WWW.JNEUROSCI.ORG
-
The Journal of Neuroscience
 QUICK SEARCH:   [advanced]


     
-


HOME
  |  
SEARCH  |   ARCHIVE  |   SUBSCRIBE  |   CONTACT  |   HELP

The Journal of Neuroscience, July 27, 2005, 25(30):6984-6996; doi:10.1523/JNEUROSCI.1137-05.2005

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow A correction has been published
Right arrow Submit an eLetter
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Web of Science (25)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Leroy, J.
Right arrow Articles by Dolphin, A. C.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Leroy, J.
Right arrow Articles by Dolphin, A. C.

 Previous Article  |  Next Article 

Cellular/Molecular
Interaction via a Key Tryptophan in the I-II Linker of N-Type Calcium Channels Is Required for {beta}1 But Not for Palmitoylated {beta}2, Implicating an Additional Binding Site in the Regulation of Channel Voltage-Dependent Properties

Jérôme Leroy,1 Mark S. Richards,1,2 * Adrian J. Butcher,1 * Manuela Nieto-Rostro,1 Wendy S. Pratt,1 Anthony Davies,1 and Annette C. Dolphin1

1Laboratory of Cellular and Molecular Neuroscience, Department of Pharmacology, University College London, London WC1E 6BT, United Kingdom, and 2School of Crystallography, Birkbeck College, London WC1E 7HX, United Kingdom


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
The CaV{beta} subunits of voltage-gated calcium channels regulate these channels in several ways. Here we investigate the role of these auxiliary subunits in the expression of functional N-type channels at the plasma membrane and in the modulation by G-protein-coupled receptors of this neuronal channel. To do so, we mutated tryptophan 391 to an alanine within the {alpha}-interacting domain (AID) in the I-II linker of CaV2.2. We showed that the mutation W391 virtually abolishes the binding of CaV{beta}1b and CaV{beta}2a to the CaV2.2 I-II linker and strongly reduced current density and cell surface expression of both CaV2.2/{alpha}2{delta}-2/{beta}1b and/{beta}2a channels. When associated with CaV{beta}1b, the W391A mutation also prevented the CaV{beta}1b-mediated hyperpolarization of CaV2.2 channel activation and steady-state inactivation. However, the mutated CaV2.2W391A/{beta}1b channels were still inhibited to a similar extent by activation of the D2 dopamine receptor with the agonist quinpirole. Nevertheless, key hallmarks of G-protein modulation of N-type currents, such as slowed activation kinetics and prepulse facilitation, were not observed for the mutated channel. In contrast, CaV{beta}2a was still able to completely modulate the biophysical properties of CaV2.2W391A channel and allow voltage-dependent G-protein modulation of CaV2.2W391A. Additional data suggest that the concentration of CaV{beta}2a in the proximity of the channel is enhanced independently of its binding to the AID by its palmitoylation. This is essentially sufficient for all of the functional effects of CaV{beta}2a, which may occur via a second lower-affinity binding site, except trafficking the channel to the plasma membrane, which requires interaction with the AID region.

Key words: calcium channel; neuron; {alpha}-interaction domain; {beta} subunit; trafficking; G-protein; palmitoylation


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Voltage-gated calcium (CaV) channels play a major role in the physiology of excitable cells, particularly of neurons. Three families of voltage-gated calcium channels have been identified, CaV1-CaV3 (for review, see Ertel et al., 2000Go). The CaV1 class, L-type channels and the CaV2 class, non-L-type channels are both high-voltage-activated (HVA). These are heteromultimers composed of the pore-forming {alpha}1 subunit, associated with auxiliary CaV{beta} and {alpha}2{delta} subunits (for review, see Catterall, 2000Go). The CaV2 calcium channels are inhibited by G{beta}{gamma} dimers (Herlitze et al., 1996Go; Ikeda, 1996Go), which is the main mechanism of presynaptic inhibition by G-protein-coupled receptors. CaV{beta} subunits are crucial for normal HVA channel function (for review, see Dolphin, 2003aGo), because they enhance expression of functional channels at the plasma membrane, modulate their biophysical properties, and promote the voltage dependence of modulation of CaV2.2 calcium channels by G{beta}{gamma} dimers, although the mechanism involved remains unclear (Bichet et al., 2000Go; Meir et al., 2000Go; Canti et al., 2001Go). G{beta}{gamma} dimers and CaV{beta} subunits have been shown to bind to overlapping sites in the I-II loop of CaV2 channels, and they induce opposite effects on biophysical properties of the channels (for review, see Dolphin, 2003bGo), shifting channels between a willing and a reluctant state that requires large depolarizations to be opened (Bean, 1989Go). This observation led to the hypothesis that the binding of G{beta}{gamma} dimers might dissociate the CaV{beta} subunit from the I-II loop of the {alpha}1 subunit (Sandoz et al., 2004Go) and that dissociation of CaV{beta} was the mechanism responsible for the inhibition observed. However, there is also evidence that G{beta}{gamma} dimers do not displace CaV{beta} subunits but alter the orientation of the subunit with respect to the {alpha}1 subunit (Hummer et al., 2003Go).

Here, we investigated the role of CaV{beta} subunits in the plasma membrane expression and G-protein modulation of CaV2.2 calcium channels by mutating the tryptophan (W391) in the {alpha}1-interacting domain (AID) in the I-II loop of CaV2.2. This amino acid has been shown both by the study that identified the AID motif and the recent structural studies to be key to the interaction between CaV{beta} subunits and the AID (Pragnell et al., 1994Go; Chen et al., 2004Go; Opatowsky et al., 2004Go; Van Petegem et al., 2004Go). This mutation prevents the enhancement of functional expression of CaV2.2 by CaV{beta}1b and also prevents modulation of CaV2.2 by this subunit. In addition, although the G-protein modulation of CaV2.2W391A was present, it was not voltage dependent. In contrast, only the expression of the channel at the plasma membrane was affected when CaV{beta}2a was coexpressed with this mutant channel, whereas all of the biophysical properties of the expressed CaV2.2W391A channels were still normally modulated by CaV{beta}2a, including the voltage dependence of G-protein modulation. Our results further show that this was dependent on palmitoylation of CaV{beta}2a and suggest that the effect of CaV{beta} subunits on the voltage-dependent properties of the CaV2.2 channels occurs not only via the high-affinity I-II linker interaction but also via low-affinity interactions, presumably with other sites on the channel.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Materials. The cDNAs used in this study were CaV2.2 (D14157 [GenBank] ), CaV{beta}1b (X61394 [GenBank] ), CaV{beta}3 (M88751 [GenBank] ), CaV{beta}2a(M88751 [GenBank] ), CaV{beta}2a-{beta}1b chimera (Olcese et al., 1994Go), {alpha}2{delta}-2 (Barclay et al., 2001Go), and D2 dopamine receptor (X17458 [GenBank] ). The green fluorescent protein (GFP-mut3b, U73901 [GenBank] ) was used to identify transfected cells. All cDNAs were subcloned in pMT2.

Construction, expression, and purification of proteins. CaV2.2W391A was generated by site-directed mutagenesis with primers for CaV2.2W391A.F (5'CGGGTACCTGGAGGCGATCTTCAAGGCTGAG) and CaV2.2W391A.R (5'CTCAGCCTTGAAGATCGCCTCCAGGTACCCG).

CaV2.2 I-II loop in pGEX2T (Bell et al., 2001Go) [glutathione S-transferase (GST)-CaV2.2 I-II loop] was modified by PCR using Pfu polymerase (Stratagene, Amsterdam, The Netherlands) with the oligonucleotide primers 5'-ATGCTGGCCGAGGAGGACAGGAATGCAGAG-3' and 5'-GACTCATTCCTCCGCCTTGAAGATCCACTCCAGGTAC-3', which truncate the CaV2.2 I-II loop after the region encoding the AID. In this way, a construct was generated encoding the first 40 residues of the CaV2.2 I-II loop, incorporating the AID, fused to GST to form GST-CaV2.2(357-397)WT. Mutagenesis of GST-CaV2.2(357-397)WT was performed as described above using the primers 5'-ATCTTCAAGGCGGAGGAATGAGTCATGCTGGCCG-3' and 5'-AGCCTCCAGGTACCCGTTGAGCTCTCGCTCGATC-3' to substitute an alanine for W391. GST-CaV2.2(357-397)WT, GST-CaV2.2(357-397)W391A, and GST were expressed and purified as described for GST-CaV2.2 I-II loop by Bell et al. (2001Go). N-Terminally His-tagged Cav{beta}2a (H6N-Cav{beta}2a) and C-terminally His-tagged Cav{beta}1b (Cav{beta}1b-H6C) were expressed and purified as described by Bell et al. (2001Go).

Surface plasmon resonance. Assays were performed using a BIAcore 2000 (Biacore, Uppsala, Sweden) at 25°C using running buffer (20 mM Na phosphate, pH 7.5, 500 mM NaCl, and 0.005% Tween 20). Anti-GST monoclonal antibodies (Amersham Biosciences, Little Chalfont, UK) were covalently attached to the surface of CM5 dextran sensor chips according to the instructions of the manufacturer to allow the reversible immobilization of GST-fusion proteins. Approximately equivalent molar quantities ~350 resonance units (RU) of GST-CaV2.2(357-397)WT, ~350 RU of GST-CaV2.2(357-397)W391A, and ~300 RU of GST were immobilized on successive flow cells of a sensor chip. The flow rate of running buffer was 25 µl/min. H6N-Cav{beta}2a and Cav{beta}1b-H6C were dialyzed against running buffer and diluted to a series of concentrations. These samples were applied for 6 min over all flow cells, and each injection was followed by a similar dissociation phase. The sensor chip surface was regenerated between injections by the application of 35 µl of 20 mM glycine/HCl, pH 2.2, at 10 µl/min and the immobilization of fresh ligand.

Sensorgrams were processed using the BIAevaluation 3.0 software (Biacore). Sensorgrams recorded from the flow cells containing GST-CaV2.2(357-397)WT and GST-CaV2.2(357-397)W391A were corrected for passive refractive index changes and for nonspecific interactions by subtraction of the corresponding sensorgram recorded from the flow cell containing GST only. Sensorgrams were fitted by nonlinear regression using Prism 4 (GraphPad Software San Diego, CA). For each sensorgram, the first 120 s of the association phase and the dissociation phase were fitted to a single exponential to determine the observed association rate kon(obs) and the dissociation rate koff. The specific association rate, kon, was calculated as kon = (kon(obs) - koff)/[CaV{beta}], and the dissociation constant KD was calculated as KD = koff/kon.

Cell culture and heterologous expression. The tsA-201 cells were cultured in a medium consisting of DMEM, 10% fetal bovine serum, and 1% nonessential amino acids. The cDNAs (all at 1 µg/µl) for CaV{alpha}1 subunits, CaV{beta}, {alpha}2{delta}-2, D2 dopamine receptor, and GFP (when used as a reporter of transfected cells) were mixed in a ratio of 3:2:2:2:0.4. The cells were transfected using Fugene6 (DNA/Fugene6 ratio of 2 µg in 3 µl; Roche Diagnostics, Lewes, UK). The tsA-201 cells were replated at low density on 35 mm tissue culture dishes on the day of recording.

