferent feedback). The
brainstem-spinal cord-diaphragm preparation has been well
characterized and shown to generate a complex, coordinated pattern of
respiratory activity (Smith et al., 1990 ). Recordings of diaphragmatic
EMG, cervical ventral roots, and hypoglossal roots provide information
regarding inspiratory drive transmission to key components of the
respiratory motor system. The respiratory motor discharge produced by
wild-type mice preparations at E18.5 were regular and at a frequency
similar to newborn pups. In marked contrast, the motor patterns
generated by the preparations from Ndntm2Stw mice were very irregular, with
prominent bouts of depression of respiratory rhythmogenesis that would
account for the hypoventilation observed in newborn
Ndntm2Stw mice in vivo. The
abnormal respiratory discharge pattern was present at the level of the
diaphragm, cervical ventral roots, cranial motoneuron pools and within
neurons located in the putative respiratory rhythm-generating center,
the pre-Bötzinger complex.
These data indicate that the defect in
Ndntm2Stw mutant mice can be explained by
abnormal respiratory rhythmogenesis emanating from the medulla. Data
from in vitro (Smith et al., 1991 ) and in vivo (Ramirez et al., 1998 ; Solomon et al., 1999 ; Gray et al., 2001 ) models
strongly suggest that a well defined region of the ventrolateral medulla, the pre-Bötzinger complex, is a major contributor to the
genesis of respiratory rhythm. A detailed understanding of the cellular
mechanisms underlying rhythm and pattern generation with the
ventrolateral medulla remains to be elucidated. However, there are data
to support a pacemaker-network hypothesis, which states that the kernel
for rhythm generation consists of a population of neurons with
intrinsic pacemaker properties that are embedded within, and modulated
by, a neuronal network (Rekling and Feldman, 1998 ; Smith et al., 2000 ).
It has been postulated that the pacemaker properties arise from
intrinsic voltage-dependent conductances that confer increases in burst
frequency at depolarized membrane potentials and decreases, to the
point of inhibiting rhythmic bursting, at hyperpolarized membrane
potentials (Smith et al., 1991 ; Butera et al., 1999a ,b ). The primary
conditioning excitatory drive that maintains the oscillatory state
arises from activation of glutaminergic receptors (Greer et al., 1991 ;
Funk et al., 1993 ). Additional conditioning is provided by a diverse
group of neuromodulators, including GABA, serotonin, noradrenaline,
opioids, prostaglandins, substance P, and acetylcholine (Lagercrantz,
1987 ; Moss and Inman, 1989 ; Ballanyi et al., 1999 ). Thus, absence of
necdin expression could result in the loss, or perturbation
of function, of rhythmogenic neurons in the pre-Bötzinger
complex. This is the proposed abnormality in Rnx-deficient
mice, which also have a central respiratory defect, possibly
attributable to altered cell-fate commitment of respiratory neurons
attributable to loss of this homeobox transcription factor (Shirasawa
et al., 2000 ; Qian et al., 2001 ). Alternatively, necdin expression may be necessary for the proper functioning of neurons providing appropriate conditioning drive impinging on rhythmogenic neurons within the pre-Bötzinger complex.
People with PWS are deficient for multiple genes, including
necdin. Although many aspects of PWS can be related to a
basic defect in hypothalamic development, development of other systems is probably also compromised in PWS. Abnormal ventilatory responses to
hyperoxia, hypoxia, and hypercapnia when awake and sleeping are noted
in PWS patients (Arens et al., 1994 ; Gozal et al., 1994 ; Schluter et
al., 1997 ; Menendez, 1999 ). Furthermore, there are reports of
sleep-related central and obstructive apnea (Clift et al., 1994 ;
Wharton and Loechner, 1996 ; Manni et al., 2001 ; Nixon and Brouillette,
2002 ). A report of a 29 week premature infant with PWS who required
prolonged ventilatory support points to a prenatal onset of respiratory
dysfunction in PWS (MacDonald and Camp, 2001 ). The sleep-related
breathing problems likely contribute significantly to the excessive
daytime sleepiness in childhood and adulthood that is characteristic of
PWS (Hertz et al., 1995 ). Aside from one report showing reduced number
of oxytocin neurons in the hypothalamic paraventricular nucleus, no
abnormal pathological findings have been noted in PWS individuals at
autopsy (Swaab et al., 1995 ). Our study now suggests that loss of
necdin is implicated in abnormal respiration in PWS infants,
and we hypothesize that necdin may be important for normal
respiratory activity in the human newborn medulla.
 |
FOOTNOTES |
Received Oct. 23, 2002; revised Nov. 27, 2002; accepted Dec. 6, 2002.
