 |
The Journal of Neuroscience, November 22, 2006, 26(47):12294-12307; doi:10.1523/JNEUROSCI.3855-06.2006
Previous Article | Next Article 
Behavioral/Systems/Cognitive
Vesicular Glutamate Transporter 2 Is Required for Central Respiratory Rhythm Generation But Not for Locomotor Central Pattern Generation
Åsa Wallén-Mackenzie,1
Henrik Gezelius,1 *
Muriel Thoby-Brisson,2 *
Anna Nygård,1
Anders Enjin,1
Fumino Fujiyama,3
Gilles Fortin,2 and
Klas Kullander1
1Department of Neuroscience, Unit of Developmental Genetics, Uppsala University, 751 23 Uppsala, Sweden, 2Laboratoire de Neurobiologie Génétique et Intégrative, Institut Alfred Fessard, Centre National de la Recherche Scientifique, 91198 Gif sur Yvette, France, and 3Department of Morphological Brain Science, Graduate School of Medicine, Kyoto University, Kyoto 606-8501, Japan
 |
Abstract
|
|---|
Glutamatergic excitatory neurotransmission is dependent on glutamate release from presynaptic vesicles loaded by three members of the solute carrier family, Slc17a68, which function as vesicular glutamate transporters (VGLUTs). Here, we show that VGLUT2 (Slc17a6) is required for life ex utero. Vglut2 null mutant mice die immediately after birth because of the absence of respiratory behavior. Investigations at embryonic stages revealed that neural circuits in the location of the pre-Bötzinger (PBC) inspiratory rhythm generator failed to become active. However, neurons with bursting pacemaker properties and anatomical integrity of the PBC area were preserved. Vesicles at asymmetric synapses were fewer and malformed in the Vglut2 null mutant hindbrain, probably causing the complete disruption of AMPA/kainate receptor-mediated synaptic activity in mutant PBC cells. The functional deficit results from an inability of PBC neurons to achieve synchronous activation. In contrast to respiratory rhythm generation, the locomotor central pattern generator of Vglut2 null mutant mice displayed normal rhythmic and coordinated activity, suggesting differences in their operating principles. Hence, the present study identifies VGLUT2-mediated signaling as an obligatory component of the developing respiratory rhythm generator.
Key words: central pattern generator; rhythm; glutamate; respiration; network; physiology; development; transmitter
 |
Introduction
|
|---|
Central pattern generators (CPGs) are defined as neuronal circuits capable of producing a rhythmic and coordinated output without the influence of sensory input. The respiratory and locomotor neuronal circuits are two of the better characterized CPGs, although much work remains to fully understand how these networks operate. Glutamatergic neurons are involved in most neuronal circuits of the nervous system and considerable efforts have been made to study the role of glutamate receptors in nervous system signaling using a variety of approaches. It has been difficult to pinpoint the role of glutamatergic neurons in neuronal circuits because of the complexity of glutamate-mediated signaling and the variety of receptors triggered by glutamate. In addition, glutamate is an amino acid used by every cell, which has hampered identification of glutamatergic neurons. The discovery of the vesicular glutamate transporter (VGLUT) proteins, which transport glutamate into presynaptic vesicles (Bellocchio et al., 2000 ; Takamori et al., 2000 , 2001 ; Fremeau et al., 2001 ; Herzog et al., 2001 ), has enabled a novel approach to identify and interfere with presynaptic release of glutamate. Recently, mice with a targeted deletion of the Vglut1 gene were unexpectedly demonstrated to be viable, although they displayed progressive neurodegeneration and died prematurely (Fremeau et al., 2004 ; Schuske and Jorgensen, 2004 ; Wojcik et al., 2004 ).
The pre-Bötzinger complex (PBC) is an inspiratory oscillator network within the respiratory CPG primarily pacing the respiratory rhythm (Smith et al., 1991 ; Koshiya and Smith, 1999 ; Feldman and Del Negro, 2006 ). It is located in the rostroventrolateral medulla and relies on excitatory glutamatergic connections (Funk et al., 1993 ; Rekling and Feldman, 1998 ). PBC interneurons discharge through activation of NMDA and non-NMDA glutamate receptors (Funk et al., 1993 , 1997 ) and are immunopositive for glutamate receptor subunits (Robinson and Ellenberger, 1997 ; Paarmann et al., 2005 ). Neurokinin-1-receptor (NK1R)-expressing PBC neurons, essential for maintenance of normal breathing in vivo (Gray et al., 2001; McKay et al., 2005 ), have been shown to contain Vglut2 mRNA and to receive VGLUT2-positive terminals (Gray et al., 1999 ; Guyenet et al., 2002 ; Stornetta et al., 2003a ,b ) but also have GABAergic and glycinergic terminals (Liu et al., 2002 ). The locomotor CPG is located in the ventral part of the lumbar spinal cord (Kjaerulff and Kiehn, 1996 ) and controls rhythmically alternating activity between the left and right sides and flexorextensor muscles. In vivo, locomotor activity is likely initiated by glutamatergic descending pathways from the brain (Mori et al., 2001 ). In the in vitro spinal cord preparation, fictive locomotion can be induced by bath application of neurotransmitters or their agonists, like dopamine, 5-HT, and NMDA (Jiang et al., 1999 ; Cazalets et al., 2000 ; Nishimaru et al., 2000 ). Data mainly derived from studies in lamprey and mouse have suggested that the locomotor CPG in both developing and adult vertebrates is built on inhibitory components and excitatory glutamatergic components (Buchanan and Grillner, 1987 ; Grillner, 1997 , 2003 ; Kiehn, 2006 ).
Here, we have genetically eliminated presynaptic release of glutamate mediated by VGLUT2 in the mouse and present evidence that VGLUT2 is necessary for life ex utero. We further demonstrate that respiratory-related rhythm generation in the PBC fails to initiate during embryonic development leading to absence of respiration. Targeted deletion of Vglut2 has no notable consequence on the anatomy of the brainstem but affects the number and morphology of excitatory synaptic vesicles in the brainstem. As a probable consequence, we have observed a complete loss of AMPA/kainate-mediated excitatory synaptic processing in neurons of the PBC area of Vglut2f/f;PCre mutants. This results in an absence of population synchronized activity. In contrast, activity of the spinal locomotor CPG is spared by the mutation, suggesting that VGLUT2 is specifically required in the respiratory CPG. This Vglut2f/f;PCre mutant mouse represents the first genetic model showing complete uncompensated functional impairment of the respiratory CPG.
 |
Materials and Methods
|
|---|
Generation of Vglut2 null animals.
The Vglut2 targeting construct was built by conventional and Red-ET recombination cloning (Zhang et al., 2000 ). In the construct, exons 4, 5, and 6 were flanked by an upstream loxP site and downstream by an FRT-flanked neo cassette followed by a second loxP site. A dual prokaryotic/eukaryotic promoter enabling kanamycin resistance selection in bacteria and neomycin resistance in embryonic stem (ES) cells preceded the neo cassette. ES cells (Sv129/R1) were electroporated with the targeting construct and the modified allele was detected by standard PCR using oligos that recognized the 5'-loxP site, the neo cassette, and the 3'-loxP site. Positive clones were also confirmed by Southern blot analysis of the 3' end using a probe directed against the neo cassette after digestion with BstEII. Two ES clones were selected for blastocyst (C57BL/6) injection, which produced a large number of chimeric mice. These were bred with C57BL/6 mice to generate heterozygous mice carrying one floxed allele (Vglut2f/+), which were then intercrossed to produce homozygous mice (Vglut2f/f). Vglut2f/f mice were crossed to PGK-Cre mice (Lallemand et al., 1998 ) to generate null mutant mice (Vglut2f/f;PCre). The neo cassette was removed by crossing Vglut2f/+ mice to Deleter-FlpE mice (Rodriguez et al., 2000 ). As controls, littermates with at least one wild-type (wt) allele were used. All experiments involving live animals were performed in accordance with ethical guidelines defined by the French Agricultural Ministry and the European Union Council Directive for the Care and Use of Laboratory Animals (number 2889) and have been approved by the appropriate local Swedish ethical committee (C156/4).
