WWW.JNEUROSCI.ORG
-
The Journal of Neuroscience
 QUICK SEARCH:   [advanced]


     
-


HOME
  |  
SEARCH  |   ARCHIVE  |   SUBSCRIBE  |   CONTACT  |   HELP

The Journal of Neuroscience, July 11, 2007, 27(28):7429-7437; doi:10.1523/JNEUROSCI.1307-07.2007

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Supplemental Data
Right arrow Submit an eLetter
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Web of Science (2)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Plant, S. R.
Right arrow Articles by Ting, J. P.-Y.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Plant, S. R.
Right arrow Articles by Ting, J. P.-Y.

 Previous Article  |  Next Article 

Neurobiology of Disease
Lymphotoxin ß Receptor (LtßR): Dual Roles in Demyelination and Remyelination and Successful Therapeutic Intervention Using LtßR–Ig Protein

Sheila R. Plant,1,2 * Heather A. Iocca,1 * Ying Wang,1 J. Cameron Thrash,4 Brian P. O'Connor,1 Heather A. Arnett,1,2 Yang-Xin Fu,5 Monica J. Carson,4 and Jenny P.-Y. Ting1,2,3

1Lineberger Comprehensive Cancer Center, 2Neuroscience Center, and 3Department of Microbiology-Immunology, University of North Carolina, Chapel Hill, North Carolina 27599, 4Division of Biomedical Sciences, University of California, Riverside, California 92521, and 5Department of Pathology, The University of Chicago, Chicago, Illinois 60637


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Inflammation mediated by macrophages is increasingly found to play a central role in diseases and disorders that affect a myriad of organs, prominent among these are diseases of the CNS. The neurotoxicant-induced, cuprizone model of demyelination is ideally suited for the analysis of inflammatory events. Demyelination on exposure to cuprizone is accompanied by predictable microglial activation and astrogliosis, and, after cuprizone withdrawal, this activation reproducibly diminishes during remyelination. This study demonstrates enhanced expression of lymphotoxin ß receptor (LtßR) during the demyelination phase of this model, and LtßR is found in areas enriched with microglial and astroglial cells. Deletion of the LtßR gene (LtßR–/–) resulted in a significant delay in demyelination but also a slight delay in remyelination. Inhibition of LtßR signaling by an LtßR–Ig fusion decoy protein successfully delayed demyelination in wild-type mice. Unexpectedly, this LtßR–Ig decoy protein dramatically accelerated the rate of remyelination, even after the maximal pathological disease state had been reached. This strongly indicates the beneficial role of LtßR–Ig in the delay of demyelination and the acceleration of remyelination. The discrepancy between remyelination rates in these systems could be attributed to developmental abnormalities in the immune systems of LtßR–/– mice. These findings bode well for the use of an inhibitory LtßR–Ig as a candidate biological therapy in demyelinating disorders, because it is beneficial during both demyelination and remyelination.

Key words: demyelination; cuprizone; glia; Lt{alpha}ß; LtßR; therapy


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Tumor necrosis factor {alpha} (TNF{alpha}) and lymphotoxin {alpha} (Lt{alpha}) (also known as TNFß) are part of the large TNF superfamily of ligands (Ware et al., 1995Go; Locksley et al., 2001Go; Zhang, 2004Go). Membrane-bound or soluble TNF{alpha} signals through TNFRI (also p55) and TNFRII (also p75) to elicit a wide variety of signals in many different cell types. Homotrimeric secreted Lt{alpha} also signals through TNFRI and TNFRII. Additionally, Lt{alpha} can interact with membrane-bound lymphotoxin ß (Ltß) to form a Lt{alpha}ß heterotrimer, which is specific for lymphotoxin ß receptor (LtßR) (Crowe et al., 1994Go; Ware et al., 1995Go). Signaling through LtßR causes the activation of TNF receptor-associated factor adaptor molecules and induces signals through both the classical and alternative nuclear factor-{kappa}B pathways (Baud and Karin, 2001Go; Dempsey et al., 2003Go).