Biotinylation. T75 flasks of transiently transfected tsA-201 cells were washed three times with 10 ml of PBS. Cells were incubated with 2 ml of PBS, pH 8.0, containing 800 µM EZ-link Sulfo NHS-SS-Biotin (Pierce, Rockford, IL) for 15 min at room temperature. The biotinylation reaction was terminated by addition of 10 ml of 100 mM glycine in PBS, and cells were collected by centrifugation (1000 x g) and washed an additional three times with 10 ml of PBS.

Cells were lysed by addition of 750 µl of lysis buffer (20 mM Tris, pH 7.4, 150 mM NaCl, 1 mM EDTA, and 1.5% Triton X-100) containing one Complete protease inhibitor tablet (Roche Diagnostics) per 10 ml, followed by brief sonication. After centrifugation at 20,000 x g for 20 min at 4°C, the protein concentration of the supernatant was determined using the BCA assay (Pierce). Biotinylated proteins were precipitated by incubating 500 µg of supernatant with 50 µl of streptavidin agarose beads (Pierce) for 3 h at room temperature. Precipitated proteins were washed four times with 1 ml of lysis buffer. Proteins were eluted from the beads by incubation with 100 mM dithiothreitol in lysis buffer for 30 min, followed by an equal volume of 2x SDS-PAGE sample buffer. Samples of supernatant and precipitated proteins were analyzed by SDS-PAGE on 4-12% Tris-glycine gels (Invitrogen, Paisley, UK) followed by Western blotting with anti CaV2.2 II-III linker antibodies (Raghib et al., 2001Go).

Western blot analysis. Samples (2.5-250 µg of protein) from tsA-201 whole-cell lysates [prepared as described for COS-7 cells by Raghib et al. (2001Go)] or from biotinylation experiments (see above) were separated by SDS-PAGE on 4-12% Tris-glycine gels and then transferred to polyvinylidene fluoride membranes. Immunodetection was performed with antibodies to the Cav2.2 II-III linker (Raghib et al., 2001Go) or {beta}3 subunit (Canti et al., 2001Go) as described previously (Raghib et al., 2001Go).

Immunocytochemistry. Two days after transfection with CaV{beta}2a or CaV{beta}2aC3,4S, tsA-201 cells were fixed with 4% paraformaldehyde in PBS for 5 min at room temperature. For permeabilization, cells were incubated twice for 7 min in a 0.02% solution of Triton X-100 in Tris-buffered saline. For detection of CaV{beta}2a or CaV{beta}2aC3,4S, the primary antibody used was a rabbit anti-CaV{beta}2a (462-600) at 0.2 µg/ml (Chien et al., 1995Go). The secondary antibody was an anti-rabbit IgG FITC conjugated (1:500; Sigma, St. Louis, MO). For nuclear staining, 4',6-diamidino-2-phenylindole (DAPI) (300 nM; Molecular Probes, Eugene, OR) was applied. Samples were mounted in VectaShield (Vector Laboratories, Burlingame, CA) to reduce photobleaching and examined on a confocal laser scanning microscope (model LSM; Ziess, Oberkochen, Germany) using a 40x objective (1.3 numerical aperture) with constant photomultiplier settings.

Whole-cell electrophysiology. Whole-cell patch-clamp recordings were performed at room temperature (22-24°C). Only fluorescent cells expressing GFP were used for recording. The single cells were voltage clamped using an Axopatch 200B patch-clamp amplifier (Axon Instruments, Foster City, CA). The electrode potential was adjusted to give zero current between pipette and external solution before the cells were attached. The cell capacitance varied from 10 to 40 pF. Patch pipettes were filled with a solution containing the following (in mM): 140 Cs-aspartate, 5 EGTA, 2 MgCl2, 0.1 CaCl2, 2 K2ATP, and 10 HEPES, titrated to pH 7.2 with CsOH (310 mOsm; with a resistance of 2-3 M{Omega}). The external solution contained the following (in mM): 150 tetraethylammonium bromide, 3 KCl, 1.0 NaHCO3, 1.0 MgCl2, 10 HEPES, 4 glucose, and 10 BaCl2, pH adjusted to 7.4 with Tris base (320 mOsm). The pipette and cell capacitance as well as the series resistance were compensated by 80%. Leak and residual capacitance current were subtracted using a P/4 protocol. Data were filtered at 2 kHz and digitized at 5-10 kHz. The holding potential was -100 mV, and pulses were delivered every 10 s.

Data analysis and curve fitting. Current amplitude was measured 10 ms after the onset of the test pulse, and the average over a 2 ms period was calculated and used for subsequent analysis. The current density-voltage (I-V) relationships were fitted with a modified Boltzmann equation as follows: I = Gmax x (V - Vrev)/(1 + exp(-(V - V50, act)/k)), where I is the current density (in picoamperes per picofarad), Gmax is the maximum conductance (in nanosiemens per picofarad), Vrev is the reversal potential, V50, act is the midpoint voltage for current activation, and k is the slope factor. Steady-state inactivation properties were measured by applying 5 s pulse from -120 to +20 mV in 10 mV increments, followed by a 11 ms repolarization to -100 mV before the 100 ms test pulse to +20 mV. Steady-state inactivation and activation data were fitted with a single Boltzmann equation of the following form: I/Imax = (A1 - A2)/[1 + exp((V - V50, inact)/k)] + A2, where Imax is the maximal current, and V50, inact is the half-maximal voltage for current inactivation. For the steady-state inactivation, A1 and A2 represent the proportion of inactivating and non-inactivating current, respectively. Inactivation kinetics of the currents were estimated by fitting the decaying part of the current traces with the following equation: I(t) = C + A x exp(-(t - to)/{tau}inact), where to is zero time, C the fraction of non-inactivating current, A the relative amplitude of the exponential, and {tau}inact is its time constant. Activation kinetics were estimated by fitting the activation phase of the current with either a single or a double exponential. Analysis was performed using pClamp6 and Origin 7. Data are expressed as mean ± SEM of the number of replicates (n). Error bars indicate SEs of multiple determinations if not otherwise mentioned. Statistical significance was analyzed using Student's paired and unpaired t test, and p < 0.05 was considered to be statistically significant.


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Mutation of W391A in the I-II linker of CaV2.2 disrupts both CaV{beta}1b and CaV{beta}2a subunit binding
The amino acid W391 in CaV2.2 (Fig 1A) is conserved in the AID sequence of all HVA calcium channels (for review, see Dolphin, 2003aGo; Richards et al., 2004Go) and has been described previously to be important for the binding of the CaV{beta} ancillary subunits to HVA calcium channels (Pragnell et al., 1994Go; De Waard et al., 1996Go; Berrou et al., 2002Go). The recent structural analysis of the interaction of CaV{beta} subunits with the CaV1.2 I-II linker showed that this residue is deeply embedded in the AID binding groove in CaV{beta} (Chen et al., 2004Go; Opatowsky et al., 2004Go; Van Petegem et al., 2004Go). We first showed by surface plasmon resonance analysis that mutation of W391 to A in the AID of CaV2.2 prevents the binding of both CaV{beta}1b and CaV{beta}2a subunit to the I-II linker of CaV2.2 (Fig. 1B). In our experiments, GST-fusion proteins corresponding to the proximal I-II linker, including the AID of CaV2.2 or CaV2.2W391A, or GST alone as control, were immobilized via an anti-GST antibody to an individual flow cell of a CM5 dextran sensor chip. CaV{beta} subunit solutions (25-200 nM) were perfused over all flow cells. No binding of the CaV{beta} subunits to the control GST-fusion protein was detected (data not shown). CaV{beta}1b and CaV{beta}2a exhibited specific binding to the I-II linker of CaV2.2. From the data shown in Figure 1B, the dissociation constants (KD) of CaV{beta}1b and CaV{beta}2a for the I-II loop of CaV2.2 were calculated to be 13.8 and 10.3 nM, respectively. Negligible binding of either CaV{beta} subunit was detected to the mutated CaV2.2W391A I-II linker, and thus the KD values could not be determined. We can only estimate that they must be at least 1000-fold less than for the I-II linker of the wild-type channel. From this assay, we show that the W391 present in the AID is crucial for the binding of CaV{beta} subunits to the proximal CaV2.2 I-II linker, and that the affinity for {beta} binding to this construct is very similar to that observed previously for the full-length I-II linker (Bell et al., 2001Go).



View larger version (33K):
[in this window]
[in a new window]
 
Figure 1. The W391A mutation prevents the binding of CaV{beta}1b and CaV{beta}2a to CaV2.2 I-II linker. A, Representation of the CaV2.2 subunit that is composed of four domains of six transmembrane segments each. The I-II linker contains an 18 amino acid domain (AID) that interacts with CaV{beta} subunits (dotted box). The sequence of the AID within CaV2.2 and CaV2.2W391A are given below, with W391 underlined and also showing the putative overlapping binding motif for G{beta}{gamma} dimer binding. B, Representative Biacore sensorgrams showing interactions between CaV{beta}1b (top) or CaV{beta}2a (bottom) with I-II loop GST-fusion proteins from CaV2.2 (left) and CaV2.2W391A (right). The auxiliary CaV{beta} subunits (25-200 nM as indicated) were applied during the time indicated by the bars.

 
CaV{beta} subunit binding is essential for functional expression of N-type calcium channels at the plasma membrane
Coexpression of CaV2.2 or CaV2.2W391A with accessory CaV{beta} subunits allowed us to compare the biophysical properties of the wild-type and mutated channels. The {alpha}2{delta}-2 subunit was additionally present in all conditions in this study. The first striking effect of the W391A mutation was a large reduction of the current density for the mutated channel, consistent with a role of CaV{beta} binding to the I-II linker in trafficking CaV1 and CaV2 channels to the plasma membrane (Bichet et al., 2000Go) (Fig. 2A). The Gmax determined from the I-V relationships for CaV2.2W391A with CaV{beta}1b was significantly decreased by 81 ± 3% compared with the CaV2.2/{beta}1b combination (Fig. 2A; Table 1). The reduction in Gmax was similar (94 ± 0.5%) when the wild-type channel was expressed in the absence of CaV{beta} (Fig. 2A; Table 1). Similarly, the Gmax was decreased by 72 ± 6% for CaV{beta}2a with CaV2.2W391A compared with the CaV2.2/{beta}2a combination (Fig. 2A; Table 1). In cells transfected with CaV2.2W391A in the absence of a CaV{beta} subunit, none of the GFP-positive cells expressed any current (n = 21), whereas at least 90% of the GFP-positive CaV2.2/{beta}1b-transfected cells displayed a current. This strongly suggests that CaV2.2 requires interaction via the I-II linker with a CaV{beta} to traffic to the plasma membrane.