Genotyping by PCR.
For genotyping of mice, 12 mm of tail was incubated in 75 µl of buffer consisting of 25 mM NaOH and 200 µM EDTA at 96°C for 45 min and placed on ice for a few minutes. Tris-HCl (40 mM), pH 8.0, was then added to a final volume of 150 µl, after which the preparations were subjected to PCR analysis. Oligos a and b (see Fig. 1A) detects a 150 bp fragment in the wt allele and a 184 bp band in the floxed allele. Oligos a and c (see Fig. 1A) detects a 327 bp fragment in the null allele and no band in the wt and floxed allele, respectively. A separate Cre-specific PCR was run to verify the presence of the PGK-Cre allele. In addition, Neo and Deleter-FlpE specific PCRs were used to genotype Neo-excised mice.
Preparation of tissue and histology.
Animals were mated overnight, and females were checked for vaginal plug the next morning. In the morning of plug, embryos were staged as embryonic day 0.5 (E0.5). Embryos were collected at E12.5, E15.5, E16.5, and E18.5. In the morning of E19, pups were born. Newborn pups are denoted as postnatal day 0 (P0). For dissection of embryos, pregnant females were killed by cervical dislocation and embryos were removed. E12.5 embryos were kept intact, whereas older embryos and newborn pups were decapitated and the skin was removed. Tails were collected for genotyping. The animals were fixed in zinc-formalin (Richard-Allan Scientific, Kalamazoo, MI) for 1824 h at room temperature before dehydration and paraffin infusion (Tissue Tek vacuum infiltration processor; Miles Scientific, Elkhart, IN). Sections (7 µm thick) were cut on Microm microtome, attached on Superfrost slides (Menzel-Gläser, Braunschweig, Germany) and stored at 4°C until usage. Slides were deparaffinized in X-tra solve (Medite Histotechnic, Burgdorf, Germany) and rehydrated in ethanol/water before subsequent treatments. For hematoxylin (Richard-Allan Scientific) and eosin (Sigma, St. Louis, MO) histological staining, slides were incubated in hematoxylin 2030 s, rinsed in water, 0.1% ammonium hydroxide, and water again before incubation in eosin 2030 s followed by water. Slides were then dehydrated in ethanol/water, infused in X-tra solve, and mounted.
In situ hybridization histochemistry.
For paraffin in situ hybridization histochemistry, rehydrated paraffin sections were fixed for 10 min in 4% formaldehyde, washed in PBS, and treated with proteinase K (Sigma; 27 µg/ml diluted in 10 mM Tris-HCl/1 mM EDTA, pH 8.0) for 5 min. After refixation and washes in PBS, the slides were acetylated for 10 min in a mixture of 1.3% triethanolamine (Sigma), 0.2% acetic anhydride (Fluka, Neu-Ulm, Germany), and 0.06% HCl diluted in water. Slides were then incubated for 30 min in PBS containing 1% Triton X-100 (Sigma). After subsequent washes in PBS, slides were prehybridized for 25 h in hybridization solution without probe [50% formamide (Fluka), 5x SSC, 5x Denhardt's, 250 µg/ml yeast transfer RNA (Sigma), 500 µg/ml sheared salmon sperm DNA (Ambion, Austin, TX) diluted in water]. Probes were diluted to 0.11 µg/ml in hybridization solution and heated to 80°C. Sections were then hybridized with 100 µl of hybridization solution for 16 h at 70°C. The next day, slides were dipped in prewarmed 5x SSC, transferred to 0.2x SSC, and incubated for 2 h at 70°C. After one wash in 0.2x SSC at room temperature and one wash in B1 solution (0.1 M Tris-HCl, pH 7.5, and 0.15 M NaCl), sections were immunoblocked with 10% fetal calf serum in B1, and then incubated overnight at +4°C with alkaline phosphatase-conjugated anti-digoxigenin Fab fragments (Roche, Mannheim, Germany) diluted 1:5000 in B1 containing 1% fetal calf serum. The following day, slides were washed in B1, equilibrated in B3 (0.1 M Tris-HCl, pH 9.5, 0.1 M NaCl, 50 mM MgCl2), and color developed in a 10% polyvinyl alcohol (Sigma) solution also containing 100 mM Tris-HCl, pH 9.5, 100 mM NaCl, 5 mM MgCl2, 0.17% nitroblue tetrazolium (Roche), 0.17% 5-bromo-4-chloro-3-indolyl phosphate (Roche), and 1 mM levamisole (Sigma). Staining was sufficient after 624 h, whereupon slides were washed in water and mounted.
Probes.
The Vglut2 probe covers nucleotides 16162203, vesicular acetylcholine transporter (VAChT) 15342413, tyrosine hydroxylase (TH) 13001754. The VGlut1 and Phox2b probes have been described previously (Kullander et al., 2003 ; Pattyn et al., 2000b ).
Immunofluorescence.
For immunofluorescence histochemistry, rehydrated paraffin sections were boiled for 10 min in 0.1 M citric acid (VWR International, Leicestershire, UK), pH 6.0, left to cool for 2030 min, washed in PBS, and incubated with primary antibodies (guinea pig VGLUT2) diluted to 1 µg/ml [described by Fujiyama et al. (2001) and Hioki et al. (2003) ]; mouse TH (Chemicon, Temecula, CA), 1:200; rabbit NK1R (Sigma), 1:5000; guinea pig islet1,2 (gift from J. Ericson, Karolinska Institute, Stockholm, Sweden), 1/1000; and Phox2b, 1:500 (Pattyn et al., 2000b ) in PBS with 0.3% Triton X-100 at room temperature overnight. The following day, slides were washed in PBS and incubated with Alexa fluorescent secondary antibodies (Invitrogen, San Diego, CA) diluted 1:200 in PBS with 0.3% Triton X-100 and 10% goat serum for >2 h at room temperature. Slides were then washed in PBS, incubated with 1 µg/ml 4',6'-diamidino-2-phenylindole (DAPI) (Sigma), washed again, and mounted.
Imaging.
Fluorescent and bright-field stainings were analyzed using an Olympus (Tokyo, Japan) microscope with an Optigrid system (Thales, Fairport, NY) and Volocity software (Improvision, Lexington, MA); fluorescent stainings were also analyzed by confocal microscopy using Zeiss (Oberkochen, Germany) LSM 510 META system and bright-field stainings on a MZ16F dissection microscope with DFC300FX camera and FireCam software (Leica, Nussloch, Germany). Captured images were auto-leveled using Adobe Photoshop software.
Electron microscopy.
For electron microscopy (EM), E18.5 embryos were dissected and brains were rapidly placed in 2.5% glutaraldehyde (Sigma). After 1 h of fixation, brains were cut in 1-mm-thick coronal sections using a brain matrix, and from these slices, round pieces of 1 mm in diameter were punched out from the following regions: olfactory bulb, cortex/hippocampus border, thalamus, striatum, medulla, and pons. The punches (from two control brains and two null mutant brains) were mounted in Epon plastic, sectioned at 1 µm, and stained in toluidine blue, after which the punches were appropriately cut in one-third to allow ultrathin sectioning into 50 nm slices (three slices per region) for EM analysis. The slices were contrast stained with 5% uranyl acetate and lead citrate for analysis on a Hitachi H-700 EM (Hitachi Scientific Instruments, Nissei Sangyo, Tokyo, Japan). Synaptic structures were analyzed morphologically in all brain areas. Synapses with both presynaptic and postsynaptic membrane thickening were defined as symmetric, whereas those with only a postsynaptic thickening were defined as asymmetric. In the control brains, symmetric vesicles were either round or displayed a flattened appearance, whereas asymmetric vesicles were always round. In the null mutant, symmetric vesicles looked as in the control, whereas the asymmetric vesicles frequently displayed an irregular shape (see Results). The medulla was selected for synaptic vesicle quantification. Three consecutive medullary slices were analyzed per animal, and values given are averages per genotype ± SEM. The number of vesicles per synapse was subdivided into groups of 1, 28, 918, 1925, and >25 vesicles per synapse. Photographs were taken at 40,000x magnification.