The roles of TNF{alpha}, Lt{alpha}, TNFRI, and TNFRII have been extensively investigated in numerous rodent models of demyelination (Ruddle et al., 1990Go; Korner et al., 1997Go; Liu et al., 1998Go; Probert et al., 2000Go; Arnett et al., 2001Go, 2003Go; Kassiotis and Kollias, 2001Go). Although TNF{alpha} and Lt{alpha} are upregulated in multiple sclerosis (MS) and are believed to play an important detrimental role in the pathology of disease (Raine et al., 1998Go), inhibition of TNF{alpha} in patients leads to symptom exacerbation (van Oosten et al., 1996Go; The Lenercept Multiple Sclerosis Study Group and The University of British Columbia MS/MRI Analysis Group, 1999Go; Robinson et al., 2001Go; Sicotte and Voskuhl, 2001Go), highlighting the need for a comprehensive understanding of the role of TNF family ligands and receptors in demyelinating disease.

Using inhibitors of LtßR signaling to examine the role of LtßR in experimental autoimmune encephalomyelitis (EAE), one report demonstrates that signaling by Lt{alpha}ß heterotrimers is important in demyelination (Gommerman et al., 2003Go). In these studies, T-cell function was believed to be the primary target of LtßR–Ig. Although these results highlight the involvement of infiltrating T cells in demyelination, the role of CNS-derived Lt{alpha}ß and LtßR is not known. In addition, the capacity of signaling via LtßR to affect reparative remyelination has not been determined.

In the current investigation, we used the cuprizone model to study the involvement of LtßR in demyelination and remyelination. Cuprizone-induced demyelination and remyelination occur without T-cell involvement. We previously used the cuprizone model to demonstrate the detrimental nature of TNF{alpha} and Lt{alpha} during demyelination and the beneficial effect of TNF{alpha} in the remyelination phase (Arnett et al., 2001Go; Plant et al., 2005Go). In the present study, we demonstrate detrimental effects of LtßR in cuprizone-induced demyelination. In addition, we tested the efficacy of inhibitors of LtßR signaling (LtßR–Ig) and found significant benefits of blocking the LtßR pathway in both demyelination and remyelination phases of the model. These findings strongly suggest that inhibition of LtßR signaling in MS patients may be a beneficial treatment option.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Animals. C57BL/6 mice were purchased from The Jackson Laboratory (Bar Harbor, ME) and bred in house at the University of North Carolina (UNC) animal facility. LtßR–/– mice (Futterer et al., 1998Go), previously backcrossed to C57BL/6 for at least five generations, were imported from the University of Chicago and bred in house at the UNC animal facility. All procedures were conducted in accordance with National Institutes of Health guidelines and were approved by the Institutional Animal Care and Use Committee of UNC at Chapel Hill. All mice were 8–10 weeks of age before the start of cuprizone treatment.

Treatment of mice. Male LtßR–/– and C57BL/6 wild-type mice were fed ad libitum 0.2% cuprizone [oxalic bis(cyclohexylidenehydrazide)] (Sigma-Aldrich, St. Louis, MO) mixed into milled chow. Mice were treated for 3, 3.5, 4, or 5 weeks to study the demyelination process. For remyelination, mice were treated for 6 full weeks with cuprizone and then were returned to a diet of normal pellet chow for 1, 2, 4, or 6 weeks (7, 8, 10, or 12 weeks of total treatment). Untreated mice were maintained on a diet of normal pellet chow. This protocol was used for all studies with the exception of those involving inhibitors of LtßR signaling.

Two versions of murine LtßR–IgG (LtßR–human IgG and LtßR–mouse IgG) and their controls were kindly provided by Dr. J. Browning (Biogen Idec, Cambridge, MA) and have been described previously (Gommerman et al., 2003Go). Separate treatment paradigms were used for studies using LtßR–Ig fusion molecules. To study demyelination, mice were intraperitoneally injected on day –1 and weekly thereafter with 5 mg/kg of either LtßR–human IgG-1 Fc (LtßR–hIg) or human IgG as a control. To study remyelination, a posttreatment paradigm was used, in which mice were treated with cuprizone for 6 full weeks. After 5 weeks plus 2 d of cuprizone treatment (approximate height of demyelination) and weekly thereafter out to 10 weeks, mice were given intraperitoneal injections of either LtßR–mouseIgG-1 (LtßR–mIg) or matched control mouse IgG-1, MOPC-21. This murine version of LtßR–Ig has been shown to be less antigenic in the mouse (J. Browning, personal communication).

