WWW.JNEUROSCI.ORG
-
The Journal of Neuroscience ScienceCareers.org
 QUICK SEARCH:   [advanced]


     
-


HOME
  |  
SEARCH  |   ARCHIVE  |   SUBSCRIBE  |   CONTACT  |   HELP

The Journal of Neuroscience, October 4, 2006, ():

This Article
Right arrow Abstract
Right arrow Full Text
Right arrow Submit an eLetter
Services
Right arrow Email this article to a friend
Right arrow Alert me to new issues of the journal
Right arrow reprints & permissions

Bidirectional Trafficking of Prostaglandin E2 Receptors Involved in Long-Term Potentiation in Visual Cortex
J. Neurosci. Akaneya and Tsumoto 26: 10209

Supplemental data

Files in this Data Supplement:

  • supplemental material - Supplemental Figure 1. (A) Expression levels of COX-1, COX-2, and EP1-4 following the application of scramble siRNAs of COX1, COX-2, and EP1-4, respectively. n = 7-8. (B) Levels of mRNA measured by real-time PCR after 6-7 days. n = 7-9. The siRNAs of iREP-4 (not scramble siRNAs) were applied as in Figure 2D. In (A) the following siRNAs were used as negative control: iRCOX-1a/sc (antisense) AAGCGAACCTCTCATATGTTCCCTGTCTC iRCOX-1a/sc (sense) AAGAACATATGAGAGGTTCGCCCTGTCTC iRCOX-2a/sc (antisense) AACCGTAGGTAGCATATCCCTCCTGTCTC iRCOX-2a/sc (sense) AAAGGGATATGCTACCTACGGCCTGTCTC iREP1a/sc (antisense) AACGCCTGCTACAGGCACCAGCCTGTCTC iREP1a/sc (sense)AACTGGTGCCTGTAGCAGGCGCCTGTCTC iREP2a/sc (antisense) AATCAGGTGCACGCTCTCCGCCCTGTCTC iREP2a/sc (sense) AAGCGGAGAGCGTGCACCTGACCTGTCTC iREP3a/sc (antisense) AACTGCTGGTGCTTGCCATCGCCTGTCTC iREP3a/sc (sense) AACGATGGCAAGCACCAGCAGCCTGTCTC iREP4a/sc (antisense) AACGAAAGAAGGCGCGAGGCTCCTGTCTC iREP4a/sc (sense) AAAGCCTCGCGCCTTCTTTCGCCTGTCTC The eight nucleotides underlined indicate the region complementary to the T7 promoter primer. The procedures were the same as those in Figs. 3B and D.
  • supplemental material - Supplemental Figure 2 Immunocytochemical images of cultured cortical neurons. Dissociated neurons cultured from rat visual cortex for 10 DIV, followed by immunocytochemical staining with anti-MAP2 (second from the top) and anti-EEA1 (third) antibodies. The top panel indicates a differential interference contrast image (DIC) in which arrows indicate the axon. The second and third images were reconstructed in the z-axis direction. The bottom, superposed image of the second and third images. The bar indicates 10 μm and applies to the other images.
  • supplemental material - Supplemental Figure 3 Hypothesized scheme for mechanisms of PGE2-mediated LTP in visual cortex. Glutamate released from presynaptic sites by TBS activates NMDAR at postsynaptic sites, followed by a Ca2+ influx. This activates Ca2+-dependent cPLA2, which then produces AA from the membrane lipid substrate, in addition to activation of CaMKII. AA is metabolized to PGH2 by COX-2 that has been activated by TBS concomitantly. PGH2 is converted immediately to PGE2 by PGE2 synthase. EP2 translocates from the early endosome in cytosol to the membrane simultaneously with the translocation of EP3 from the membrane to the endosome in cytosol. Activated CaMKII may play a role in the translocation of EP2. The PGE2 generated spreads from postsynaptic sites into the synaptic cleft, where it then activates EP2 at the posysynaptic membrane, resulting in the production of cAMP. Subsequently, cAMP activates PKA, followed by the phosphorylation of AMPAR (at S845 on GluR1) at the membrane and CREB in the nucleus of postsynaptic cells in the visual cortex. This activation of CREB may induce the synthesis of protein such as BDNF, which is involved in the long-lasting phase of LTP.




This Article
Right arrow Abstract
Right arrow Full Text
Right arrow Submit an eLetter
Services
Right arrow Email this article to a friend
Right arrow Alert me to new issues of the journal
Right arrow reprints & permissions

-

Home  |   Search  |   Archive  |   Subscribe  |   Contact  |   Help

-
Copyright 2008 by Society for Neuroscience ONLINE ISSN: 1529-2401
-