In vivo measurement of the ventilation.
Pregnant mice were killed by cervical dislocation at E18.5, and fetuses surgically delivered from uterine horns were transferred into a ventilation recording chamber. Ventilation was monitored using a barometric method (Bartlett and Tenney, 1970 ). The plethysmograph chamber (15 ml) equipped with a temperature sensor, was connected through a slow leak to a reference chamber of the same volume. The pressure difference between the two chambers was measured with a differential pressure transducer (DP-103-10; Validyne, Northridge, CA) connected to sine wave demodulator (CD15; Validyne). The spirogram was stored on a personal computer (PC) (Chatonnet et al., 2002 ). Calibrations were made during each recording session by injecting 5 µl of air into the experimental chamber with a Hamilton syringe. Mean values for the ventilatory frequency were calculated from averaging 100 breaths.
Brainstem electrophysiology.
Pregnant mice were killed by cervical dislocation on E16.5 to E18.5. Isolated whole hindbrain preparations and transverse slices containing the PBC were prepared according to previously published protocols (Thoby-Brisson et al., 2005 ). Embryos were excised from the uterus and kept in oxygenated artificial CSF (aCSF) at room temperature until the electrophysiological recording session. aCSF composition was as follows (in mM): 128 NaCl, 8 KCl, 1.5 CaCl2, 1 MgSO4, 24 NaHCO3, 0.5 Na2HPO4, 30 glucose, pH 7.4. One transverse 450-µm-thick slice was prepared from each embryo using a vibratome, and then transferred to a recording chamber continuously superfused with oxygenated aCSF, at 30°C. Hypoglossal nerve root activity in whole hindbrain preparations and local population activity in slices were recorded using glass micropipettes suction electrodes (150 µm tip diameter). The micropipettes filled with aCSF were connected through silver wires to a high-gain AC amplifier (7P511; Grass, West Warwick, RI), filtered (bandwidth, 3 Hz to 3 kHz), integrated using an electronic filter (Neurolog System; time constant, 100 ms), recorded on a computer via a digitizing interface (Digidata 1322A; Molecular Devices, Foster City, CA), and analyzed with the pClamp9 software (Molecular Devices). Whole-cell patch-clamp neuronal recordings were performed under visual control using differential interference contrast and infrared video microscopy, an Axoclamp2A amplifier (Molecular Devices), a digitizing interface (Digidata 1322A; Molecular Devices), and the software program pClamp9 (Molecular Devices). Patch electrodes (resistance, 46 M ) were pulled from borosilicate glass tubes (GC 150TF; Clark, Pangbourn, UK) and filled with a high chloride internal solution containing the following (in mM): 123 K-gluconic acid, 21 KCl, 0.5 EGTA, 3 MgCl2, 10 HEPES, pH 7.2. Ongoing synaptic currents were recorded at a holding potential of 70 mV. The inward direction of synaptic currents mediated by GABAA and glycine receptors was imposed by our recording conditions to mimic the immature transmembrane chloride gradient enforcing, at the embryonic time of recording, a depolarizing action of GABA (Thoby-Brisson et al., 2005 ). Drugs were obtained from Sigma, dissolved in aCSF, and bath applied for 1015 min at the following final concentrations (in µM): 0.1 for substance P (SP), 0.3 for D-Ala2,MePhe4,Gly-ol5-enkephalin (DAMGO), 10 for 6-cyano-7-nitroquinoxaline-2,3-dione (CNQX), 10 for bicuculline, 5 for strychnine, and 1000 for NMDA. A pressure pulse (50 ms; 0.5 bar) was applied to a patch pipette filled with AMPA (1 mM) diluted in aCSF, positioned right below the surface of the slice over the PBC area to test the presence of orthodromically evoked excitatory responses in the contralateral PBC area. A concentric bipolar stimulation electrode (Phymep, Paris, France) was positioned at the surface of the slice on the PBC area and at a ventral level on the midline to stimulate commissural fibers connecting the PBCs bilaterally. Values are given as means ± SEM.
Calcium imaging.
Whole hindbrain and slices were incubated for 45 min in oxygenated aCSF containing the cell-permeable calcium indicator dye Calcium Green-1AM (10 µM; Invitrogen). Whole hindbrain preparations were positioned in the recording chamber with the ventral side up to allow optical accessibility of the facial motor nuclei. After a 30 min recovery period in the recording chamber to wash out the dye, a standard epifluorescent illumination system on an E-600-FN upright microscope (Nikon, Tokyo, Japan) equipped with a fluorescein filter block was used to excite the dye and capture the emitted light. Fluorescence images were captured with a cooled CCD camera (Coolsnap HQ; Photometrics, Tucson, AZ) using an exposure time of 100 ms in overlapping mode (simultaneous exposure and readout) during periods of 30120 s and analyzed using MetaMorph software (Universal Imaging, West Chester, PA). The average intensity in a region of interest was calculated for each frame, and changes in fluorescence were normalized to their initial value by expression as the ratio of changes in fluorescence to initial fluorescence ( F/F).
Spinal cord electrophysiology.
The functional output of the locomotor CPG was studied using extracellular electrophysiology on an in vitro preparation of the spinal cord (for review, see Whelan, 2003 ). The embryos were decapitated just before dissection and mounted ventral side up in a dissection chamber. After filling the chamber with ice-cold oxygenated (95% O2 plus 5% CO2) dissection buffer (in mM: 128 NaCl, 4.69 KCl, 25 NaHCO3, 1.18 KH2PO4, 3.5 MgSO4, 0.25 CaCl2, 22 D-glucose), the animals were eviscerated and the spinal cord was exposed by ventral laminectomy. The spinal cord was dissected out to preserve the integrity of the ventral roots, pinned down in a perfusion chamber, and perfused with oxygenated aCSF (in mM: 128 NaCl, 4.69 KCl, 25 NaHCO3, 1.18 KH2PO4, 1.25 MgSO4, 2.5 CaCl2, 22 D-glucose) at room temperature. Embryos without reflex response were dissected first. The spinal cords of the litter mates were then dissected and put in a chamber filled with aCSF, continuously oxygenated, until recordings were started. Suction electrodes were attached to left and right lumbar (L)2 and L5 ventral roots and the spinal cord was equilibrated at least 30 min before application of neurotransmitter chemicals. A combination of NMDA (010 µM), serotonin (5-HT) (315 µM), and dopamine (050 µM) were added to the perfusing aCSF to induce stable locomotor-like output. All chemicals were obtained from Sigma. The signals were amplified 10,000 times and bandpass filtered 10 Hz to 5 kHz (model 1700; A-M Systems, Carlsborg, WA). The signals were A/D converted (Digidata 1322A; Molecular Devices) before being recorded on a PC (Axoscope 9.0.2.05
[EC]
) for later off-line analysis. Data analysis of the recorded signals was performed as described previously (Kjaerulff and Kiehn, 1996 ); the onset of each burst was determined directly from recordings without rectifying the signals. The intrasegmental left/right alternations were analyzed in either L2 or L5 roots, and the intersegmental L2/L5 alternations were analyzed on either the right or left side in each animal. Only traces showing a stable rhythmic activity were analyzed for coordination coupling. Vector points were derived from 15 random locomotor cycles. Each point represents the endpoint of a vector, the direction given by the mean phase value, and the length given by the focus of phase values around the mean. A phase value of 0.5 reflects alternating activity, and 0.0 reflects synchronous activity.