View this table:
[in this window]
[in a new window]
 
Table 1. Biophysical properties of Cav2.2 and Cav2.2W391A

 



View larger version (33K):
[in this window]
[in a new window]
 
Figure 2. Role of CaV{beta} subunits in plasma membrane expression of CaV2.2. A, Left, I-V relationships for CaV2.2/{alpha}2{delta}-2 coexpressed with CaV{beta}1b (filled circles, left; n = 18) or CaV{beta}2a (diamonds, right; n = 13) or without a CaV{beta} subunit (filled squares, left; n = 13) compared with I-V relationships for CaV2.2W391A/{alpha}2{delta}-2 coexpressed with CaV{beta}1b (filled stars, left; n = 11) or CaV{beta}2a (filled triangles, right; n = 14). The mean data are fitted with a modified Boltzmann function (see Materials and Methods), the V50, act and Gmax values of which are given in Table 1. Typical Ba2+ current traces at +20 mV (identified by the symbols used) are shown above the I-V relationships. Right, Mean current density at +20 mV for each of these combinations ± SEM. B, Cell surface expression of either CaV2.2 or CaV2.2WA391A expressed with {alpha}2{delta}-2, either without CaV{beta} or with CaV{beta}1b (left) or with CaV{beta}2a (right). Total expression of CaV2.2 is shown by Western blot in the top row and biotinylated CaV2.2 in the bottom row. Cells were transfected with empty vector (lane 1), CaV2.2/{alpha}2{delta}-2/{beta}1b (lane 2), CaV2.2W391A/{alpha}2{delta}-2/{beta}1b (lane 3), CaV2.2/{alpha}2{delta}-2 (lane 4), CaV2.2/{alpha}2{delta}-2/{beta}2a (lane 5), or CaV2.2W391A/{alpha}2{delta}-2/{beta}2a (lane 6). Note that only the cell surface expression is affected similarly by the W391A mutation or by the absence of CaV{beta}. Right, Histogram showing quantification of the mean amount of CaV2.2WA391A expressed at the plasma membrane, when coexpressed with either {beta}1b or {beta}2a, or CaV2.2 without CaV{beta}, given as a percentage of the amount of CaV2.2 expressed with the relevant CaV{beta} present under the same conditions. Data are mean ± SEM of four independent experiments. MW, Molecular weight. C, Western blot illustrating the endogenous expression of CaV{beta}3 in tsA-201 cells. Gel loaded with 2.5 µg of protein prepared from cells transfected with CaV{beta}3 (lane 1) compared with 2.5 or 250 µg of protein from cells transfected with an empty pMT2 vector (lanes 2, 3). An anti-{beta}3 monoclonal antibody was used for immunoblotting.

 
We used a biotinylation assay to assess biochemically whether there were fewer channels present at the surface of the tsA-201 cells transfected with CaV2.2W391A and a CaV{beta} subunit or when CaV2.2 was expressed without a CaV{beta} subunit, compared with wild-type CaV2.2/CaV{beta} combination. Whereas the total expression of CaV2.2W391A was identical to the expression of CaV2.2 transfected with or without a CaV{beta}, the amount of biotinylated channels at the plasma membrane was clearly lower (Fig. 2B). The W391A mutation decreased by 62 ± 5 and 37 ± 3% (n = 4) the number of channels that were present at the plasma membrane when coexpressed with CaV{beta}1b or CaV{beta}2a, respectively. A similar diminution of the surface expression (by 52 ± 6%) was observed for the wild-type CaV2.2 when expressed without CaV{beta} (Fig. 2B). Even when the binding of CaV{beta} subunits to the proximal I-II linker, including the W391A AID, was negligible in vitro, some channels were still able to traffic to the plasma membrane. It is therefore possible that CaV{beta} subunits can bind to other binding sites present, for example, in the distal I-II linker or on the N and C terminus of the channel as suggested previously (Cornet et al., 2002Go; Maltez et al., 2005Go).

Given the foregoing results, the reason for the presence of a low level of wild-type CaV2.2 current in the absence of expressed CaV{beta} may therefore be the presence of an endogenous {beta} subunit as described previously in Xenopus oocytes (Canti et al., 2001Go). This was examined by Western blotting using specific CaV{beta} antibodies. We clearly detected an endogenously expressed CaV{beta}3 in tsA-201 cells (Fig. 2C). This endogenous CaV{beta} may be responsible for trafficking wild-type CaV2.2, allowing small currents to be recorded in cells transfected without CaV{beta} subunits, whereas the much lower affinity of the CaV2.2W391A channel would preclude any interactions with the low level of endogenous CaV{beta}.

Biophysical properties of CaV2.2W391A expressed with CaV{beta}1b are similar to those of CaV2.2 expressed without CaV{beta}
CaV{beta}1b is known to hyperpolarize the activation and the steady-state inactivation of HVA calcium channels (for review, see Dolphin, 2003aGo). If the W391A mutation were effectively disrupting the binding of CaV{beta}1b to the channel, the biophysical properties of CaV2.2W391A should be comparable with those of CaV2.2 expressed without any CaV{beta} subunit. This was indeed the case, because tail current analysis showed the V50, act to be depolarized by +9.8 and +11.2 mV, respectively, for CaV2.2W391A/{beta}1b and CaV2.2 in the absence of CaV{beta} compared with CaV2.2/{beta}1b (Fig. 3A,B; Table 1), confirming the V50, act estimates obtained from the I-V relationships (Table 1). This indicated that the W391A mutation abolished the effect of CaV{beta}1b on the voltage dependence of activation of CaV2.2, such that it behaved like the wild-type channel expressed without a CaV{beta} subunit.

Another important feature of CaV{beta}1, {beta}3, and {beta}4 subunits is that they hyperpolarize the steady-inactivation curves of CaV2.2 as well as other HVA calcium channels (Bogdanov et al., 2000Go). The potential for half-inactivation (V50, inact) was -48.6 mV for CaV2.2 expressed with CaV{beta}1b (Fig. 3C,D; Table 1). Again, in agreement with the assumption that the I-II linker of the CaV2.2W391A channel does not bind CaV{beta}1b, we found a significant depolarizing shift of the steady-state inactivation for CaV2.2W391A/{beta}1b [by +13 mV (Table 1)], whose steady-state inactivation curve is superimposed on that of CaV2.2 expressed without CaV{beta}1b (Fig. 3C,D; Table 1). CaV{beta} subunits are known to modulate not only the voltage dependence of the inactivation of calcium channels but also the kinetics of current decay (for review, see Dolphin, 2003aGo). The time constant of inactivation ({tau}inact) of the CaV2.2W391A/{beta}1b current at +20 mV (209.2 ± 14.5 ms; n = 14) was smaller than that of the wild-type CaV2.2/{beta}1b combination (510.3 ± 51.6 ms; n = 25; p < 0.01), whereas the wild-type CaV2.2 expressed without a CaV{beta} subunit showed intermediate inactivation (Fig. 3E). The faster inactivation kinetics for the CaV2.2W391A/{beta}1b currents might be explained by the introduction of the mutation itself, because it has been shown previously that mutations in the AID are able to alter the inactivation kinetics (Dafi et al., 2004Go; Berrou et al., 2005Go).

Altogether, these results indicate that CaV2.2W391A is not regulated by CaV{beta}1b in the plasma membrane. Furthermore, if, as our evidence suggests, CaV2.2 expressed without CaV{beta} subunit is trafficked to the plasma membrane by endogenous CaV{beta}, this CaV{beta} does not regulate the channels once they have reached the membrane, as suggested previously (Canti et al., 2001Go).

Differential modulation of N-type channels by CaV{beta}2a subunits
Despite the fact that the W391A mutation effectively decreased the expression of CaV2.2W391A channels at the plasma membrane in the presence of CaV{beta}2a as well as CaV{beta}1b, no shift of activation was observed of the I-V curves when CaV{beta}2a was coexpressed with CaV2.2W391A compared with the wild-type CaV2.2/{beta}2a combination (Fig. 2A). This was confirmed by analysis of tail currents. The V50, act was equivalent when either CaV2.2 or CaV2.2W391A was coexpressed with CaV{beta}2a (Fig. 4A,B; Table 1).

As expected, CaV{beta}2a depolarized the V50, inact of CaV2.2 by +42 ± 2 mV compared with CaV2.2 expressed without CaV{beta} (Fig. 4C,D; Table 1). However, contrary to all expectations, we found that CaV{beta}2a was also able to depolarize the steady-state inactivation properties of CaV2.2W391A to the same extent as for wild-type CaV2.2 (Fig. 4D; Table 1). Furthermore, CaV{beta}2a also slowed the inactivation kinetics of CaV2.2W391A currents (Fig. 4E), abolishing the acceleration of the inactivation observed when CaV2.2W391A was coexpressed with CaV{beta}1b (Fig. 3E), as noted previously for other mutations in the AID region (Dafi et al., 2004Go). The decay of the currents was <40% during the 800 ms depolarizing pulses and therefore could not be fitted with an exponential function, so we estimated the inactivation rate from the ratio of the current at 600 ms to that at the peak. The ratio at +20 mV was equivalent when CaV{beta}2a was coexpressed with either CaV2.2 (0.76 ± 0.06) or the mutated channel (0.77 ± 0.08) (Fig. 4E).



View larger version (29K):
[in this window]
[in a new window]
 
Figure 3. Biophysical properties of CaV2.2 and CaV2.2W391A coexpressed with CaV{beta}1b. A, Representative current traces to illustrate current activation. Ba2+ tail currents were recorded after repolarizing to -50 mV after a 20 ms test pulse to between -40 and +80 mV from a holding potential of -100 mV. Top, CaV2.2/{beta}1b; middle, CaV2.2 without any CaV{beta}; bottom, CaV2.2W391A/{beta}1b, all coexpressed with {alpha}2{delta}-2. B, Voltage dependence of activation of CaV2.2/{alpha}2{delta}-2 coexpressed with CaV{beta}1b (filled circles) or without any CaV{beta} subunit (filled squares) or CaV2.2W391A/{alpha}2{delta}-2 expressed with CaV{beta}1b (filled stars). The normalized data, obtained from recordings such as those shown in A, are plotted against the test pulse (n = 6-19). The mean data are fitted with a Boltzmann function, the V50, act values of which are given in Table 1. C, Representative current traces (labeled as in A) to illustrate steady-state inactivation protocols. Inward Ba2+ currents were recorded after conditioning pulses of 5 s duration, applied from a holding potential of -100 mV in 10 mV steps between -110 and +30 mV, followed by a 50 ms test pulse to +20 mV. D, Voltage dependence of steady-state inactivation of CaV2.2/{alpha}2{delta}-2 coexpressed with CaV{beta}1b (filled circles) or without any CaV{beta} subunit (filled squares) or CaV2.2W391A/{alpha}2{delta}-2 expressed with CaV{beta}1b (filled stars). The normalized data obtained from recordings such as those shown in C are plotted against the conditioning potentials (n = 6-19). The mean data are fitted with a Boltzmann function, the V50,inact values of which are given in Table 1. E, Left, Superposition of representative current traces for the subunit combinations indicated, recorded during an 800 ms depolarizing step to +20 mV, from a holding potential of -100 mV, normalized to the peak current. Right, Mean time constants of inactivation ({tau}inact) obtained by fitting the decaying phase of the Ba2+ currents at +20 mV with a single exponential, for CaV2.2/{alpha}2{delta}-2/{beta}1b (black bar; n = 25), CaV2.2/{alpha}2{delta}-2 (white bar; n = 25), and CaV2.2W391A/{alpha}2{delta}-2/{beta}1b (gray bar; n = 14).

 
In summary, despite the fact that the W391 mutation was able to diminish the trafficking of the CaV2.2W391A channels to the plasma membrane with all of the CaV{beta} subunits examined and in contrast to the results obtained for CaV{beta}1b, the CaV2.2W391A/{beta}2a channels expressed at the cell surface were still modulated by CaV{beta}2a.