Tissue preparation and histopathological analysis. Paraffin-embedded coronal brain sections were prepared from the fornix region of the corpus callosum. Luxol fast blue–periodic acid Schiff (LFB–PAS) stained sections were read by three double-blinded readers and graded on a scale from 0 (complete myelination) to 3 (complete demyelination), as described previously (Arnett et al., 2001Go; Plant et al., 2005Go).

Immunohistochemistry. Detection of mature oligodendrocytes and microglia/macrophages was performed by immunohistochemistry (IHC) as described previously (Plant et al., 2005Go). Quantitative analyses of glutathione S-transferase {pi}-positive (GST{pi}+) and Ricinus communis agglutinin-1-positive (RCA-1+) cells were restricted to a 0.033 mm2 area at midline corpus callosum. Only immunopositive cells with an observable 4',6'-diamidino-2-phenylindole-stained nucleus were included in the quantification. Cell counts are averages of at least 9 and up to 14 mice per time point. Myelinated fibers were detected by immunohistochemistry with a primary antibody to myelin basic protein (MBP) (diluted 1:1000; Sternberger Monoclonals, Lutherville, MD) followed by fluorescein-conjugated anti-mouse IgG (Invitrogen, Carlsbad, CA) diluted 1:1000.

Dual in situ hybridization/immunohistochemical analysis. After cuprizone treatment, mice were perfused with RNase-free PBS and then 4% paraformaldehyde. Brains were removed and incubated in fixative until mounted for cryosectioning. Detection of mRNA for LtßR was performed by in situ hybridization (ISH) on free-floating brain cryosections as described previously (Schmid et al., 2002Go). Briefly, 25 µm sections were hybridized overnight at 55°C with 33P-labeled riboprobes (107 cpm/ml). Excess probe was removed by successive washing with 0.03 M NaCl, 0.003 M sodium citrate (2x SSC) containing 10 mM ß-mercaptoethanol (ß-ME), followed by a 1 h incubation with ribonuclease at 37°C, a 2 h incubation at 55°C with 0.5x SSC, 50% formamide, and 10 mM ß-ME, and finally by a 1 h incubation at 68 C in 0.1x SSC, 5 mM ß-ME and 5% sarcosyl. Myeloid cells and blood vessels were identified by their ability to bind biotinylated tomato lectin (Sigma, St. Louis, MO), and visualized by standard streptavidin–horseradish peroxidase methodology. Tissue sections were air dried onto superfrost plus slides (Fisher Scientific, Hampton, NH) and coated with Ilford K-5 emulsion (Polysciences, Warrington, PA). After 3 weeks, the emulsion-coated slides were developed with Kodak D19 developer and fixative (Fisher Scientific). Mayer's hematoxylin was used to visualize cellular nuclei, before dehydrating and preserving tissues sections under glass coverslips with Permount. Emulsion grains were counted in six microscopy fields per tissue section. Tissue sections from at least three mice were quantified. In each experiment, the basal (nonspecific) levels of grain counts were determined from quantifying grains over ventricles and areas without tissues. Induced expression was defined as threefold increase in grains per microscopic field.

To discern the cell types that express LtßR, the same tissue sections were also immunolabeled with either tomato lectin to visualize microglia, macrophages, and blood vessels or antibody to glial fibrillary acidic protein (GFAP) to visualize astrocytes. All immunolabeled cells were visualized by horseradish peroxidase staining (indicated by brown stain), whereas cells expressing the LtßR transcript were identified by black grains generated by in situ hybridization. Blood vessels are readily distinguished from microglia and macrophages by their tubular structure. Tomato lectin does not distinguish between microglia and macrophages.