 |
Results
|
|---|
Vglut2f/f;PCre mutants die at birth
We generated a Vglut2 deficient allele by replacing part of the Vglut2 gene with a targeting construct by homologous recombination in ES cells (Fig. 1A). Successful targeting produced a modified allele with a loxP site preceding exons 4, 5, and 6, and a neomycine selection cassette flanked by Frt sites, followed by a second loxP site. We confirmed the correct targeting event in the ES cells and in the animals by Southern blotting (data not shown) and a PCR strategy (Fig. 1B). Vglut2f/f mice carrying the entire construct were viable, fertile, and subsequently bred to PGK-Cre mice (Lallemand et al., 1998 ) to delete the targeted region including the neo cassette. The region flanked by the loxP sites contains three exons coding for a substantial part of the protein including three and a half transmembrane domains and two large extracellular loops (Fig. 1C). A transcript containing the 3' end of the mRNA was detectable by in situ hybridization, albeit at very low levels compared with control tissue (Fig. 1D,E). We failed to detect VGLUT2 protein by immunohistochemistry (Fig. 1C,F), whereas we found normal levels of the closely related VGLUT1 protein in the brain (Fig. 1H,I). This suggests that removal of the targeted region severely affects transcription efficiency and that there is no detectable VGLUT2 protein product in null mutant mice.

View larger version (38K):
[in this window]
[in a new window]
|
Figure 1. Gene targeting of the Vglut2 locus results in specific loss of VGLUT2 protein expression. A, The gene targeting strategy shows exons 4, 5, 6 in the Vglut2 locus flanked by a 5' loxP (P) site and a 3' Frt (F)-flanked Neo (N) cassette followed by a second loxP site in the targeting construct and the resulting recombined allele (f). A 6.3 kb 5' arm and a 1.3 kb 3' arm were used for homologous recombination sequence. The locations of PCR-oligos used for genotyping are labeled with a, b, and c; a, CTGTCCACCTTTGTATCCCA; b, GCAATCACATTTCACTGTTC; c, CACACCCACTCCACTTGAGG. General Cre-mediated recombination using PGK-Cre mice (PCre) (Lallemand et al., 1998 ) results in a null allele designated Vglut2f;PCre (f c). Deleter-FlpE (Del-FlpE)-mediated recombination removes the Neo cassette, and region-specific (sp) Cre-mediated deletion results in a region-specific null allele. B, PCR primer combination a+b (top) results in a 150 bp band corresponding to the wt allele (+), a 184 bp band to the f allele, and no band to the f c allele, whereas a+c (bottom) results in a 327 bp band in the f c allele and no band in the f and + alleles. The f/f c genotype thus results in 184 and 327 bp bands, the f c/f c genotype in a 327 bp band, and the f/+ genotype in 150 and 184 bp bands. C, Schematic drawing of the VGLUT2 protein structure including 12 transmembrane domains and interconnecting loops of which transmembrane domains 3, 4, 5, and part of 6, and loops 3, 4, and 5 (thick line) are deleted after Cre-mediated recombination. DI, In situ hybridization and immunofluorescence (IF) expression analysis in control and Vglut2f/f;PCre brains shows strong Vglut2 mRNA (D) and protein (F) in control thalamus and a weak mRNA expression but complete absence of protein, in the same region in the Vglut2f/f;PCre brain. VGLUT1 protein expression was normal in the hippocampus of control and Vglut2f/f;PCre embryos (H, I). Scale bars: E, 1.3 mm; G, 160 µm; I, 65 µm.
|
|
None of the mice homozygous for the null allele (Vglut2f/f;PCre) survived at birth (n = 20). Litters from embryonic stages E12.5 to E18.5 all showed a normal Mendelian ratio of genotypes, indicating that lethality occurred at birth. Observation of delivering females revealed that Vglut2f/f;PCre pups were born completely immobile with a beating heart that rapidly ceased as they became cyanotic (Fig. 2C). Of 20 null mutant pups dissected out at E18.5, none had a functional toe-pinch reflex, whereas 44 of 49 tested heterozygote or wt siblings responded with limb movements. Vglut2 mRNA is expressed in developing dorsal root ganglia (Fig. 2D,E) containing cell bodies of sensory neurons, and dysfunction of these sensory neurons provides one explanation for the absence of a reflex response. Furthermore, Vglut2f/f;PCre embryos were hunched, significantly smaller (Fig. 2A,B), and weighed 1.20 ± 0.03 g, which was 8% less than littermate controls (control, n = 49; Vglut2f/f;PCre mutants, n = 20; p = 0.0269). Because of the early expression of Vglut2 both in the nervous system (Fig. 2DG), and in peripheral organs (Fig. 2J,K), we speculated that the early dysfunction of glutamate signaling mediated by VGLUT2 could potentially lead to developmental defects. We therefore analyzed whether such defects were present in E18.5 embryos and P0 pups.

View larger version (76K):
[in this window]
[in a new window]
|
Figure 2. Vglut2 is expressed early in the embryo and is essential for normal development. AC, Vglut2f/f;PCre embryos (*) appear arrested in development and can be distinguished from control littermates already at E16.5 by their hunched posture (A). At E18.5 (B), their smaller size (weights: control, 1.31 ± 0.03 g, n = 49; Vglut2f/f;PCre, 1.20 ± 0.03 g, n = 20; p = 0.0269) is easily distinguished at P0. C, The pups display cyanosis and die directly after birth. D, E, Vglut2 in situ hybridization of E12.5 embryos reveals strong mRNA expression in distinct brain regions (D), such as the ventral and dorsal diencephalon and ventral mesencephalon (arrows), brainstem, spinal cord, and dorsal root ganglia (close-up in E, marked with arrows) and also along the telencephalic and fourth ventricles and the aqueduct. F, G, Vglut2 continues to be strongly expressed in the brainstem (F) and the thalamus during late development (G). H, I, Hematoxylin/eosin staining of control (H) and Vglut2f/f;PCre embryos (I) coronal sections at E18.5 shows grossly normal brain histology of the null mutant compared with control, except a few animals (n = 4/9, E18.5 and P0) that displayed enlarged appearance of ventricles (e.g., third ventricle) (inset in I). J, K, VGLUT2-positive nerve terminals (red) are readily detected by immunofluorescence (nuclear costaining with DAPI in blue) in control internal organs at E18.5, as shown here in transverse sections of the muscular wall of the esophagus (J), whereas these nerve terminals are undetectable in the null mutants (K). LO, Hematoxylin/eosin staining of transverse sections of control and Vglut2f/f;PCre P0 bodies shows grossly normal histology of the mutant compared with control except in the lungs, where the control display normal alveolar appearance (close-up in M), whereas an immature, noninflated structure is manifest in the mutant (close-up in O). Scale bars: D, 1 mm; E, 0.25 mm; F, 730 µm; G, 0.3 mm; H, 1.7 mm; I, inset, 0.5 mm; J, 45 µm; L, 2 mm; M, 40 µm.
|
|
Comparing Vglut2f/f;PCre E18.5 embryos with littermate controls, the gross morphology of the brain appeared normal (Fig. 2H,I). However, in four of nine E18.5 and P0 Vglut2f/f;PCre mice, the third ventricle appeared enlarged and reminded us more of an embryo at stage E16.5 (Fig. 2I, inset). We then analyzed embryos at E12.5 (control, n = 2; Vglut2f/f;PCre, n = 2), E15.5 (control, n = 2; Vglut2f/f;PCre, n = 3), and E16.5 (control, n = 1; Vglut2f/f;PCre, n = 1), but we did not detect any defects with regard to brain morphology or proliferation (data not shown). In contrast, in Vglut2f/f;PCre neonates, lung alveoli were considerably reduced in size, indicating that the lungs had never been inflated (Fig. 2LO).