*
J.R. and S.L. contributed equally to this work.
This work was supported by the Canadian Institutes of Health Research
(CIHR) (J.J.G.), March of Dimes Birth Defects Foundation Research Grant
6-FY00-196 (R.W.), a CIHR-Alberta Sudden Infant Death Syndrome
Foundation Fellowship (J.R.), and Graduate Studentships to S.L. and
S.P. from the Alberta Heritage Foundation for Medical Research (AHFMR).
R.W. is a Scholar of the AHFMR and CIHR, and J.J.G. is a Senior Scholar
of the AHFMR. We thank personnel in the Health Science Laboratory
Animal Service, particularly Brenda Roszell for mouse handling. We
thank Sharee Kuny for technical assistance and Dr. Serguei Kozlov for
useful discussions.
Correspondence should be addressed to John Greer at the above address.
E-mail: john.greer{at}ualberta.ca.
 |
References |
-
Arens R,
Gozal D,
Omlin KJ,
Livingston FR,
Liu J,
Keens TG,
Ward SL
(1994)
Hypoxic and hypercapnic ventilatory responses in Prader-Willi syndrome.
J Appl Physiol
77:2224-2230[Abstract/Free Full Text].
-
Ballanyi K,
Onimaru H,
Homma I
(1999)
Respiratory network function in the isolated brainstem-spinal cord of newborn rats.
Prog Neurobiol
59:583-634[Web of Science][Medline].
-
Boccaccio I,
Glatt-Deeley H,
Watrin F,
Roeckel N,
Lalande M,
Muscatelli F
(1999)
The human MAGEL2 gene and its mouse homologue are paternally expressed and mapped to the Prader-Willi region.
Hum Mol Genet
8:2497-2505[Abstract/Free Full Text].
-
Butera Jr RJ,
Rinzel J,
Smith JC
(1999a)
Models of respiratory rhythm generation in the pre-Botzinger complex. I. Bursting pacemaker neurons.
J Neurophysiol
82:382-397[Abstract/Free Full Text].
-
Butera Jr RJ,
Rinzel J,
Smith JC
(1999b)
Models of respiratory rhythm generation in the pre-Botzinger complex. II. Populations of coupled pacemaker neurons.
J Neurophysiol
82:398-415[Abstract/Free Full Text].
-
Clift S,
Dahlitz M,
Parkes JD
(1994)
Sleep apnoea in the Prader-Willi syndrome.
J Sleep Res
3:121-126[Web of Science][Medline].
-
Funk GD,
Smith JC,
Feldman JL
(1993)
Generation and transmission of respiratory oscillations in medullary slices: role of excitatory amino acids.
J Neurophysiol
70:1497-1515[Abstract/Free Full Text].
-
Gerard M,
Hernandez L,
Wevrick R,
Stewart C
(1999)
Disruption of the mouse necdin gene results in early postnatal lethality: a model for neonatal distress in Prader-Willi syndrome.
Nat Genet
23:199-202[Web of Science][Medline].
-
Gozal D,
Arens R,
Omlin KJ,
Ward SL,
Keens TG
(1994)
Absent peripheral chemosensitivity in Prader-Willi syndrome.
J Appl Physiol
77:2231-2236[Abstract/Free Full Text].
-
Gray PA,
Janczewski WA,
Mellen N,
McCrimmon DR,
Feldman JL
(2001)
Normal breathing requires preBotzinger complex neurokinin-1 receptor-expressing neurons.
Nat Neurosci
4:927-930[Web of Science][Medline].
-
Greer JJ,
Smith JC,
Feldman JL
(1991)
Role of excitatory amino acids in the generation and transmission of respiratory drive in neonatal rat.
J Physiol (Lond)
437:727-749[Abstract/Free Full Text].
-
Greer JJ,
Smith JC,
Feldman JL
(1992)
Respiratory and locomotor patterns generated in the fetal rat brain stem-spinal cord in vitro.
J Neurophysiol
67:996-999[Abstract/Free Full Text].
-
Hertz G,
Cataletto M,
Feinsilver SH,
Angulo M
(1995)
Developmental trends of sleep-disordered breathing in Prader-Willi syndrome: the role of obesity.
Am J Med Genet
56:188-190[Web of Science][Medline].
-
Holm VA,
Cassidy SB,
Butler MG,
Hanchett JM,
Greenswag LR,
Whitman BY,
Greenberg F
(1993)
Prader-Willi syndrome: consensus diagnostic criteria.