View larger version (25K):
[in this window]
[in a new window]
 
Figure 4. Biophysical properties of CaV2.2 and CaV2.2WA391A coexpressed with CaV{beta}2a. A, Representative current traces to illustrate current activation using the same protocols as described in the legend to Figure 3. Top, CaV2.2/{beta}2a; bottom, CaV2.2W391A/{beta}2a, all coexpressed with {alpha}2{delta}-2. B, Voltage dependence of activation for CaV2.2/{alpha}2{delta}-2 coexpressed with CaV{beta}2a (filled diamonds; n = 10) or CaV2.2W391A/{alpha}2{delta}-2 expressed with CaV{beta}2a (filled triangles; n = 12). The normalized data obtained from recordings such as those shown in A are plotted against the test pulse. The mean data are fitted with a Boltzmann function, the V50, act values of which are given in Table 1. C, Representative current traces to illustrate steady-state inactivation using the same protocols as described in the legend to Figure 3. Top, CaV2.2/{beta}2a; bottom, CaV2.2W391A/{beta}2a. D, Voltage dependence of steady-state inactivation for CaV2.2/{alpha}2{delta}-2 coexpressed with CaV{beta}2a (filled diamonds; n = 17) or CaV2.2W391A/{alpha}2{delta}-2 expressed with CaV{beta}2a (filled triangles; n = 18). The normalized data obtained from recordings such as those shown in C are plotted against the conditioning potentials. The mean data are fitted with a Boltzmann function, the V50, inact values of which are given in Table 1. The dotted line represents the fit for CaV2.2 without CaV{beta} from Figure 3D. E, Left, Superposition of representative current traces for the subunit combinations indicated, recorded during an 800 ms depolarizing step to +20 mV, from a holding potential of -100 mV and normalized to the peak current. Right, Normalized residual IBa at 600 ms, for CaV2.2/{alpha}2{delta}-2/{beta}2a (black bar; n = 15) and CaV2.2W391A/{alpha}2{delta}-2/{beta}2a (gray bar; n = 14).

 
Interaction with a CaV{beta} subunit is essential for the voltage dependence of the modulation of CaV2.2 calcium channels by G-protein activation
To investigate the importance of the W391 residue for the modulation by G-proteins of CaV2.2 calcium channels, we coexpressed a D2 dopamine receptor with the CaV2.2, CaV{beta}1b, {alpha}2{delta}-2 combination and activated the receptor with a maximal concentration (100 nM) of the agonist quinpirole. Figure 5A shows representative currents obtained before (P1) and immediately after (P2) a 100 ms depolarizing prepulse to +100 mV, before and during application of quinpirole. The currents measured at +10 mV were inhibited by quinpirole by 64.2 ± 4% for the wild-type channel (Fig. 5A, B). The P2/P1 ratio obtained from traces such as those represented in Figure 5A reflects the voltage-dependent loss of inhibition. A value of 2.3 ± 0.1 (n = 18) was obtained for P2/P1 at +10 mV for the wild-type channel expressed with CaV{beta}1b (Fig. 5C).



View larger version (27K):
[in this window]
[in a new window]
 
Figure 5. G-protein modulation of CaV2.2 and CaV2.2W391A expressed with CaV{beta}1b. Top, The pulse protocol used is depicted. A 100 ms test pulse (P1) from -30 to +60 mV was applied from a holding potential of -100 mV. After 800 ms repolarization to -100 mV, a 100 ms prepulse to +100 mV was applied. The cell was repolarized for 20 ms to -100 mV, and a second pulse (P2) identical to the first one was applied. A, D, Typical current traces obtained with this protocol are represented for CaV2.2 (top) and CaV2.2W391A (bottom) coexpressed with CaV{beta}1b. In A, the D2 dopamine receptor is coexpressed, and the top current traces (depicted by the open symbols) are in the presence of the agonist quinpirole (100 nM). In D, G{beta}1{gamma}2 are coexpressed, and typical traces for CaV2.2/{beta}1b and CaV2.2W391A/{beta}1b are shown. B, I-V curves for the calcium channel combinations are shown, obtained before (filled symbols) and during (open symbols) application of 100 nM quinpirole. Top, I-V curves for CaV2.2/{alpha}2{delta}-2 coexpressed with CaV{beta}1b (circles; n = 18) Bottom, I-V curves for CaV2.2W391A/{alpha}2{delta}-2 coexpressed with CaV{beta}1b (stars; n = 11) are represented. I-V curves are fitted with modified Boltzmann functions, the V50, act and Gmax parameters of which are given in Table 1. E, Top, I-V curves for Ba2+ currents during P1 for CaV2.2/{alpha}2{delta}-2/{beta}1b coexpressed without (filled circles; n = 6) or with (open triangles; n = 9) G{beta}1{gamma}2. Bottom, For CaV2.2W391A/{alpha}2{delta}-2/{beta}1b coexpressed without (stars; n = 6) or with (open squares; n = 8) G{beta}1{gamma}2. I-V curves obtained from currents recorded during P2 when G{beta}1{gamma}2 was coexpressed with CaV2.2/{alpha}2{delta}-2/{beta}1b (filled triangles; n = 9) or CaV2.2W391A/{alpha}2{delta}-2/{beta}1b (filled squares; n = 8) are also represented. All data were obtained in parallel on the same experimental days. C, Voltage-dependent facilitation was calculated by dividing the peak current value obtained in P2 by that obtained in P1 at the potentials of 0, +10, and +20 mV, for CaV2.2/{alpha}2{delta}-2 with CaV{beta}1b (black bars; n = 18), CaV2.2W391A/{alpha}2{delta}-2 with CaV{beta}1b (white bars; n = 11) after application of quinpirole, or when G{beta}1{gamma}2 were coexpressed with CaV2.2/{beta}1b (gray bars; n = 9), CaV2.2W391A/{beta}1b (hatched bars; n = 8). F, Typical current traces at +20 mV for R52, 54ACaV2.2W391A (top) coexpressed with CaV{beta}1b before (filled circles) and after (open circles) activation of the D2 dopamine receptor. Corresponding I-V curves are represented in the bottom.

 
For the CaV2.2W391A/{beta}1b currents, inhibition by quinpirole was similar, being 58.8 ± 5.2% at +10 mV (n = 11) (Fig. 5A, B). This inhibition was prevented by preincubating the cells for 16 h with 100 ng/ml pertussis toxin (PTX), as was inhibition of the wild-type currents (data not shown). However, the P2/P1 ratio was markedly diminished to 1.3 ± 0.1 at +10 mV (n = 11; p < 0.01) (Fig. 5C), demonstrating a lack of voltage-dependent loss of the G-protein modulation for the mutated channel. In agreement with this, when the CaV2.2W391A/{beta}1b combination was coexpressed with G{beta}1{gamma}2, it resulted in tonic inhibition compared with controls in the absence of G{beta}1{gamma}2, but these currents exhibited no slowed activation and no prepulse facilitation, in contrast to the wild-type CaV2.2/{beta}1b currents (Fig. 5C-E). Furthermore, although the V50,act of the I-V relationship was depolarized by +12.9 mV for the wild-type channel when G{beta}1{gamma}2 were cotransfected, it was only depolarized by +4.5 mV for the CaV2.2W391A channels, in agreement with a reduced voltage dependence of the modulation by G{beta}{gamma} of CaV2.2W391A channels. Moreover, two arginines (R52 and R54) present in the N terminus of CaV2.2 are essential for the modulation by G{beta}{gamma} of CaV2.2 calcium channels (Canti et al., 1999Go). After mutation of these two amino acids to alanines in the N terminus of CaV2.2W391A, quinpirole no longer inhibited the currents. This shows that these residues, and therefore G{beta}{gamma}, are involved in the voltage-independent inhibition of CaV2.2W391A induced by activation of the D2 dopamine receptor by quinpirole (Fig. 5F).

To investigate whether these data were contaminated by the increased inactivation rate of the CaV2.2W391A/{beta}1b combination compared with wild-type CaV2.2/{beta}1b currents, we also examined the quinpirole-mediated inhibition of the wild-type and mutated channels expressed with CaV{beta}3, which produces more inactivation of wild-type CaV2.2 than does CaV{beta}1b (Fig. 6A). Unsurprisingly, when CaV2.2W391A was coexpressed with CaV{beta}3, the Gmax was dramatically reduced by 83 ± 4% compared with wild-type CaV2.2/{beta}3 (Fig. 6A; Table 1). There was also a +4.5 mV shift of the V50, act for CaV2.2W391A compared with wild-type CaV2.2/{beta}3, and the CaV{beta}3 subunit did not hyperpolarize the steady-state inactivation of CaV2.2W391A (Table 1). This suggests that, like CaV{beta}1b, CaV{beta}3 is not able to modulate the biophysical properties of CaV2.2W391A. However, quinpirole still inhibited CaV2.2W391A/{beta}3 currents by 57.8 ± 11.8% at +10 mV (p < 0.01) (Fig. 6A). Furthermore, the voltage-dependent facilitation at +10 mV was greatly diminished from 2.5 ± 0.2 when CaV{beta}3 was coexpressed with wild-type CaV2.2 to 1.3 ± 0.2 (n = 7; p < 0.01) for the CaV2.2W391A/{beta}3 combination (Fig. 6B).

Although the CaV2.2W391A currents exhibited faster inactivation kinetics than the wild-type currents, the decrease of facilitation observed for the CaV2.2W391A currents was not attributable to inactivation occurring during either P1 or the prepulse, because the facilitation was similar for currents formed from CaV2.2 with either CaV{beta}1b or CaV{beta}3, despite the fact that the latter showed accelerated inactivation kinetics (at +20 mV; {tau}inact = 174.1 ± 17.1 ms; n = 7). In addition, at all prepulse durations from 5 to 200 ms, the P2/P1 ratio for the CaV2.2W391A/{beta}1b currents remained markedly reduced compared with CaV2.2/{beta}1b (Fig. 6C). Therefore, the inactivation occurring during the prepulse is not responsible for the apparent decrease in facilitation of CaV2.2W391A. Furthermore, the kinetics of facilitation could be fit to a single exponential, whose time constant ({tau}facil) for CaV2.2/{beta}1b was 9.0 ± 1.4 ms (Fig. 6C), whereas the small residual facilitation was much slower for the CaV2.2W391A/{beta}1b combination ({tau}facil = 16.7 ± 3.2 ms). These results indicate that CaV{beta} accelerates the kinetics of facilitation as described previously (Canti et al., 2000Go), but also that the presence of a CaV{beta} subunit, bound with high affinity to the I-II linker of CaV2.2, is essential for the voltage-dependent loss of inhibition, i.e., the ability of a +100 mV prepulse to remove G{beta}{gamma}-mediated inhibition in P2.