Complete absence of rhythmic activity in the PBC of Vglut2f/f;PCre mutants
The cyanosis, noninflated lung morphology, and immediate postnatal death prompted a functional investigation of ventilation and respiratory generating circuits in the brainstem of the embryo. In vivo measurement of the ventilation of wt (n = 3), heterozygous (n = 6), and Vglut2f/f;PCre homozygous mutants (n = 4) were performed on fetuses surgically delivered at E18.5 (from two mice). Wild-type and heterozygous siblings (nine of nine) immediately initiated breathing and showed a stable breathing behavior 10 min after delivery at a frequency of 139 ± 12 breath · min1 (Fig. 3A). In contrast, Vglut2f/f;PCre mutant littermates failed to show any respiratory behavior in a 35 min postdelivery period when they were placed in a plethysmographic chamber (Fig. 3B).

View larger version (69K):
[in this window]
[in a new window]
|
Figure 3. Vglut2f/f;PCre mutants do not breathe and fail to generate a central respiratory-like rhythm. A, B, Plethysmographic recordings of spontaneous ventilation in E18.5 fetuses 1 min after surgical delivery. All control fetuses (A) showed robust respiratory cycles with alternating inspiratory (upward deflections) and expiratory (downward deflections) phases, whereas all Vglut2f/f;PCre mutants (B) did not show any sign of ventilation. C, D, Photomicrographs of a whole E16.5 wt hindbrain preparation (ventral side up, rostral at top) used to visualize fluorescence changes (D) occurring spontaneously and synchronously in the left (l) and right (r) facial motor nuclei (white outlines 7m,l and 7m,r in C). E, Corresponding fluorescence changes ( F/F) after loading whole hindbrain isolated preparation with Calcium Green-1AM are shown superposed to the hypoglossal nerve (12n) integrated neurogram (bottom trace). Note rhythmic fluorescence changes of facial motoneurons phased to the hypoglossal nerve root electrical activity. F, Photomicrograph of a whole-mount hindbrain preparation double immunostained for NK1R (red) and the motorneuron marker Islet1,2 (green) demonstrates that the position of the right facial motor nucleus matches the location of the fluorescence changes presented in D. G, Bath application of 10 µM CNQX to a wt whole-mount hindbrain preparation suppressed both rhythmic calcium changes over the facial motor nuclei (G, H) and accompanying electrical activity of the 12n (H, bottom trace). I, The Vglut2f/f;PCre mutants showed normal hindbrain morphology (I) but never displayed calcium transients over the facial motor nuclei (J) nor electrical hypoglossal motor activity (K).
|
|
Breathing movements in rodent embryos arise before birth and respiratory-related rhythmic activity in the mouse is first detected at E15.5 in en bloc brainstem and slice preparations (Suzue and Shinoda, 1999 ; Kobayashi et al., 2001 ; Thoby-Brisson et al., 2005 ). Suspecting that altered lung morphology could have resulted from impaired central respiratory command, we first used E16.5 brainstem en bloc preparations to check the presence of rhythmic activity on cranial motor nerve outputs in wt (n = 2), heterozygous (n = 6), and Vglut2f/f;PCre mutants (n = 4). Electrophysiological recording from the hypoglossal nerve root (12n) while optically recording changes in fluorescence occurring over the facial motor nuclei (7m) demonstrated bilateral rhythmic changes in fluorescence over the 7m synchronized with rhythmic bursts of activity of the 12n. Rhythmic activities emerging from wt and heterozygous mutant preparations were similar, with a combined average frequency for the rhythm of 9.5 ± 1.3 bursts · min1 (Fig. 3CE). Application of the AMPA/kainate receptor antagonist CNQX (10 µM; n = 4) suppressed both 12n electrical and 7m optically detected activities (Fig. 3FH). In control conditions, recordings performed on Vglut2f/f;PCre mutant preparations revealed the absence of both spontaneous electrical activity of the 12n and accompanying changes in fluorescence over the facial motor nuclei areas (Fig. 3IK). Hence, the Vglut2f/f;PCre mutants showed a complete impairment of respiratory-related rhythmic motor output.
We next examined premotor rhythm generation at the level of the PBC on another set of embryos. We recorded the neuronal activity within the PBC from brainstem transverse slices. The spontaneous activity of the PBC cellular population was recorded from 11 slices from either wt or heterozygous embryos through calcium imaging and extracellular electrophysiological recordings at E16.5, 24 h after it becomes first active (Thoby-Brisson et al., 2005 ). In all cases, a spontaneous rhythmic activity could be recorded and visualized through associated changes in fluorescence in the PBC area of the slice (Fig. 4AC) (Thoby-Brisson et al., 2005 ). Bath application of the µ-opioid agonist DAMGO (0.3 µM) first slowed and then reversibly fully suppressed the PBC rhythm (data not shown), whereas SP (0.1 µM) increased the rhythm frequency from 8.0 ± 1.4 burst · min1 (n = 5) to 14.5 ± 2.5 burst · min1 (Fig. 4D). Furthermore, blockade of AMPA/kainate receptors with bath application of CNQX (10 µM) abolished the rhythm (n = 5) [see below and also Thoby-Brisson et al. (2005) ]. In contrast, no activity could be recorded from corresponding seven of seven slices (E15.5, n = 2; E16.5, n = 2; E17.5, n = 1; E18.5, n = 2) from Vglut2f/f;PCre mice (Fig. 4EG). Prolonged (15 min) applications of SP (0.1 µM; n = 3) (Fig. 4H) or NMDA (5 µM; n = 2) (data not shown) failed to induce rhythmic activity.
The PBCs in Vglut2 mutants have contralateral projections but no longer communicate over the midline
Commissural synaptic relationships across ventrolaterally located PBC areas in E16.5 transverse slices from wt and Vglut2f/f;PCre mutants were investigated by electrical and chemical stimulation. In wt slices, unilateral electrical stimulation of the PBC (Fig. 5AC) resulted in evoked bilateral bursts mixed with spontaneously occurring rhythmic bursts. The same stimulus in Vglut2f/f;PCre mutant slices instead evoked a calcium response restricted ispilaterally in the vicinity of the stimulation site (Fig. 5JL). When the stimulating electrode was placed in a medial position to stimulate PBC axonal connections crossing the midline (Koshiya and Smith, 1999 ), it resulted in bilateral evoked calcium responses of the PBCs in wt slices (Fig. 5DF). In Vglut2f/f;PCre mutant slices, midline stimulation could also elicit a calcium response in the expected location of the PBC (Fig. 5MO). However, the amplitude of this response was reduced 10-fold and resembled the response evoked in wt slices after blockade of AMPA/kainate receptors with CNQX (Fig. 5GI). Finally, orthodromic recruitment of the contralateral PBC through commissural interneurons was assessed by chemical stimulation. Local pressure application of a glutamate agonist or GABA onto the PBC on one side is known to induce bilateral calcium variation in wt E15.5 PBC slices (Thoby-Brisson et al., 2005 ). Here, pressure application of the glutamate agonist AMPA (1 mM; 50 ms; 0.5 bar) on the PBC on one side resulted in bilateral PBC calcium responses in wt slices (n = 3) (data not shown). However, the same AMPA application in Vglut2f/f;PCre slices (n = 2) (Fig. 5PR) elicited a calcium response limited to the injection site, demonstrating that local AMPA responsive cells were unable to synaptically propagate their excitation contralaterally. Hence, in the mutant, the small-amplitude PBC-evoked responses to electrical stimulation from the midline probably arose from antidromic activation of preserved commissural PBC neurons. These experiments indicate a conserved albeit nonfunctional PBC-like commissural connectivity in the Vglut2f/f;PCre mutant.