Pediatrics
91:398-402[Abstract/Free Full Text].
-
Jay P,
Rougeulle C,
Massacrier A,
Moncla A,
Mattei MG,
Malzac P,
Roeckel N,
Taviaux S,
Lefranc JL,
Cau P,
Berta P,
Lalande M,
Muscatelli F
(1997)
The human necdin gene, NDN, is maternally imprinted and located in the Prader-Willi syndrome chromosomal region.
Nat Genet
17:357-361[Web of Science][Medline].
-
Lagercrantz H
(1987)
Neuromodulators and respiratory control during development.
Trends Neurosci
10:368-372[Web of Science].
-
Lee S,
Kozlov S,
Hernandez L,
Chamberlain SJ,
Brannan CI,
Stewart CL,
Wevrick R
(2000)
Expression and imprinting of MAGEL2 suggest a role in Prader-Willi syndrome and the homologous murine imprinting phenotype.
Hum Mol Genet
9:1813-1819[Abstract/Free Full Text].
-
MacDonald HR,
Wevrick R
(1997)
The necdin gene is deleted in Prader-Willi syndrome and is imprinted in human and mouse.
Hum Mol Genet
6:1873-1878[Abstract/Free Full Text].
-
MacDonald JT,
Camp D
(2001)
Prolonged but reversible respiratory failure in a newborn with Prader-Willi syndrome.
J Child Neurol
16:153-154[Abstract/Free Full Text].
-
Manni R,
Politini L,
Nobili L,
Ferrillo F,
Livieri C,
Veneselli E,
Biancheri R,
Martinetti M,
Tartara A
(2001)
Hypersomnia in the Prader Willi syndrome: clinical-electrophysiological features and underlying factors.
Clin Neurophysiol
112:800-805[Web of Science][Medline].
-
Maruyama K,
Usami M,
Aizawa T,
Yoshikawa K
(1991)
A novel brain-specific mRNA encoding nuclear protein (necdin) expressed in neurally differentiated embryonal carcinoma cells.
Biochem Biophys Res Commun
178:291-296[Web of Science][Medline].
-
Menendez AA
(1999)
Abnormal ventilatory responses in patients with Prader-Willi syndrome.
Eur J Pediatr
158:941-942[Web of Science][Medline].
-
Moss IR,
Inman JG
(1989)
Neurochemicals and respiratory control during development.
J Appl Physiol
67:1-13[Abstract/Free Full Text].
-
Muscatelli F,
Abrous DN,
Massacrier A,
Boccaccio I,
Moal ML,
Cau P,
Cremer H
(2000)
Disruption of the mouse necdin gene results in hypothalamic and behavioral alterations reminiscent of the human Prader-Willi syndrome.
Hum Mol Genet
9:3101-3110[Abstract/Free Full Text].
-
Nicholls RD
(2000)
The impact of genomic imprinting for neurobehavioral and developmental disorders.
J Clin Invest
105:413-418[Web of Science][Medline].
-
Niinobe M,
Koyama K,
Yoshikawa K
(2000)
Cellular and subcellular localization of necdin in fetal and adult mouse brain.
Dev Neurosci
22:310-319[Web of Science][Medline].
-
Nixon GM,
Brouillette RT
(2002)
Sleep and breathing in Prader-Willi syndrome.
Pediatr Pulmonol
34:209-217[Web of Science][Medline].
-
Qian Y,
Fritzsch B,
Shirasawa S,
Chen CL,
Choi Y,
Ma Q
(2001)
Formation of brainstem (nor)adrenergic centers and first-order relay visceral sensory neurons is dependent on homeodomain protein Rnx/Tlx3.
Genes Dev
15:2533-2545[Abstract/Free Full Text].
-
Ramirez JM,
Schwarzacher SW,
Pierrefiche O,
Olivera BM,
Richter DW
(1998)
Selective lesioning of the cat pre-Botzinger complex in vivo eliminates breathing but not gasping.
J Physiol (Lond)
507:895-907[Abstract/Free Full Text].
-
Rekling JC,
Feldman JL
(1998)
PreBotzinger complex and pacemaker neurons: hypothesized site and kernel for respiratory rhythm generation.
Annu Rev Physiol
60:385-405[Web of Science][Medline].
-
Schluter B,
Buschatz D,
Trowitzsch E,
Aksu F,
Andler W
(1997)
Respiratory control in children with Prader-Willi syndrome.
Eur J Pediatr
156:65-68[Medline].