View larger version (24K):
[in this window]
[in a new window]
 
Figure 6. The kinetics of inactivation do not contaminate the properties of G-protein modulation of CaV2.2 and CaV2.2W391A. A, Typical current traces obtained for CaV2.2/{alpha}2{delta}-2 and CaV2.2W391A/{alpha}2{delta}-2 coexpressed with CaV{beta}3 and the D2 dopamine receptor are represented (top). I-V curves obtained for these combinations before (filled symbols) and during (100 nM) application of quinpirole (open symbols) are also shown (bottom). B, Voltage-dependent facilitation for CaV2.2/{alpha}2{delta}-2 (black bars; n = 7) or CaV2.2W391A/{alpha}2{delta}-2 coexpressed with CaV{beta}3 (white bars; n = 7) obtained from the P2/P1 ratio when the D2 dopamine receptor was activated by 100 nM quinpirole. C, Facilitation rate of G-protein-modulated channels. The duration of the prepulse was increased from 0 to 200 ms. The P2/P1 facilitation ratios are given for each prepulse, for CaV2.2 (open circles; n = 16) and CaV2.2W391A (open stars; n = 17) coexpressed with CaV{beta}1b. Data are fitted with a single exponential, the time constant ({tau}facil) of which is given in Results.

 
A related characteristic of the G-protein modulation of CaV2 channels is that the kinetics of current activation are slowed. Activation of the D2 dopamine receptor significantly slowed the activation kinetics of CaV2.2 channels coexpressed with CaV{beta}1b, increasing the time constant of activation ({tau}act) from 2.0 ms to a combination of a similar fast {tau}act,fast (2.2 ms) and a much slower {tau}act,slow of 23.4 ms representing 36.5% of the current (Figs. 5A, 7A). In contrast, the activation kinetics for CaV2.2W391A/{beta}1b measured during a pulse to +10mV were unaffected by quinpirole. {tau}act remained fast both before (2.1 ms) and during (2.1 ms) activation of the receptor (Figs. 5A, 7A).

Another hallmark of G-protein modulation is the depolarization of the voltage dependence of current activation. For the wild-type CaV2.2 coexpressed with CaV{beta}1b, application of quinpirole induced a +17.5 mV shift of the V50, act, from +14.6 ± 1.8 to +32.1 ± 2.5 mV (n = 19; p < 0.01) (Fig. 7B). This shift was reversible on washout of quinpirole (data not shown). There was no significant inhibition of tail current amplitude at +80 mV (13.5 ± 18.0%), indicating that all of the inhibition was entirely voltage dependent. In contrast, for CaV2.2W391A coexpressed with CaV{beta}1b, the tail currents were still significantly inhibited by 55.8 ± 11.9% at +80 mV (p < 0.01) (Fig. 7B). However, the V50, act for the residual CaV2.2W391A/{beta}1b was still depolarized by application of quinpirole by +14.9 mV, from +27.5 ± 3.7 to +42.4 ± 1.9 mV (p < 0.01) (Fig. 7B), as was also true for CaV2.2 expressed without a CaV{beta} subunit (data not shown), possibly indicating that G{beta}{gamma} can still affect the voltage dependence of gating of CaV2.2W391A by shifting the channel to a reluctant state. Altogether, these results strongly suggest that the loss of ability of CaV2.2W391A to bind CaV{beta}1b was accompanied by the almost complete loss of voltage dependence of the G-protein modulation of N-type calcium channels.

CaV2.2W391A coexpressed with CaV{beta}2a shows voltage-dependent G-protein modulation
When CaV{beta}2a was coexpressed with either CaV2.2 or CaV2.2W391A, quinpirole significantly inhibited the currents, by 64.4 ± 6.2% (p < 0.01) and 77.5 ± 6.1% (p < 0.01), respectively (Fig. 8A). Furthermore, in agreement with our evidence that CaV2.2W391A was still associated with CaV{beta}2a (Fig. 4), we observed voltage-dependent facilitation of the CaV2.2W391A/{beta}2a combination, equivalent to that observed for the wild-type CaV2.2/{beta}2a (Fig. 8A,B). The P2/P1 ratio at +10 mV was 4.3 ± 0.6 for the wild-type channel and 3.7 ± 0.4 for CaV2.2W391A (Fig. 8B).

For the CaV2.2/{beta}2a combination, {tau}act was slowed by application of quinpirole from 2.2 ± 0.1 ms to a combination of a similar {tau}act, fast (2.2 ms) and a very slow {tau}act, slow (>400 ms), representing 51% of the current at 100 ms (Fig. 8C). The activation kinetics of CaV2.2W391A were similarly slowed from a {tau}act of 2.4 ± 0.1 ms to a combination of a similar {tau}act, fast (2.4 ms) and a very slow {tau}act, slow (>400 ms), representing 46% of the current at 100 ms (Fig. 8C). From tail currents recorded before and during activation of D2 dopamine receptors, we observed an equivalent shift of V50, act of +12.0 ± 1.7 and +15.6 ± 2.3 mV for CaV2.2 and the mutated channel, respectively (Fig. 8D). At +80 mV, the control tail current amplitude was not significantly greater that that in the presence of quinpirole for CaV2.2W391A/{beta}2a (Fig. 8D), in contrast to the results obtained when CaV{beta}1b was coexpressed with CaV2.2W391A. We can conclude that CaV{beta}2a was still able to support voltage-dependent removal of the inhibition of CaV2.2W391A induced by activation of the D2 dopamine receptors.

Palmitoylation is responsible for the ability of CaV{beta}2a to regulate the voltage-dependent properties of CaV2.2W391A
A peculiarity of CaV{beta}2a is that it contains two cysteines in its N terminus that are palmitoylated. Palmitoylation of these residues strongly modulates the biophysical properties of calcium channels associated with CaV{beta}2a, particularly their inactivation (Olcese et al., 1994Go; Chien et al., 1996Go; Qin et al., 1998Go; Bogdanov et al., 2000Go; Hurley et al., 2000Go; Restituito et al., 2000Go). To investigate the role of this palmitoylation, we used a CaV{beta}2a with the cysteines C3 and C4 mutated to serines (CaV{beta}2aC3,4S) (Bogdanov et al., 2000Go) that is unable to incorporate palmitate (Qin et al., 1998Go). Coexpressing CaV2.2 with CaV{beta}2aC3,4S resulted in a significant hyperpolarization of the tail current V50, act by -11.4 mV compared with CaV2.2/{beta}2a (Fig. 9A; Table 1). The effect of CaV{beta}2aC3,4S was therefore similar to CaV{beta}1b. In contrast, when CaV{beta}2aC3,4S was coexpressed with CaV2.2W391A, the voltage dependence of activation of the channel did not show any hyperpolarizing shift compared with CaV2.2W391A/{beta}2a (Fig. 9A; Table 1), suggesting that, when not palmitoylated, the CaV{beta}2aC3,4S subunit was not able to modulate the CaV2.2W391A channel.

As described previously (Qin et al., 1998Go; Bogdanov et al., 2000Go; Hurley et al., 2000Go; Restituito et al., 2000Go), coexpressing this mutated CaV{beta}2aC3,4S subunit with CaV2.2 significantly hyperpolarized the steady-state inactivation compared with wild-type CaV{beta}2a, by -51 mV (Fig. 9B; Table 1), and accelerated the kinetics of inactivation (Fig. 9C). In contrast, the steady-state inactivation V50, inact of the CaV2.2W391A channel coexpressed with CaV{beta}2aC3,4S was significantly depolarized by >10 mV compared with the inactivation of the CaV2.2 channel in the presence of CaV{beta}2aC3,4S (Fig. 9B; Table 1), suggesting a lack of modulation of CaV2.2W391A by CaV{beta}2aC3,4S. As expected, currents recorded from cells expressing CaV2.2W391A with CaV{beta}2aC3,4S also exhibited fast kinetics of inactivation, similar to those of this channel when coexpressed with CaV{beta}1b (Fig. 9C).

We next determined whether the G-protein modulation of the wild-type CaV2.2/{beta}2aC3,4S combination would be affected by the lack of palmitoylation of the CaV{beta} subunit. The currents in this case were still inhibited by 58.9 ± 2.6% (n = 8) (Fig. 9D), and the P2/P1 facilitation ratio was 3.5 ± 0.4 at +10 mV, comparable with that for the wild-type channel coexpressed with CaV{beta}2a (Fig. 9D). However, when this mutated CaV{beta}2aC3,4S was coexpressed with the mutated CaV2.2W391A, although the currents were still significantly inhibited by activation of the D2 dopamine receptor by 61.4 ± 6.9% (n = 7) (Fig. 9D), the P2/P1 ratio was significantly diminished to 1.2 ± 0.7 at +10 mV (Fig. 9D). These results demonstrate that, when the W391A mutation in the I-II linker of CaV2.2 is accompanied by the mutation of the two palmitoylation sites in the N terminus of CaV{beta}2a, it abolishes the ability of CaV{beta}2a to support the voltage dependence of G-protein modulation of the channel. The lack of palmitoylation is confirmed by the altered distribution when expressed in tsA-201 cells, from wild-type CaV{beta}2a being predominantly membrane associated to diffuse expression throughout the cytoplasm for CaV{beta}2aC3,4S (Fig. 10A).

To confirm that this property was inherent to the palmitoylation of the CaV{beta} subunit, we used a chimera in which the N terminus of CaV{beta}1b was swapped with that of CaV{beta}2a to obtain a palmitoylatable CaV{beta}1b (Olcese et al., 1994Go). The CaV{beta}2a-{beta}1b chimera was able to depolarize the V50,act of CaV2.2W391A currents (Fig. 9A), similar to CaV{beta}2a. The chimeric CaV{beta}2a-{beta}1b subunit also significantly depolarized the steady-state inactivation of both the wild-type CaV2.2 channel and CaV2.2W391A by +37 and +17.8 mV, respectively, compared with channels containing the CaV{beta}1b subunit with CaV2.2 or CaV2.2W391A (Fig. 9B; Table 1). Furthermore, the chimeric CaV{beta}2a-{beta}1b subunit slowed the inactivation of the wild-type channel and, to a lesser extent, the mutated CaV2.2W391A (Fig. 9C). Moreover, when coexpressed with CaV{beta}2a-{beta}1b, CaV2.2W391A currents were modulated by G-protein activation in a voltage-dependent manner (Fig. 9D). CaV2.2W391A exhibited prepulse facilitation during application of quinpirole; the P2/P1 ratio in this case was 3.0 ± 0.2, which was comparable with the value obtained for the wild-type channel expressed with CaV{beta}2a-{beta}1b (3.4 ± 0.2) (Fig. 9D). Altogether, these results show that the W391 is crucial for the voltage-dependent effects of CaV{beta}1b and CaV{beta}3 but not for those of palmitoylated CaV{beta}2a, because palmitoylation of CaV{beta} can restore the voltage dependence of modulation of the mutated CaV2.2W391A channel.