View larger version (79K):
[in this window]
[in a new window]
|
Figure 5. Excitatory commissural communication between PBC ventrolateral areas is impaired in E16.5 Vglut2f/f;PCre mutant transverse slices. Communication between bilaterally located PBCs through commissural projections was compared in wt (AI) and Vglut2f/f;PCre mutants (JO). AC, Direct fluorescence image (A) showing the position of the stimulation electrode (S1) over the right PBC and regions used to detect calcium changes over the stimulated PBC (red outline) and the contralateral PBC (black outline). B, Evoked relative calcium change over the slice in response to S1. C, Fluorescence ( F/F) traces color matched to regions shown in A. The top red trace in C corresponds to calcium transients (upward arrowheads) occurring in red outlined region of the PBC ipsilateral to the stimulus. Note in the wt the bilateral activation of dorsomedial regions. Synchronous ipsilateral and contralateral (black trace) PBC-evoked responses are intermixed with spontaneous rhythmic activity in wt slices (DF). In contrast, evoked activity fails contralaterally in the Vglut2f/f;PCre mutant (JL), which are also spontaneously inactive. DF, Stimulation over the midline commissure (S2) in wt slices evoked a local (red trace) and a bilateral response of the PBC (black trace; left PBC response) as well as activation of dorsomedial regions of the slice in the vicinity of hypoglossal motorneurons. In corresponding Vglut2f/f;PCre mutant slices (MO), the PBC-evoked response to S2 (O, black trace) shows a considerably reduced amplitude reminiscent of that obtained in the wt context after application of CNQX (G, H). PR, Pressure application of AMPA over the right PBC area in Vglut2f/f;PCre mutant (Q, R, red squares) evoked a calcium response restricted to the immediate vicinity of the injection site (R, red trace), thus failing to orthodromically propagate to the contralateral PBC area (R, black trace).
|
|
The brainstem nuclei involved in respiration appear morphologically normal
We next characterized the structural and cellular organization of several nuclei located in the brainstem that are known to be part of the central respiratory network. Embryo sections at E16.5 and E18.5 were analyzed by in situ hybridization and immunohistochemistry. At E18.5, the locations, distributions, and the size of cellular populations of upper airway motorneurons in the hypoglossal nucleus (XII), the vagal nucleus (X), and nucleus ambiguous (NA) as well as phrenic motoneurons (MN) in the cervical spinal cord were similar in wt and Vglut2f/f;PCre embryos as shown by VAChT mRNA expression (Fig. 6CH). In Figure 6, D and G, the area of the PBC is boxed to show its location; however, this is a VAChT-negative nucleus. Phox2b mRNA expression (Pattyn et al., 2000b ) was used to localize the locus ceruleus (LC), the A1/C1 nucleus, and the nucleus of the solitary tract (NTS) in sections at E18.5 (Fig. 6A shows control sections; Vglut2f/f;PCre sections are not shown). Adjacent sections were then processed for immunoreactivity of VGLUT2 and nuclei-specific markers. VGLUT2-positive nerve terminals are seen closely surrounding TH-expressing noradrenergic neurons in the LC (Fig. 6I), Phox2b/TH-expressing neurons in the noradrenergic/adrenergic A1/C1, and Phox2b-expressing neurons in the NTS (Fig. 6O). In sections covering the PBC area, VGLUT2-positive terminals were detected on NK1R-positive PBC neurons (Guyenet et al., 2002 ; Liu et al., 2003 ; Stornetta et al., 2003a ,b ) (Fig. 6R). We then examined how loss of Vglut2 expression affects these nuclei. The neurons of the LC had a normal distribution and number of cells in Vglut2f/f;PCre E18.5 embryos (Fig. 6J,K), which was true also for the A1/C1 nucleus and the NTS (Fig. 6M,N,P,Q). Medial in the NTS, the TH-expressing noradrenergic/adrenergic A2/C2 nucleus could be detected in both control and Vglut2f/f;PCre brains (Fig. 6P,Q) (data not shown). Finally, the organization of NK1R/islet1,2-immuno positive visceral motorneurons in the nucleus ambiguous and NK1R-positive PBC neurons appeared similar in control and Vglut2f/f;PCre embryos at both E16.5 (Fig. 6S,T) and E18.5 (data not shown). Together, these data indicate that components of the respiratory network in Vglut2f/f;PCre embryos are present and have normal locations and size, suggesting little impact on brainstem structures and expression of genetic markers.

View larger version (110K):
[in this window]
[in a new window]
|
Figure 6. Respiratory-related nuclei in the brainstem appear normal in the Vglut2f/f;PCre mutant. A, B, Phox2b in situ hybridization on coronal sections of E18.5 wt embryos shows the locations of several nuclei involved in regulation of respiratory function including the LC (A), the NTS (B), and the A1/C1 noradrenergic/adrenergic nucleus (A1/C1) (B). CH, VAChT in situ hybridization on adjacent section shows the location of other respiratory-related nuclei; the dorsal nucleus of the vagus nerve (X), the hypoglossal nucleus (XII) (both on C), the ambiguous nucleus (NA) (D), and the anterior spinal motor neurons (MN) (E). In the Vglut2f/f;PCre, these nuclei appear normal (F, X and XII; G, NA; H, MN). Note, in D, the approximate area of the PBC is boxed to visualize its location; however, this is a VAChT-negative nucleus. IT, Immunofluorescence analyses with specific markers of the respiratory nuclei at E18.5 shown in A and B, in which the left panel shows the location of VGLUT2-positive terminals (green) in the LC (I, colabeling with TH in red and DAPI in blue), A1/C1 [L, TH in red and Phox2b (P2b) in blue], NTS (O, P2b in blue), and also the PBC [R, neurokinin-1-receptor (N1R) in red and DAPI in blue]. The middle and right panels show the entire nuclei at lower magnification; NTS with TH in red (J, K), A1C1 with TH in red and Phox2b in blue (M, N), NTS with Phox2b in blue (P, Q), and PBC and NA visceral motor neurons with N1R in red and islet1,2 in green (S, T) in the control (J, M, P, S) and Vglut2f/f;PCre (K, N, Q, T) brains. No major structural differences between the two genotypes could be detected in these nuclei. In particular, note in S and T the conserved organization of the PBC area including NK1R+/islet1,2- interneurons (white arrowheads) ventral and medial to the NA. Scale bars: A, 410 µm; B, 320 µm; C, 270 µm; D, 230 µm; E, 72 µm; I, 13 µm; K, 75 µm; L, 9 µm; N, 35 µm; O, 21 µm; R, 13 µm; Q, 150 µm; T, 50 µm.
|
|
Fast, excitatory synaptic events are abolished in Vglut2f/f;PCre mutants
We next analyzed how lack of VGLUT2 affected the activity of individual neurons of the PBC area. The ongoing synaptic activity present in neurons of the PBC area of wt and Vglut2f/f;PCre mutants was examined on transverse slices. Whole-cell voltage-clamp experiments, using a high chloride concentration (26 mM) intrapipette solution, indicated that the spontaneous synaptic activity in wt preparation was composed of fast and slow decaying inward synaptic currents (Fig. 7AD) (15 cells from two E18.5 slices). Slow but not fast synaptic currents were abolished in the presence of bicuculline and strychnine (Fig. 7D), indicating that they were likely mediated by GABAA and glycinergic receptors. In all cases, fast synaptic events resistant to bicuculline and strychnine (Fig. 7D) were abolished by additional application of CNQX (data not shown). Hence, the fast synaptic events were mediated by AMPA/kainate receptors. Interestingly, the spontaneous synaptic activity recorded in neurons of the PBC area in Vglut2f/f;PCre slices (12 cells from two slices) revealed the selective absence of fast synaptic events (Fig. 7EG). Additional application of bicuculline and strychnine suppressed all remaining synaptic activity in Vglut2f/f;PCre mutant preparations (Fig. 7H). Hence, the absence of population synchronous rhythmic activity in the expected location of the PBC in Vglut2f/f;PCre mutants is associated to the lack of AMPA/kainate receptor-mediated synaptic processing.