-
Shirasawa S,
Arata A,
Onimaru H,
Roth KA,
Brown GA,
Horning S,
Arata S,
Okumura K,
Sasazuki T,
Korsmeyer SJ
(2000)
Rnx deficiency results in congenital central hypoventilation.
Nat Genet
24:287-290[Web of Science][Medline].
-
Smith JC,
Greer JJ,
Liu GS,
Feldman JL
(1990)
Neural mechanisms generating respiratory pattern in mammalian brain stem-spinal cord in vitro. I. Spatiotemporal patterns of motor and medullary neuron activity.
J Neurophysiol
64:1149-1169[Abstract/Free Full Text].
-
Smith JC,
Ellengerger HH,
Ballanyi K,
Richter DW,
Feldman JL
(1991)
Pre-Bötzinger complex: a brainstem region that may generate respiratory rhythm in mammals.
Science
254:726-728[Abstract/Free Full Text].
-
Smith JC,
Butera RJ,
Koshiya N,
Del Negro C,
Wilson CG,
Johnson SM
(2000)
Respiratory rhythm generation in neonatal and adult mammals: the hybrid pacemaker-network model.
Respir Physiol
122:131-147[Web of Science][Medline].
-
Solomon IC,
Edelman NH,
Neubauer JA
(1999)
Patterns of phrenic motor output evoked by chemical stimulation of neurons located in the pre-Botzinger complex in vivo.
J Neurophysiol
81:1150-1161[Abstract/Free Full Text].
-
Sutcliffe JS,
Han M,
Christian SL,
Ledbetter DH
(1997)
Neuronally-expressed necdin gene: an imprinted candidate gene in Prader-Willi syndrome.
Lancet
350:1520-1521[Web of Science][Medline].
-
Swaab DF,
Purba JS,
Hofman MA
(1995)
Alterations in the hypothalamic paraventricular nucleus and its oxytocin neurons (putative satiety cells) in Prader-Willi syndrome: a study of five cases.
J Clin Endocrinol Metab
80:573-579[Abstract].
-
Tsai TF,
Armstrong D,
Beaudet AL
(1999)
Necdin-deficient mice do not show lethality or the obesity and infertility of Prader-Willi syndrome.
Nat Genet
22:15-16[Web of Science][Medline].
-
Uetsuki T,
Takagi K,
Sugiura H,
Yoshikawa K
(1996)
Structure and expression of the mouse necdin gene. Identification of a postmitotic neuron-restrictive core promoter.
J Biol Chem
271:918-924[Abstract/Free Full Text].
-
Wharton RH,
Loechner KJ
(1996)
Genetic and clinical advances in Prader-Willi syndrome.
Curr Opin Pediatr
8:618-624[Medline].
-
Wilkinson DG,
Nieto MA
(1993)
Detection of messenger RNA by in situ hybridization to tissue sections and whole mounts.
Methods Enzymol
225:361-373[Web of Science][Medline].
Copyright © 2003 Society for Neuroscience 0270-6474/03/2351569-05$05.00/0
This article has been cited by other articles:

|
 |

|
 |
 
N. L.G. Miller, R. Wevrick, and P. L. Mellon
Necdin, a Prader-Willi syndrome candidate gene, regulates gonadotropin-releasing hormone neurons during development
Hum. Mol. Genet.,
January 15, 2009;
18(2):
248 - 260.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
K. Hasegawa and K. Yoshikawa
Necdin Regulates p53 Acetylation via Sirtuin1 to Modulate DNA Damage Response in Cortical Neurons
J. Neurosci.,
August 27, 2008;
28(35):
8772 - 8784.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C. Gaultier and J Gallego
Neural control of breathing: insights from genetic mouse models
J Appl Physiol,
May 1, 2008;
104(5):
1522 - 1530.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. Zanella, F. Watrin, S. Mebarek, F. Marly, M. Roussel, C. Gire, G. Diene, M. Tauber, F. Muscatelli, and G. Hilaire
Necdin Plays a Role in the Serotonergic Modulation of the Mouse Respiratory Network: Implication for Prader-Willi Syndrome
J. Neurosci.,
February 13, 2008;
28(7):
1745 - 1755.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. M. Bischof, C. L. Stewart, and R. Wevrick
Inactivation of the mouse Magel2 gene results in growth abnormalities similar to Prader-Willi syndrome
Hum. Mol. Genet.,
November 15, 2007;
16(22):
2713 - 2719.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
N. Lopez-Sanchez, Z. Gonzalez-Fernandez, M. Niinobe, K. Yoshikawa, and J. M. Frade
Single mage gene in the chicken genome encodes CMage, a protein with functional similarities to mammalian type II Mage proteins
Physiol Genomics,
July 18, 2007;
30(2):
156 - 171.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
D. A. M. Festen, A. W. de Weerd, R. A. S. van den Bossche, K. Joosten, H. Hoeve, and A. C. S. Hokken-Koelega
Sleep-Related Breathing Disorders in Prepubertal Children with Prader-Willi Syndrome and Effects of Growth Hormone Treatment
J. Clin. Endocrinol. Metab.,
December 1, 2006;
91(12):
4911 - 4915.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. Kurita, T. Kuwajima, I. Nishimura, and K. Yoshikawa
Necdin Downregulates Cdc2 Expression to Attenuate Neuronal Apoptosis.