View larger version (14K):
[in this window]
[in a new window]
 
Figure 7. G-protein modulation of the kinetics and voltage dependence of activation of CaV2.2 and CaV2.2W391A coexpressed with {beta}1b. A, The {tau}act for currents recorded in P1 as described in Figure 5 before and during perfusion of quinpirole in cells transfected with CaV2.2/{alpha}2{delta}-2/CaV{beta}1b (white and black bars, respectively; n = 18) and with CaV2.2W391A/{alpha}2{delta}-2/{beta}1b (gray and hatched bars, respectively; n = 11). For CaV2.2/{alpha}2{delta}-2/CaV{beta}1b in the presence of quinpirole, the data were fit by a double exponential with a fast {tau}act and a slow {tau}act, the percentage of each component being given above the bars. B, Activation curves derived from tail current amplitude measurements for CaV2.2/{alpha}2{delta}-2/{beta}1b (left) and CaV2.2W391A/{alpha}2{delta}-2/{beta}1b (right). Top, Typical tail current traces recorded after a test pulse to +80 mV before (filled symbols) and during (open symbols) application of 100 nM quinpirole. Bottom, Peak tail current density, before (filled symbols) and during (open symbols) application of quinpirole, for CaV2.2/{alpha}2{delta}-2/{beta}1b (circles, left) or CaV2.2W391A/{alpha}2{delta}-2/{beta}1b (stars, right). Data are the mean ± SEM of 12-19 cells, and the solid lines are Boltzmann functions fits, the parameters of which are given in Results.

 

    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
CaV{beta} subunits are membrane-associated guanylate-kinase proteins characterized by guanylate kinase-like (GK) domain that binds to the AID motif in the I-II loop of HVA CaVa1 subunits (Fig. 1A) and an Src homology 3 domain (SH3) (Hanlon et al., 1999Go). The 18 amino acid AID motif contains a conserved tryptophan that is crucial for binding CaV{beta} (Pragnell et al., 1994Go; Berrou et al., 2002Go). Recent structural data from three groups has provided detailed information about the interaction between the AID-CaV{beta} complex and confirmed that this tryptophan is deeply embedded in the binding groove within the GK of CaV{beta} (Chen et al., 2004Go; Opatowsky et al., 2004Go; Van Petegem et al., 2004Go).

Requirement of CaV{beta} for plasma membrane expression of HVA calcium channel
One of the main effects of CaV{beta} subunits on HVA calcium channels is to increase current density. However, the mechanism for this increase remains controversial, being attributed to increased trafficking (Bichet et al., 2000Go), increased maximum open probability (Neely et al., 2004Go), or both. Our data agree with previous studies showing biochemically that the amount of CaV1.2 channels in the plasma membrane was increased by CaV{beta} subunits (Altier et al., 2002Go; Cohen et al., 2005Go). We show that fewer channels are present at the surface when no CaV{beta} subunits were coexpressed or when the mutated CaV2.2W391A channels were cotransfected with a CaV{beta}. It has been suggested that a CaV{beta} bound to the I-II linker may mask an endoplasmic reticulum (ER) retention signal present in the I-II linker of HVA calcium channels and favor the trafficking of the channel to the cell surface (Bichet et al., 2000Go). If the trafficking of the channel were the only process affected by the lack of a CaV{beta} bound to the I-II linker of CaV2.2, the reduction of the current density, as judged by the Gmax, and the amount of CaV2.2 expressed at the plasma membrane would be the same. However, the Gmax was more affected than the plasma membrane expression of CaV2.2 (81 and 62% reduction, respectively, when coexpressed with CaV{beta}1b). The reason for this is likely to be that CaV{beta} not only traffics the channel to the surface but also increases the maximum open probability of the channel, as suggested previously (Wakamori et al., 1999Go; Meir et al., 2000Go; Neely et al., 2004Go).



View larger version (30K):
[in this window]
[in a new window]
 
Figure 8. G-protein modulation of the kinetics and voltage dependence of activation of CaV2.2 and CaV2.2W391A coexpressed with CaV{beta}2a. A, The effect of quinpirole (100 nM) is compared on the CaV2.2/{alpha}2{delta}-2/{beta}2a (left) and CaV2.2W391A/{alpha}2{delta}-2/{beta}2a (right) combinations. Representative currents traces using the P1/P2 pulse protocol shown in Figure 5, obtained before (Con) and during (Quin) application of 100 nM quinpirole. B, The P2/P1 facilitation ratios for CaV2.2/{alpha}2{delta}-2/{beta}2a (black bars; n = 13) or CaV2.2W391A/{alpha}2{delta}-2/{beta}2a (white bars; n = 14) at potentials between 0 and +20 mV are given. C, The {tau}act values for currents activated by +20 mV steps before and during application of quinpirole. Values are given for CaV2.2/{alpha}2{delta}-2/{beta}2a in control conditions (white bars) and in the presence of quinpirole (black bars; n = 13) or for the CaV2.2W391A (gray and hatched bars, respectively; n = 14). In the presence of quinpirole, the data were fit by two exponentials, with the percentage of the total represented by each component given above the bar. D, Activation derived from normalized tail current density before (filled symbols) and during (open symbols) application of quinpirole (100 nM) for the subunit combination CaV2.2/{alpha}2{delta}-2/{beta}2a (left, diamonds; n = 10) or CaV2.2W391A/{alpha}2{delta}-2/{beta}2a (right, triangles; n = 12). The solid lines are Boltzmann function fits to the mean data, the parameters of which are given in Results.

 
When no CaV{beta} was coexpressed with wild-type CaV2.2 channels, small currents remained, whereas none of the GFP-positive cells transfected with the mutated CaV2.2W391A channel alone expressed any current. This suggests that the endogenous CaV{beta}3 that we have identified in tsA-201 cells was responsible for trafficking some wild-type CaV2.2 to the plasma membrane, and that the markedly reduced affinity of the W391A mutated channel for CaV{beta} subunits prevented interaction with the endogenous CaV{beta}3 subunits and thus their trafficking to the plasma membrane. When a CaV{beta} subunit was cotransfected with CaV2.2W391A channel, a small fraction of these channels were then trafficked to the plasma membrane, presumably because the overexpressed CaV{beta} was able to either bind with low affinity to the mutated I-II linker of CaV2.2W391A or mask other ER retention signals that may be present on other parts of the channel (Cornet et al., 2002Go). Our results therefore provide very strong evidence that the binding of a CaV{beta} auxiliary subunit to the channel is an essential requirement for functional expression of CaV2.2 at the plasma membrane.



View larger version (32K):
[in this window]
[in a new window]
 
Figure 9. Effect of palmitoylation of CaV{beta} subunits on the modulation of CaV2.2 and CaV2.2W391A channels. A, Voltage dependence of activation of CaV2.2 (filled symbols) or CaV2.2W391A (open symbols) with either CaV{beta}2aC3,4S (triangles) or CaV{beta}2a-{beta}1b chimera (pentagons) and {alpha}2{delta}-2. The solid lines are Boltzmann function fits to the mean data, the parameters of which are given in Results. B, Voltage dependence of steady-state inactivation of CaV2.2 (filled symbols) or CaV2.2W391A (open symbols) with either CaV{beta}2aC3,4S (triangles) or CaV{beta}2a-{beta}1b chimera (pentagons) and {alpha}2{delta}-2. The solid lines are Boltzmann function fits to the mean data, the parameters of which are given in Results. C, Left, Representative Ba2+ current traces recorded during an 800 ms depolarizing step to +20 mV from a holding potential of -100 mV. Right, The normalized amount of residual current at 600 ms, obtained for CaV2.2 or CaV2.2W391A coexpressed with {alpha}2{delta}-2 and CaV{beta}2aC3,4S (black and white bars, respectively; n = 18 for both) or the CaV{beta}2a-{beta}1b chimera (gray and hatched bars; n = 23 and n = 19, respectively). D, Left, The effect of quinpirole (100 nM) is compared for the subunit combinations CaV2.2W391A/{alpha}2{delta}-2/{beta}2aC3,4S (top traces) and CaV2.2W391A/{alpha}2{delta}-2/{beta}2a-{beta}1b chimera (bottom traces). Representative currents traces using the P1/P2 pulse protocol shown in Figure 5, obtained before (Con) and during (Quin) application of 100 nM quinpirole. Right, The P2/P1 ratio obtained from such traces for CaV2.2 and CaV2.2W391A coexpressed with {alpha}2{delta}-2 and CaV{beta}2aC3,4S (black and white bars; n = 7 and n = 8, respectively) or the CaV{beta}2a-{beta}1b chimera (gray and hatched bars; n = 12 and n = 11 respectively).

 
Role of CaV{beta} in voltage-dependent modulation of N-type calcium channels
Apart from their important role in trafficking, CaV{beta} subunits also modify the biophysical properties of calcium channels (for review, see Dolphin, 2003aGo). Despite our conclusion that interaction with CaV{beta} (either endogenous or expressed) is essential for trafficking to the plasma membrane, when CaV2.2 was expressed alone, its activation and inactivation properties were shifted to more positive potentials compared with those for CaV2.2 coexpressed with CaV{beta}1b or CaV{beta}3. The CaV2.2W391A/{beta}1b or CaV{beta}3 combinations showed similar biophysical properties to wild-type CaV2.2 channels expressed without a CaV{beta}. Thus, although the channels required a CaV{beta} to be trafficked to the plasma membrane, they were not modulated by the CaV{beta} subunits when inserted in the plasma membrane, in agreement with our previous results suggesting two binding sites with differing affinities (Canti et al., 2001Go).



View larger version (57K):
[in this window]
[in a new window]
 
Figure 10. Proposed mechanism for G-protein modulation of CaV2.2 calcium channels and the effect of palmitoylation on the interaction of CaV{beta} subunits with the I-II linker. A, Confocal immunofluorescent images of {beta}2a and {beta}2aC3,4S subunits expressed in tsA-201 cells, using an anti-{beta}2 antibody (green). Nuclei are visualized with DAPI (blue). Scale bars, 20 µm. Note the membrane localization of the {beta}2a subunit (left), whereas the {beta}2aC3,4S subunit is localized to the cytoplasm (right). B, Model for the mechanism of action of G{beta}{gamma} binding to the channel to inhibit its activity. The N terminus of CaV2.2 containing two arginines (R52, R54) constitutes a motif implicated in the inhibition by G-proteins, whereas the voltage-dependent facilitation (loss of inhibition induced by strong depolarization) requires a bound CaV{beta} subunit on the I-II linker. C, The GK domain of CaV{beta} subunits interacts with the AID, allowing a low-affinity binding of its SH3 domain elsewhere on the channel (e.g., to the I-II loop of CaV2.2) (Maltez et al., 2005Go) to modulate the properties of the channel. Palmitoylation of CaV{beta} by anchoring the subunit to the plasma membrane allows this low-affinity interaction to occur when the W391 in the AID is mutated to disrupt its interaction with the GK domain.

 
G-protein modulation of CaV2.2 calcium channels requires CaV{beta} subunits to exhibit voltage dependence
Another unexpected feature of our results was that the CaV2.2W391A/{beta}1b currents were still inhibited by D2 dopamine receptor activation to the same extent as wild-type CaV2.2 channels, although there was no voltage-dependent relief of this inhibition. In our experiments, maximal inhibition of the CaV2.2W391A/{beta}1b currents remained fast, occurring within <10 s, and was PTX sensitive. Furthermore, CaV2.2W391A/{beta}1b currents were also tonically inhibited by G{beta}{gamma} in a voltage-independent manner. We suggest that G{beta}{gamma} dimers are involved both in the voltage-independent modulation of CaV2.2W391A/{beta}1b currents and in the voltage-dependent modulation of the wild-type CaV2.2 currents.