View larger version (29K):
[in this window]
[in a new window]
|
Figure 7. Loss of VGLUT2 results in the selective absence of fast excitatory synaptic events in neurons of the PBC area. AD, Voltage-clamp whole-cell recordings of spontaneous inward synaptic currents in rhythmically active PBC neurons recorded in a wt E16.5 transverse slice and in nonrhythmic neurons of the PBC area recorded in a Vglut2f/f;PCre mutant slice (EH). A, Current traces showing in a representative wt neuron a characteristic mixture of fast (black triangles) and slow (empty triangles) inward synaptic events. B, Ten superposed individual synaptic currents (top traces) are averaged (bottom trace) and fitted to derive the time constant of their decay respectively for fast (left set of traces) and slow (right set of traces) synaptic events. C, The bimodal frequency distribution of the decay time constant of synaptic events (n = 440) featuring a first peak corresponding to fast decaying events (black triangle); slow, white triangle above the histogram in that cell. D, The presence of bicuculline and strychnine blocking chloride-mediated synaptic currents suppressed all slow synaptic events and left the fast events unaffected. In the Vglut2f/f;PCre mutant neurons (EH), almost all synaptic events were slow (E, F); fast synaptic events were found to be extremely scarce (<3%; see the histogram in G) resulting in a modal distribution of the decay time constants of all synaptic events (n = 460) in the slow event range (white triangle above histogram). Furthermore, blocking of GABAA and glycine receptors suppressed all slow events (H). All current measurements were performed at a holding potential of 70 mV.
|
|
Neurons with intrinsic bursting properties are preserved in the PBC area in Vglut2f/f;PCre mutants
Rhythm generation in the PBC may also rely on a small proportion (525%) of cells capable of intrinsic bursting (Del Negro et al., 2002 ; Pena et al., 2004 ; Pagliardini et al., 2005 ; Thoby-Brisson et al., 2005 ). Such neurons remain active when glutamatergic synaptic transmission is blocked by CNQX (Smith et al., 1991 ; Koshiya and Smith, 1999 ; Thoby-Brisson and Ramirez, 2001 ; Johnson et al., 2002 ; Thoby-Brisson et al., 2005 ). We recorded the spontaneous calcium changes occurring in individual neurons of the PBC area in Vglut2f/f;PCre mutant transverse slices (Fig. 8A,B). Continuous 1 min samplings of the activities from 46 neurons (from two E16.5 slices) indicated that the majority of neurons (34) presented spontaneous transient calcium changes and that the remainder of neurons were silent. The active neurons showed a large cell-to-cell variability in both the frequencies (range, 115 calcium events per minute) and amplitudes ( F/F, 15%) of calcium events. In contrast to what is observed in wt slices (Thoby-Brisson et al., 2005 ), we failed to detect occurrence of phased calcium events between different cells. However, among the active cellular population, three cells ( 5%) displayed spontaneous periodic calcium changes (Fig. 8C). When substance P (0.1 µM) was bath applied, individual cells tended to show more calcium events, although this did not result in emergence of synchronous calcium events across the cellular population. Among cells with periodic bursting activity, substance P application resulted in an increased burst frequency in two of three cases (Fig. 8D, cell 8), whereas the remaining cells lost all calcium fluctuations. Interestingly, application of substance P also transformed the spontaneous activity in one cell from nonperiodic to periodic (Fig. 8, compare the activity of cell 3 in C and D). Substance P, probably acting on NK1 receptors present on neurons in the PBC area of Vglut2f/f;PCre mutants (Fig. 6S,T), depolarized individual neurons in appropriate voltage domains in which the periodic busting pattern can either emerge, increase in frequency, or can no longer be maintained. In support of this, we detected voltage-dependent bursting properties in 1 of 12 neurons by whole-cell recordings (Fig. 8E,F). Collectively, these data strongly suggest that the Vglut2f/f;PCre mutant PBC area contain a small set of independently active neurons capable of intrinsic bursting.

View larger version (51K):
[in this window]
[in a new window]
|
Figure 8. Neurons with intrinsic bursting properties are present in the PBC area of Vglut2f/f;PCre mutants. AC, Direct (A) and relative (B) fluorescence image at a cellular resolution (60x objective) of the PBC area in Vglut2f/f;PCre mutant transverse slices in control conditions. The changes in fluorescence were derived from the areas outlined around eight cells numbered 18 (A) and are presented in C. Calcium transients in cell 8 (A, red outline) are periodic, whereas cell 3 (A, blue outline) shows a single calcium event. The relative fluorescence image (B) taken at the time indicated by an arrowhead in C illustrate that cell 3 is active when remaining cells are inactive. The average calcium signal (C, bottom thick trace) for the eight cells is flat, demonstrating the lack of synchronous calcium events. D, In the presence of SP (0.1 µM), cells 3, 5, and 8 show increased number of bursts. Note that, in cell 3, bursts are organized in a periodic manner under SP. Flat average signal (D, bottom thick average trace) indicates that absence of synchronous calcium events is maintained under SP. E, Whole-cell current-clamp experiment showing the membrane potential (Vm) trajectory (top trace) of a neuron recorded in the PBC area in a Vglut2f/f;PCre mutant transverse slice and simultaneous population activity recording of the PBC area (D, bottom trace). At a hyperpolarized potential of 64 mV, this neuron is inactive; at its resting membrane potential (Vrest., 55 mV), it generates bursts of action potential (one such burst indicated by the arrowhead is shown with a faster time base in F); and when further depolarized to 50 mV, the bursts show increased duration and are generated at a higher frequency.
|
|
Synaptic vesicles are redistributed and malformed in asymmetric synapses
We analyzed several brain regions by EM to determine the influence of VGLUT2 deficiency on synaptic morphology. In the pons, cortex, and hippocampus of control embryos, the asymmetric synapses contained round vesicles, whereas in the Vglut2f/f;PCre embryos, the vesicles had an elongated, drop-like, or irregular shape (data not shown). A closer analysis of the distribution and morphology of synaptic vesicles was performed at the level of the medulla in the hypoglossal motor region showing strong immunoreactivity for VGLUT2 (Fig. 9A). Also, in this region, we found oddly shaped vesicles in asymmetric synapses from Vglut2f/f;PCre embryos (Fig. 9BD) compared with control littermates (Fig. 9E). Quantification of the number of vesicles in each synapse revealed that symmetric synapses had a similar distribution of vesicles in wt and Vglut2f/f;PCre embryos (Fig. 9F,G,J). In contrast, asymmetric synapses from Vglut2f/f;PCre embryos had a higher number of synapses containing only one vesicle than had littermate controls (Fig. 9H,I,K). The average number of vesicles in symmetric synapses was similar between the genotypes with 5.5 ± 0.6 in controls (n = 167 synapses) and 6.4 ± 0.7 (n = 172) in Vglut2f/f;PCre embryos. In contrast, the average number of vesicles in asymmetric synapses in Vglut2f/f;PCre embryos (3.7 ± 0.4; n = 108) was significantly smaller (t test, p = 0.003) compared with control embryos (8.3 ± 1.1; n = 99). Because asymmetric synapses are generally excitatory (Kandel et al., 1991 ), our data demonstrate that, in excitatory terminals of Vglut2f/f;PCre embryos, synaptic vesicles are often malformed and are reduced in number with overrepresented terminals comprising only one vesicle.