Reverse transcription-PCR and quantitative real-time reverse transcription-PCR. Total RNA was isolated from a dissected region of the brain containing the corpus callosum of wild-type and LtßR–/– mice at several points during and after cuprizone treatment. RNA isolation was performed using the Qiagen (Valencia, CA) RNeasy kit under RNase-free conditions. Reverse transcription (RT)-PCR for LIGHT (homologous to lymphotoxins, exhibits inducible expression, and competes with herpes simplex virus glycoprotein D for the herpes-virus entry mediator, a receptor expressed by T lymphocytes) was performed in 20 µl reactions using the following primers: 5' primer, CTGGCATGGAGAGTGTGGTA; 3' primer, GATACGTCAAGCCCCTCAAG.

TaqMan 5' nuclease quantitative real-time PCR assays were performed using an ABI Prism 7900 sequence-detection system (Applied Biosystems, Foster City, CA) in a 15 µl reaction with universal master mix (Invitrogen), 200 nM LtßR target primers, and 100 nM probe. LtßR-specific primers were designed to span intron–exon junctions to differentiate between cDNA and genomic DNA. The primers and probe used to detect mouse LtßR were as follows: 5' primer, GTACTCTGCCAGCCTGGCACAGAAGCCGAGGTCACAGATG; 3' primer, GGTATGGGGTTGACAGCGGGCTCGAGGGGAGG; probe, 6-carboxyfluorescein (Fam)-ACGTCAACTGTGTCCC-6-carboxytetramethylrhodamine (Tamra). The primers and probe for mouse 18S ribosomal RNA were as follows: 5' primer, GCTGCTGGCACCAGACTT; 3' primer, CGGCTACCACATCCAAGG; probe, Fam-CAAATTACCCACTCCCGACCCG-Tamra. Thermal cycle parameters were optimized to 2 min at 50°C, 2 min at 95°C, and 40 cycles comprising denaturation at 95°C for 15 s and annealing–extension at 56°C for 1.5 min. Reactions for 18S were performed alongside LtßR during each experiment and used to normalize for amounts of cDNA.

Statistical analysis. Unpaired Student's t tests were used to statistically evaluate significant differences. Data are expressed as mean ± SEM.


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
LtßR and LIGHT expression in the brain
To assess LtßR expression in the cuprizone model, we performed quantitative real-time RT-PCR to examine the level of LtßR in the corpus callosum and surrounding tissue in untreated and cuprizone-treated mice. Low levels of LtßR were detected in control untreated mice, whereas the levels of LtßR rose moderately throughout demyelination but were then reduced to baseline levels during the remyelination phase (Fig. 1A).


Figure 1
View larger version (78K):
[in this window]
[in a new window]

 
Figure 1. Upregulation of LtßR during demyelination and inflammation. A, Upregulation of LtßR during demyelination and inflammation. Quantitative real-time RT-PCR analysis demonstrates an upregulation of LtßR mRNA expression in wild-type mice during cuprizone treatment (through week 5) and a decline to baseline levels during remyelination (weeks 7–10). B, Localization of LtßR mRNA by ISH during cuprizone treatment. At the level of autoradiogram analysis, LtßR mRNA expression is not detected by in situ hybridization in brains from untreated wild-type mice (i). Induction of LtßR mRNA is weakly detected within the corpus callosum of mice treated for 3 weeks (ii), and robust induction of LtßR is seen in the same regions in brains from mice treated for 5 weeks (iii). C, Microscopic examination of the same brain sections shows LtßR expression is highest in regions and time points with a large accumulation of microglia/macrophages. In i–vi, nuclei are visualized by hematoxylin (blue) and LtßR expression by 33P-labeled riboprobes (dark grains within the emulsion). In i–iii, microglia, blood vessels, and macrophages are visualized with tomato lectin (brown), whereas in iv–vi, astrocytes are visualized with GFAP antibodies (brown). In all panels, the focal plane is optimized to visualize the riboprobe-induced grains within the emulsion.