Two models have been proposed for the regulation of HVA calcium channels by G-proteins. In the first, G{beta}{gamma} dimers displace CaV{beta} from the I-II loop, resulting in the reluctant state (Sandoz et al., 2004Go), whereas in the second model, both G{beta}{gamma} and CaV{beta} subunits would be able to bind to the channel at the same time (Meir et al., 2000Go; Hummer et al., 2003Go; Richards et al., 2004Go), with G{beta}{gamma} binding producing the reluctant state. In the present study, the fact that activating the D2 dopamine receptor still leads to a large inhibition of CaV2.2W391A currents also suggests that the G{beta}{gamma} has direct effects on channel gating and does not simply displace CaV{beta} subunits. Moreover, Van Petegem et al. (2004Go) speculated that, because the G{beta}{gamma}-AID affinity is at least 10- to 20-fold weaker than the CaV{beta}-AID affinity and a major conformational change would be required for G{beta}{gamma} to displace CaV{beta}, this was unlikely to occur (Van Petegem et al., 2004Go).

We showed previously that two arginines in the N terminus of CaV2 calcium channels are critical for G-protein modulation (Canti et al., 1999Go). By mutating these residues in the N terminus of CaV2.2W391A, we demonstrate that they are also critical for the voltage-independent inhibition of the CaV2.2W391A channel, whereas the voltage-dependent removal of this inhibition, or facilitation, involving the unbinding of G{beta}{gamma} requires CaV{beta} to be bound to the I-II linker of the channel (Fig. 10B), as suggested previously (Meir et al., 2000Go).

Palmitoylation of CaV{beta}2a subunits allows its interaction with CaV2.2W391A
Unlike other CaV{beta} subunits, palmitoylated CaV{beta}2a depolarizes, rather than hyperpolarizes, the steady-state inactivation of HVA calcium channels (Jones et al., 1998Go; Restituito et al., 2000Go). This observation led to the conclusion that the I-II linker might constitute the inactivation gate of HVA calcium channels, with its mobility being reduced by the palmitoylation of CaV{beta}2a anchoring it to the plasma membrane (Restituito et al., 2000Go). In our study, the CaV2.2W391A channels trafficked to the plasma membrane by CaV{beta}2a remained modulated by this subunit, in contrast to CaV{beta}1b, and our evidence shows clearly that this is attributable to the palmitoylation of CaV{beta}2a. The mutated CaV{beta}C3,4S subunit was not able to modulate the biophysical properties of the CaV2.2W391A channels, demonstrating that palmitoylation of CaV{beta}2a helps to anchor the subunit to the channel. This hypothesis was confirmed by creating a palmitoylatable CaV{beta}1b that was able to modulate the biophysical properties of the CaV2.2W391A channel.

As shown recently (Cohen et al., 2005Go; Maltez et al., 2005Go) and confirmed here, the AID-GK interaction is essential to traffic the channels to the plasma membrane. Our data suggest that either this interaction is not promoted by palmitoylation of CaV{beta}2a or CaV{beta}2a is not palmitoylated during the trafficking process, until the CaV2.2/{beta}2a complex is inserted in the plasma membrane.

Short CaV{beta} subunits that lack the GK domain retain the ability to modulate the open probability of CaV1.2, suggesting another low-affinity binding site on the CaV subunit for the SH3 domain (Cohen et al., 2005Go). An interaction of the SH3 with the I-II linker has been then demonstrated that modulates biophysical properties of calcium channels such as their inactivation (Maltez et al., 2005Go). The authors suggest that the role of the high-affinity GK-AID interaction is to increase the local concentration of CaV{beta} and to promote lower-affinity interactions. In a similar way, palmitoylation of CaV{beta}2a, promoting its membrane localization (Fig. 10A) and thus increasing its local concentration, may allow its binding to the CaV2.2W391A channel via interaction with low-affinity binding sites, such as the C and N termini or other sites on the I-II linker (Fig. 10C), that might be critical for the voltage-dependent properties of the channel, including the voltage dependence of G-protein modulation (Walker et al., 1999Go; Stephens et al., 2000Go; Maltez et al., 2005Go).

We also show here that, despite differentially affecting the biophysical properties of calcium channels, CaV{beta}1b and CaV{beta}2a subunits play the same role in the voltage dependence of G-protein modulation. They are necessary for voltage-dependent facilitation presumably via the second low-affinity site. Our results therefore show conclusively that G{beta}{gamma} dimers have a direct inhibitory effect on CaV2.2 channel gating, and that CaV{beta} subunits are required for the voltage-dependent removal of this inhibition.


    Footnotes
 
Received March 23, 2005; revised June 13, 2005; accepted June 15, 2005.

This work was supported by The Wellcome Trust. We thank the following for generous gifts of cDNAs: Dr. Y. Mori (Seriken, Okazaki, Japan) for rabbit CaV2.2, Dr. M. Rees (University College London, London, UK) for mouse {alpha}2{delta}-2, Dr. E. Perez-Reyes (Loyola University, Chicago, IL) for rat {beta}2a, Dr. P. G. Strange (Reading, UK) for rat D2 dopamine receptor, M. Simon (California Institute of Technology, Pasadena, CA) for bovine G{beta}1 and G{gamma}2, Dr. L. Birnbaumer for the {beta}2a-{beta}1b chimera, T. E. Hughes (Yale University, New Haven, CT) for mut-3 GFP, and Genetics Institute (Cambridge, MA) for pMT2. We thank Dr. P. Viard and Dr. K. Page for critical reading of this manuscript. We also thank K. Chaggar and L. Douglas for technical assistance.

Correspondence should be addressed to Dr. Jérôme Leroy, Laboratory of Cellular and Molecular Neuroscience, Department of Pharmacology, University College London, Gower Street, London WC1E 6BT, UK. E-mail: j.leroy{at}ucl.ac.uk.

Copyright © 2005 Society for Neuroscience 0270-6474/05/256984-13$15.00/0

* M.S.R. and A.J.B contributed equally to this work. Back


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

Altier C, Dubel SJ, Barrere C, Jarvis SE, Stotz SC, Spaetgens RL, Scott JD, Cornet V, De Waard M, Zamponi GW, Nargeot J, Bourinet E (2002) Trafficking of L-type calcium channels mediated by the postsynaptic scaffolding protein AKAP79. J Biol Chem 277: 33598-33603.[Abstract/Free Full Text]

Barclay J, Balaguero N, Mione M, Ackerman SL, Letts VA, Brodbeck J, Canti C, Meir A, Page KM, Kusumi K, Perez-Reyes E, Lander ES, Frankel WN, Gardiner RM, Dolphin AC, Rees M (2001) Ducky mouse phenotype of epilepsy and ataxia is associated with mutations in the Cacna2d2 gene and decreased calcium channel current in cerebellar Purkinje cells. J Neurosci 21: 6095-6104.[Abstract/Free Full Text]

Bean BP (1989) Neurotransmitter inhibition of neuronal calcium currents by changes in channel voltage dependence. Nature 340: 153-156.[CrossRef][Medline]

Bell DC, Butcher AJ, Berrow NS, Page KM, Brust PF, Nesterova A, Stauderman KA, Seabrook GR, Nurnberg B, Dolphin AC (2001) Biophysical properties, pharmacology, and modulation of human, neuronal L-type ({alpha}1D, CaV1.3) voltage-dependent calcium currents. J Neurophysiol 85: 816-827.[Abstract/Free Full Text]

Berrou L, Klein H, Bernatchez G, Parent L (2002) A specific tryptophan in the I-II linker is a key determinant of {beta}-subunit binding and modulation in CaV2.3 calcium channels. Biophys J 83: 1429-1442.[Web of Science][Medline]

Berrou L, Dodier Y, Raybaud A, Tousignant A, Dafi O, Pelletier JN, Parent L (2005) The C-terminal residues in the alpha-interacting domain (AID) helix anchor CaV{beta} subunit interaction and modulation of CaV2.3 channels. J Biol Chem 280: 494-505.[Abstract/Free Full Text]

Bichet D, Cornet V, Geib S, Carlier E, Volsen S, Hoshi T, Mori Y, De Waard M (2000) The I-II loop of the Ca2+ channel {alpha}1 subunit contains an endoplasmic reticulum retention signal antagonized by the {beta} subunit. Neuron 25: 177-190.[CrossRef][Web of Science][Medline]

Bogdanov Y, Brice NL, Canti C, Page KM, Li M, Volsen SG, Dolphin AC (2000) Acidic motif responsible for plasma membrane association of the voltage-dependent calcium channel {beta}1b subunit. Eur J Neurosci 12: 894-902.[CrossRef][Web of Science][Medline]

Canti C, Page KM, Stephens GJ, Dolphin AC (1999) Identification of residues in the N terminus of {alpha}1B critical for inhibition of the voltage-dependent calcium channel by G{beta}{gamma}. J Neurosci 19: 6855-6864.[Abstract/Free Full Text]

Canti C, Bogdanov Y, Dolphin AC (2000) Interaction between G proteins and accessory subunits in the regulation of {alpha}1B calcium channels in Xenopus oocytes. J Physiol (Lond) 527: 419-432.[Abstract/Free Full Text]

Canti C, Davies A, Berrow NS, Butcher AJ, Page KM, Dolphin AC (2001) Evidence for two concentration-dependent processes for beta-subunit effects on {alpha}1B calcium channels. Biophys J 81: 1439-1451.[Web of Science][Medline]

Catterall WA (2000) Structure and regulation of voltage-gated Ca2+ channels. Annu Rev Cell Dev Biol 16: 521-555.[CrossRef][Web of Science][Medline]

Chen YH, Li MH, Zhang Y, He LL, Yamada Y, Fitzmaurice A, Shen Y, Zhang H, Tong L, Yang J (2004) Structural basis of the {alpha}1-{beta} subunit interaction of voltage-gated Ca2+ channels. Nature 429: 675-680.[CrossRef][Medline]

Chien AJ, Zhao X, Shirokov RE, Puri TS, Chang CF, Sun D, Rios E, Hosey MM (1995) Roles of a membrane-localized beta subunit in the formation and targeting of functional L-type Ca2+ channels. J Biol Chem 270: 30036-30044.[Abstract/Free Full Text]

Chien AJ, Carr KM, Shirokov RE, Rios E, Hosey MM (1996) Identification of palmitoylation sites within the L-type calcium channel {beta}2a subunit and effects on channel function. J Biol Chem 271: 26465-26468.[Abstract/Free Full Text]

Cohen RM, Foell JD, Balijepalli RC, Shah V, Hell JW, Kamp TJ (2005) Unique modulation of L-type Ca2+ channels by short auxiliary {beta}1d subunit present in cardiac muscle. Am J Physiol Heart Circ Physiol 288: H2363-H2374.[Abstract/Free Full Text]

Cornet V, Bichet D, Sandoz G, Marty I, Brocard J, Bourinet E, Mori Y, Villaz M, De Waard M (2002) Multiple determinants in voltage-dependent P/Q calcium channels control their retention in the endoplasmic reticulum. Eur J Neurosci 16: 883-895.[CrossRef][Web of Science][Medline]

Dafi O, Berrou L, Dodier Y, Raybaud A, Sauve R, Parent L (2004) Negatively charged residues in the N-terminal of the AID helix confer slow voltage dependent inactivation gating to CaV1.2. Biophys J 87: 3181-3192.[CrossRef][Web of Science][Medline]