View larger version (51K):
[in this window]
[in a new window]
|
Figure 9. Loss of VGLUT2 results in altered morphology and reduced number of synaptic vesicles in asymmetric synapses. A, VGLUT2 immunofluoresence (white) of the E18.5 brainstem showing the area selected for EM quantification (square). BE, High-magnification pictures show that asymmetric vesicles in the Vglut2f/f;PCre (BD) are highly irregular in shape as exemplified here by thin (B) and thick (C) elongated vesicles and a couple of drop-shaped and pointed vesicles (D), whereas the control vesicles show a regular, circular shape (E). The white arrows indicate vesicle borders. FI, Low magnification of synaptic structures containing presynaptic vesicles shows that symmetrical synapses, defined by thickened presynaptic and postsynaptic membranes, do not differ between control (F) and Vglut2f/f;PCre (G), whereas asymmetric synapses, with thickened postsynaptic membrane in both genotypes, contain round vesicles in the control (H) and irregularly shaped vesicles in the Vglut2f/f;PCre (I). J, K, Quantification of the number of vesicles per synapse, subdivided into groups of 1, 28, 918, 1925, or >25 vesicles per synapse, in symmetrical (J) and asymmetrical (K) synapses in brainstem of two control and two Vglut2f/f;PCre E18.5 embryos. In symmetrical synapses, the resulting profiles do not differ significantly between controls and mutants; both have similar number of synapses in each subgroup. In contrast, the profiles of asymmetrical synapses differ in that 3050% of synapses contain one vesicle only in the Vglut2f/f;PCre brain, whereas no control synapses belong to this subgroup. Instead, control synapses contain a larger number of vesicles (8% have 1925 vesicles and up to 13% have >25 vesicles), whereas the corresponding number in the mutant for both these subgroups is zero. Scale bars: A, 155 µm; C, 50 nm; H, 175 nm.
|
|
Vglut2 deficiency spares the function of the locomotor CPG in vitro
To evaluate the influence of Vglut2 deficiency in other CPG neurocircuits, we investigated functionality of the locomotor CPG for which excitatory neurons have been shown to be necessary components (Buchanan and Grillner, 1987 ; Grillner, 1997 , 2003 ). Vglut2 is expressed already at stage E12.5 in the spinal cord (Fig. 10A). After birth, Vglut2 but not Vglut1, is abundantly expressed (Fig. 10B,C) in the ventral aspect of the spinal cord, which is known to be critical for locomotor rhythm generation (Kjaerulff and Kiehn, 1996 ). We therefore expected to detect major deficiencies in in vitro measurements of fictive locomotion. To induce fictive locomotion in dissected spinal cords from E18.5 fetuses, we added a combination of NMDA, serotonin, and dopamine (see also Materials and Methods). Surprisingly, the Vglut2f/f;PCre spinal cords showed in all seven preparations tested, a pattern of rhythmic leftright alternation as well as coordination of the lumbar level 2 and 5 activity with a periodicity indistinguishable from that recorded from control (n = 11) preparations (Fig. 10DG). This is in stark contrast to the situation found in the respiratory CPG, suggesting a dispensable role for VGLUT2 in the locomotor CPG.

View larger version (57K):
[in this window]
[in a new window]
|
Figure 10. Preserved rhythmic and coordinated locomotor activity in the lumbar spinal cord of Vglut2f/f;PCre mutant mice. AC, Vglut in situ hybridization on transverse wt sections of spinal cord shows expression at E12.5 (A) and P0 (B) of Vglut2 mRNA widely distributed, whereas Vglut1 mRNA is discretely expressed in the P11 dorsal spinal cord (C). D, G, Recorded activity in the lumbar ventral roots, at level 2 and 5, after application of NMDA and serotonin to the isolated spinal cord of E18.5 mice. The control (D) as well as the Vglut2f/f;PCre mutant spinal cords (G) show a normal alternating rhythmic locomotor activity. E, F, H, I, Circular phase diagrams of intrasegmental left/right (E, H) and intersegmental flexion/extension (F, I) coordination. A phase value of 0.5 reflects alternating activity, and 0.0 reflects synchronous activity. l, Left; r, right; L, lumbar segment. J, The average period cycle time of control (n = 11) and Vglut2f/f;PCre (n = 7) mice was not statistically different (p = 0.0680); the average was calculated from the mean period of 15 random locomotor cycles from each mouse. Error bars indicate SEM.
|
|
 |
Discussion
|
|---|
Here, we present the first functional study of VGLUT2 by conditional deletion in mice and demonstrate that VGLUT2 signaling is an essential component of the developing respiratory rhythm generator. VGLUT2-deficient mice fail to initiate synchronized rhythmic activity in the PBC and do not breathe at birth. Vglut2f/f;PCre mutants have fewer and malformed synaptic vesicles at asymmetric but not symmetric synapses in the hindbrain. This results in a selective impairment of AMPA/kainate receptor-mediated synaptic currents in neurons of the PBC, which in turn prevents synchronized PBC population activity. We here suggest that VGLUT2 is necessary for PBC cells to function as a network with synchronized and rhythmic activity.
Vglut2f/f;Pcre mutants fail to generate a respiratory rhythm
The central rhythmic activity of the PBC beginning on E15.5 in the mouse and E16.5 in the rat is the first sign of respiratory-related activity in developing rodents (Pagliardini et al., 2003 ; Thoby-Brisson et al., 2005 ) and is initiated shortly before the start of respiratory-like movements (Ezure, 1990 ). Spontaneous PBC area rhythmic activities in the Vglut2f/f;PCre mutant mouse was not observed at E15.5. Later on, at E16.5, central rhythm generation was missing at a stage when respiratory movements would normally be present. Fetal development of the lung is strongly influenced by mechanical forces arising from fluid inflation and fetal breathing movements (Alcorn et al., 1977 ; Tschumperlin and Drazen, 2006 ). The defective lungs found in Vglut2f/f;PCre mutants are consistent with absence of breathing movements. Therefore, the absence of ventilation in Vglut2f/f;PCre mutants observed in E18.5 fetuses in vivo and the cyanotic appearance of born mutants probably results from a deficient respiratory motor drive that has been dysfunctional throughout prenatal development. It would be interesting to investigate whether Vglut2f/f;PCre mutant fetuses also have other impaired primordial movements such as head flexions, hiccup, and startle movements that are set before onset of fetal breathing movements (de Vries et al., 1982 ; Suzue and Shinoda, 1999 ). Along the same line, it is presently unknown whether other brainstem networks such as those involved in regulation of swallowing, cardiovascular function, or sleep may also be functionally impaired in Vglut2f/f;PCre mutants. We conclude that VGLUT2-mediated signaling is crucial for the functional onset of the PBC and ventilation at birth.
The VGLUT2 deficiency does not alter the anatomy of central respiratory areas
Vglut2f/f;Pcre mutants were here shown to develop in the absence of gross anatomical defects of the brainstem hosting central respiratory areas. The location and anatomical layout of the NTS, A1/C1, A2/C2, LC, dorsal motor nuclei of the vagus nerve, hypoglossal motor nuclei as well as the phrenic motorneuronal column in the cervical spinal cord appeared normal at E18.5 and P0. Phox2b and/or TH expression were unaltered in identified neuronal groups, suggesting that normal morphogenetic development occurs within the hindbrain of Vglut2f/f;Pcre mutants. In Vglut2f/f;PCre mutants, the PBC area adjacent to normally developed A1/C1 nuclei hosted candidate PBC neurons characterized by NK1R expression ventrally located with respect to normally located Islet1,2/NK1R-positive NA visceral motorneurons (Gray et al., 1999 ). Furthermore, PBC commissural fibers as well as GABAergic/glycinergic inhibitory synapses are present in Vglut2 null mutants. Together, these results demonstrate that the anatomical integrity of the hindbrain and of the PBC in particular is preserved in Vglut2f/f;PCre mutants.
Breathing defects that result from abnormal development of brainstem respiratory cir |