J. Neurosci.,
November 15, 2006;
26(46):
12003 - 12013.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
H. V. Forster, P. M. Lalley, J. Greer, E. E. Nattie, A. Li, C. A. D. Negro, P. A. Gray, M. Dutschmann, I. A. Rybak, T. E. Dick, et al.
The parafacial respiratory group (pFRG)/pre-Botzinger complex (preBotC) is the primary site of respiratory rhythm generation in the mammal
J Appl Physiol,
June 1, 2006;
100(6):
2103 - 2108.
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
T. Kuwajima, I. Nishimura, and K. Yoshikawa
Necdin promotes GABAergic neuron differentiation in cooperation with Dlx homeodomain proteins.
J. Neurosci.,
May 17, 2006;
26(20):
5383 - 5392.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. Fujimoto, S. M. Mitalipov, H.-C. Kuo, and D. P. Wolf
Aberrant Genomic Imprinting in Rhesus Monkey Embryonic Stem Cells
Stem Cells,
March 1, 2006;
24(3):
595 - 603.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. J. Greer, G. D. Funk, and K. Ballanyi
Preparing for the first breath: prenatal maturation of respiratory neural control
J. Physiol.,
February 1, 2006;
570(3):
437 - 444.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
K.-i. Kuwako, A. Hosokawa, I. Nishimura, T. Uetsuki, M. Yamada, S. Nada, M. Okada, and K. Yoshikawa
Disruption of the Paternal Necdin Gene Diminishes TrkA Signaling for Sensory Neuron Survival
J. Neurosci.,
July 27, 2005;
25(30):
7090 - 7099.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. Pagliardini, J. Ren, R. Wevrick, and J. J. Greer
Developmental Abnormalities of Neuronal Structure and Function in Prenatal Mice Lacking the Prader-Willi Syndrome Gene Necdin
Am. J. Pathol.,
July 1, 2005;
167(1):
175 - 191.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. J. O'Neill
The influence of non-coding RNAs on allele-specific gene expression in mammals
Hum. Mol. Genet.,
April 15, 2005;
14(suppl_1):
R113 - R120.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. Lee, C. L. Walker, B. Karten, S. L. Kuny, A. A. Tennese, M. A. O'Neill, and R. Wevrick
Essential role for the Prader-Willi syndrome protein necdin in axonal outgrowth
Hum. Mol. Genet.,
March 1, 2005;
14(5):
627 - 637.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. J. Chamberlain, K. A. Johnstone, A. J. DuBose, T. A. Simon, M. S. Bartolomei, J. L. Resnick, and C. I. Brannan
Evidence for genetic modifiers of postnatal lethality in PWS-IC deletion mice
Hum. Mol. Genet.,
December 1, 2004;
13(23):
2971 - 2977.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
T. Kuwajima, H. Taniura, I. Nishimura, and K. Yoshikawa
Necdin Interacts with the Msx2 Homeodomain Protein via MAGE-D1 to Promote Myogenic Differentiation of C2C12 Cells
J. Biol. Chem.,
September 24, 2004;
279(39):
40484 - 40493.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
B. M. Cattanach, C. V. Beechey, and J. Peters
Interactions Between Imprinting Effects in the Mouse
Genetics,
September 1, 2004;
168(1):
397 - 413.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
K.-i. Kuwako, H. Taniura, and K. Yoshikawa
Necdin-related MAGE Proteins Differentially Interact with the E2F1 Transcription Factor and the p75 Neurotrophin Receptor
J. Biol. Chem.,
January 16, 2004;
279(3):
1703 - 1712.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. Pagliardini, J. Ren, and J. J. Greer
Ontogeny of the Pre-Botzinger Complex in Perinatal Rats
J. Neurosci.,
October 22, 2003;
23(29):
9575 - 9584.
[Abstract]
[Full Text]
[PDF]
|
 |
|
|