De Waard M, Scott VE, Pragnell M, Campbell KP (1996) Identification of critical amino acids involved in {alpha}1-{beta} interaction in voltage-dependent Ca2+ channels. FEBS Lett 380: 272-276.[CrossRef][Web of Science][Medline]

Dolphin AC (2003a) Beta subunits of voltage-gated calcium channels. J Bioenerg Biomembr 35: 599-620.[CrossRef][Web of Science][Medline]

Dolphin AC (2003b) G protein modulation of voltage-gated calcium channels. Pharmacol Rev 55: 607-627.[Abstract/Free Full Text]

Ertel EA, Campbell KP, Harpold MM, Hofmann F, Mori Y, Perez-Reyes E, Schwartz A, Snutch TP, Tanabe T, Birnbaumer L, Tsien RW, Catterall WA (2000) Nomenclature of voltage-gated calcium channels. Neuron 25: 533-535.[CrossRef][Web of Science][Medline]

Hanlon MR, Berrow NS, Dolphin AC, Wallace BA (1999) Modelling of a voltage-dependent Ca2+ channel beta subunit as a basis for understanding its functional properties. FEBS Lett 445: 366-370.[CrossRef][Web of Science][Medline]

Herlitze S, Garcia DE, Mackie K, Hille B, Scheuer T, Catterall WA (1996) Modulation of Ca2+ channels by G-protein {beta}{gamma} subunits. Nature 380: 258-262.[CrossRef][Medline]

Hummer A, Delzeith O, Gomez SR, Moreno RL, Mark MD, Herlitze S (2003) Competitive and synergistic interactions of G protein {beta}2 and Ca2+ channel {beta}1b subunits with CaV2.1 channels, revealed by mammalian two-hybrid and fluorescence resonance energy transfer measurements. J Biol Chem 278: 49386-49400.[Abstract/Free Full Text]

Hurley JH, Cahill AL, Currie KP, Fox AP (2000) The role of dynamic palmitoylation in Ca2+ channel inactivation. Proc Natl Acad Sci USA 97: 9293-9298.[Abstract/Free Full Text]

Ikeda SR (1996) Voltage-dependent modulation of N-type calcium channels by G-protein {beta}{gamma} subunits. Nature 380: 255-258.[CrossRef][Medline]

Jones LP, Wei SK, Yue DT (1998) Mechanism of auxiliary subunit modulation of neuronal alpha1E calcium channels. J Gen Physiol 112: 125-143.[Abstract/Free Full Text]

Maltez JM, Nunziato DA, Kim J, Pitt GS (2005) Essential CaV{beta} modulatory properties are AID-independent. Nat Struct Mol Biol 12: 372-377.[CrossRef][Web of Science][Medline]

Meir A, Bell DC, Stephens GJ, Page KM, Dolphin AC (2000) Calcium channel {beta} subunit promotes voltage-dependent modulation of {alpha}1B by G{beta}{gamma}. Biophys J 79: 731-746.[Web of Science][Medline]

Neely A, Garcia-Olivares J, Voswinkel S, Horstkott H, Hidalgo P (2004) Folding of active calcium channel {beta}1b-subunit by size-exclusion chromatography and its role on channel function. J Biol Chem 279: 21689-21694.[Abstract/Free Full Text]

Olcese R, Qin N, Schneider T, Neely A, Wei X, Stefani E, Birnbaumer L (1994) The amino terminus of a calcium channel {beta} subunit sets rates of channel inactivation independently of the subunit's effect on activation. Neuron 13: 1433-1438.[CrossRef][Web of Science][Medline]

Opatowsky Y, Chen CC, Campbell KP, Hirsch JA (2004) Structural analysis of the voltage-dependent calcium channel {beta} subunit functional core and its complex with the {alpha}1 interaction domain. Neuron 42: 387-399.[CrossRef][Web of Science][Medline]

Pragnell M, De Waard M, Mori Y, Tanabe T, Snutch TP, Campbell KP (1994) Calcium channel {beta}-subunit binds to a conserved motif in the I-II cytoplasmic linker of the {alpha}1-subunit. Nature 368: 67-70.[CrossRef][Medline]

Qin N, Platano D, Olcese R, Costantin JL, Stefani E, Birnbaumer L (1998) Unique regulatory properties of the type 2a Ca2+ channel {beta} subunit caused by palmitoylation. Proc Natl Acad Sci USA 95: 4690-4695.[Abstract/Free Full Text]

Raghib A, Bertaso F, Davies A, Page KM, Meir A, Bogdanov Y, Dolphin AC (2001) Dominant-negative synthesis suppression of voltage-gated calcium channel CaV2.2 induced by truncated constructs. J Neurosci 21: 8495-8504.[Abstract/Free Full Text]

Restituito S, Cens T, Barrere C, Geib S, Galas S, De Waard M, Charnet P (2000) The {beta}2a subunit is a molecular groom for the Ca2+ channel inactivation gate. J Neurosci 20: 9046-9052.[Abstract/Free Full Text]

Richards MW, Butcher AJ, Dolphin AC (2004) Ca2+ channel {beta}-subunits: structural insights AID our understanding. Trends Pharmacol Sci 25: 626-632.[CrossRef][Medline]

Sandoz G, Lopez-Gonzalez I, Grunwald D, Bichet D, Altafaj X, Weiss N, Ronjat M, Dupuis A, De Waard M (2004) CaV{beta}-subunit displacement is a key step to induce the reluctant state of P/Q calcium channels by direct G protein regulation. Proc Natl Acad Sci USA 101: 6267-6272.[Abstract/Free Full Text]

Stephens GJ, Page KM, Bogdanov Y, Dolphin AC (2000) The {alpha}1B Ca2+ channel amino terminus contributes determinants for {beta} subunit-mediated voltage-dependent inactivation properties. J Physiol (Lond) 525: 377-390.[Abstract/Free Full Text]

Van Petegem F, Clark KA, Chatelain FC, Minor DL Jr (2004) Structure of a complex between a voltage-gated calcium channel {beta}-subunit and an alpha-subunit domain. Nature 429: 671-675.[CrossRef][Medline]

Wakamori M, Mikala G, Mori Y (1999) Auxiliary subunits operate as a molecular switch in determining gating behaviour of the unitary N-type Ca2+ channel current in Xenopus oocytes. J Physiol (Lond) 517: 659-672.[Abstract/Free Full Text]

Walker D, Bichet D, Geib S, Mori E, Cornet V, Snutch TP, Mori Y, De Waard M (1999) A new beta subtype-specific interaction in {alpha}1A subunit controls P/Q-type Ca2+ channel activation. J Biol Chem 274: 12383-12390.[Abstract/Free Full Text]


This article has been cited by other articles:


Home page
JGPHome page
T. Mitra-Ganguli, I. Vitko, E. Perez-Reyes, and A. R. Rittenhouse
Orientation of palmitoylated CaV{beta}2a relative to CaV2.2 is critical for slow pathway modulation of N-type Ca2+ current by tachykinin receptor activation
J. Gen. Physiol., November 16, 2009; 134(5): 385 - 396.
[Abstract] [Full Text] [PDF]


Home page
Physiol. Rev.Home page
S. Dai, D. D. Hall, and J. W. Hell
Supramolecular Assemblies and Localized Regulation of Voltage-Gated Ion Channels
Physiol Rev, April 1, 2009; 89(2): 411 - 452.
[Abstract] [Full Text] [PDF]


Home page
J. Neurosci.Home page
V. Di Biase, G. J. Obermair, Z. Szabo, C. Altier, J. Sanguesa, E. Bourinet, and B. E. Flucher
Stable Membrane Expression of Postsynaptic CaV1.2 Calcium Channel Clusters Is Independent of Interactions with AKAP79/150 and PDZ Proteins
J. Neurosci., December 17, 2008; 28(51): 13845 - 13855.
[Abstract] [Full Text] [PDF]


Home page
J. Neurosci.Home page
L. Ferron, A. Davies, K. M. Page, D. J. Cox, J. Leroy, D. Waithe, A. J. Butcher, P. Sellaturay, S. Bolsover, W. S. Pratt, et al.
The Stargazin-Related Protein {gamma}7 Interacts with the mRNA-Binding Protein Heterogeneous Nuclear Ribonucleoprotein A2 and Regulates the Stability of Specific mRNAs, Including CaV2.2
J. Neurosci., October 15, 2008; 28(42): 10604 - 10617.
[Abstract] [Full Text] [PDF]


Home page
JGPHome page
G. Gonzalez-Gutierrez, E. Miranda-Laferte, D. Naranjo, P. Hidalgo, and A. Neely
Mutations of Nonconserved Residues within the Calcium Channel {alpha}1-interaction Domain Inhibit {beta}-Subunit Potentiation
J. Gen. Physiol., September 1, 2008; 132(3): 383 - 395.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
A. Ravindran, Q. Z. Lao, J. B. Harry, P. Abrahimi, E. Kobrinsky, and N. M. Soldatov
Calmodulin-dependent gating of Cav1.2 calcium channels in the absence of Cav{beta} subunits
PNAS, June 10, 2008; 105(23): 8154 - 8159.
[Abstract] [Full Text] [PDF]


Home page
J. Cell Sci.Home page
D. J. Loane, P. A. Lima, and N. V. Marrion
Co-assembly of N-type Ca2+ and BK channels underlies functional coupling in rat brain
J. Cell Sci., March 15, 2007; 120(6): 985 - 995.
[Abstract] [Full Text] [PDF]


Home page
JGPHome page
L. Seu and G. S. Pitt
Dose-dependent and Isoform-specific Modulation of Ca2+ Channels by RGK GTPases
J. Gen. Physiol., November 1, 2006; 128(5): 605 - 613.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Heart Circ. Physiol.Home page
S. M. Crump, R. N. Correll, E. A. Schroder, W. C. Lester, B. S. Finlin, D. A. Andres, and J. Satin
L-type calcium channel {alpha}-subunit and protein kinase inhibitors modulate Rem-mediated regulation of current
Am J Physiol Heart Circ Physiol, October 1, 2006; 291(4): H1959 - H1971.
[Abstract] [Full Text] [PDF]


Home page
J. Physiol.Home page
A. J. Butcher, J. Leroy, M. W. Richards, W. S. Pratt, and A. C. Dolphin
The importance of occupancy rather than affinity of CaV{beta} subunits for the calcium channel I-II linker in relation to calcium channel function
J. Physiol., July 15, 2006; 574(2): 387 - 398.
[Abstract] [Full Text] [PDF]


Home page
JGPHome page
N. Kanevsky and N. Dascal
Regulation of Maximal Open Probability Is a Separable Function of Cav{beta} Subunit in L-type Ca2+ Channel, Dependent on NH2 Terminus of {alpha}1C (Cav1.2{alpha})
J. Gen. Physiol., June 26, 2006; 128(1): 15 - 36.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow A correction has been published
Right arrow Submit an eLetter
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Web of Science (25)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Leroy, J.
Right arrow Articles by Dolphin, A. C.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Leroy, J.
Right arrow Articles by Dolphin, A. C.

-
-

Home  |   Search  |   Archive  |   Subscribe  |   Contact  |   Help

-
Copyright 2009 by Society for Neuroscience ONLINE ISSN: 1529-2401
-