 
Numerous strategies to detect LtßR protein expression were used, including immunoblot, IHC, and flow cytometry. Unfortunately, high-quality specific antibodies for the detection of mouse LtßR by immunoblot or IHC have not been reported, and we verified that existing antibodies do not work in these assays. Although antibodies for flow cytometry have been reported (Crowe et al., 1994Go; Dejardin et al., 2002Go) for the staining of immune cells, flow cytometry of adult brain cells is exceedingly challenging, and the results appear suboptimal. Nonetheless, we performed flow cytometry for microglial (CD45+CD11b+) and astroglial (GFAP+) cell populations but were unable to obtain specific staining for LtßR by comparing brain cells isolated from wild-type versus LtßR–/– mice (supplemental Fig. 1, available at www.jneurosci.org as supplemental material). Because of the lack of appropriate serological reagents for the detection of LtßR protein, dual ISH/IHC analysis was used to simultaneously define the regions expressing the LtßR transcript and identify cell populations present in these regions during cuprizone treatment. LtßR mRNA expression was not detected in the CNS of untreated mice (Fig. 1Bi). By 3 weeks of cuprizone treatment, a low level of LtßR expression was detected in the corpus callosum region (Fig. 1Bii). By 5 weeks of treatment, robust expression of LtßR was detected throughout the corpus callosum and slightly weaker expression was detected in the striatal regions (Fig. 1Biii). By 3 weeks of cuprizone treatment, there was an increase in the hypercellularity of tomato lectin-stained cells in the corpus callosum, and this level was further enhanced at the 5 week time point, consistent with previous observations of robust microgliosis (Fig. 1Cii,Ciii). Comparison of regions with prominent microglia/macrophage accumulation at both time points revealed that robust LtßR ISH signal (black grains) was enhanced in all regions with strong induction of tomato lectin staining indicated by the brown coloration. Enhanced expression is defined as a threefold increase from controls in grain density. In a different set of samples, astrogliosis indicated by increased brown color attributed to GFAP immunoreactivity was observed at the 3 week time point, and it also became much more evident at the 5 week time point (Fig. 1Cv,Cvi). At the 3 week time point, there was little colocalization of grains with GFAP+ cells (Fig. 1Cv), but, at the 5 week time point (Fig. 1Cvi), GFAP+ cells were accompanied by LtßR grains. This indicates that, at the 3 week time point before the dramatic increase in hypercellularity, LtßR expression is preferentially detected in regions enriched for lectin-positive cells (Fig. 1, compare Cii, Cv). However, after 5 weeks of treatment, LtßR expression is most intense in areas enriched for microglia/macrophages, but it is also increased in areas of astrogliosis.

Because the membrane-bound ligand LIGHT (Granger and Ware, 2001Go) has the ability to interact with LtßR, at least in the periphery, we analyzed LIGHT expression levels by RT-PCR during cuprizone treatment. Although LIGHT is found at high levels in the control spleen and thymus, negligible levels were found in the brains of untreated or cuprizone-treated mice (Fig. 2A). In addition, LIGHT is not regulated by the presence of LtßR because mice lacking LtßR express similar levels of LIGHT in the brain (Fig. 2B). This suggests that LIGHT does not play a significant role during cuprizone-induced inflammation. This is similar to the conclusion reached by others using the EAE model (Gommerman et al., 2003Go).


Figure 2
View larger version (37K):
[in this window]
[in a new window]

 
Figure 2. PCR analysis of LIGHT during cuprizone treatment. A, RT-PCR for the ligand LIGHT was performed on cDNA from untreated and cuprizone-treated wild-type mouse brain. As controls, untreated thymus and spleen were analyzed. Representative results show that very low levels of LIGHT mRNA exist in the untreated and cuprizone-treated brain. B, RT-PCR on wild-type (WT) and LtßR–/– untreated (untrt) and treated brain cDNA demonstrate that the lack of LtßR has no effect on LIGHT RNA levels.

 
Delayed demyelination in LtßR–/– mice
To analyze the role of LtßR in demyelination, cuprizone-treated LtßR–/– mice were compared with treated wild-type mice. A significant delay in demyelination was observed in the LtßR–/– mice relative to wild-type mice, as assessed by LFB–PAS staining (Fig. 3A). These data indicate that signaling through LtßR exacerbates the inflammatory demyelinating process. This delay could be seen as early as 3 weeks (p < 0.02) of cuprizone treatment but was most pronounced at 3.5 weeks (p < 0.01) and 4 weeks (p < 0.001) of treatment and is clearly revealed by representative LFB–PAS images of wild-type and LtßR–/– mice at 4 weeks of treatment (Fig. 3B). Because the delay in demyelination in LtßR–/– mice is similar to the delay in demyelination seen in Lt{alpha}–/– mice (Plant et al., 2005Go), this suggests that membrane-bound Lt{alpha}ß signaling through the LtßR is involved in the demyelination process.


Figure 3
View larger version (43K):
[in this window]
[in a new window]

 
Figure 3. Time course of demyelination and remyelination in LtßR–/– and wild-type mice. A, LFB–PAS-stained paraffin sections were graded on a scale from 0 (normal myelination) to 3 (complete demyelination) by three double-blinded investigators. Each circle represents an individual mouse: open circles, C57BL/6 wild-type (Wt); filled circles, LtßR–/– mice. Horizontal lines indicate the median score of each group. Significant differences in demyelination were seen between wild-type and LtßR–/– mice at 3 weeks (p < 0.02), 3.5 weeks (p < 0.01), and 4 weeks (p < 0.001). Significant differences during remyelination were detected at 7 weeks (p < 0.001) and 10 weeks (p < 0.02). B, Representative LFB–PAS pictures at 4 weeks of treatment demonstrate the delay in demyelination in LtßR–/– mice (ii) compared with wild-type mice (i). Higher-magnification images of the corpus callosum of LtßR–/– (iv) and wild-type (iii) mice demonstrate the lack of myelinated fibers and increased inflammation in wild-type mice during demyelination.

 
Delayed remyelination in LtßR–/– mice
The ability of mature oligodendrocytes to remyelinate the corpus callosum was studied in LFB–PAS-stained paraffin sections from wild-type and LtßR–/– mice. Modest but significant differences in remyelination were observed between wild-type and LtßR–/– mice at 7 weeks (p < 0.001) and 10 weeks (p < 0.02) (Fig. 3A). By 12 weeks, LtßR–/– mice have remyelinated to the same extent as wild-type controls (p = 0.11). These differences during remyelination are <0.5 on the scale of severity of demyelination, whereas differences seen in studies of TNF{alpha}–/– versus wild-type mice were >1.5 on the scale (Arnett et al., 2001Go) and persisted up to 14 weeks (our unpublished data). We conclude that, although remyelination appears to be transiently delayed in LtßR–/– mice, it eventually occurs.

Delayed loss of oligodendrocytes in LtßR–/– mice during demyelination
To verify that the delay in demyelination observed by LFB–PAS is accompanied by changes in oligodendrocyte number, we performed immunohistochemistry for GST{pi}, a marker shown to be specific for mature myelinating oligodendrocytes (Tansey and Cammer, 1991Go) on adjacent paraffin sections. GST{pi}+ cells at the midline corpus callosum were quantitated. Abundant oligodendrocytes were detected in both wild-type and LtßR–/– untreated mice. As has been shown previously, the number of GST{pi}+ oligodendrocytes is dramatically reduced after 3 weeks of cuprizone treatment (Mason et al., 2000Go; Arnett et al., 2002Go). This represents an actual loss of oligodendrocytes because these cells exhibit increased apoptosis rather than a simple loss of the marker (Arnett et al., 2002Go). However, after 3.5 weeks of treatment, significantly more oligodendrocytes were present in LtßR–/– mice compared with wild-type mice (p < 0.01) (Fig. 4A,B), indicating a delay in the death of oligodendrocytes in the absence of LtßR. No difference in oligodendrocyte number was found between wild-type and LtßR–/– mice at 4 weeks. These data are complementary to the LFB staining results (Fig. 3A). By 5 weeks of cuprizone treatment, few GST{pi}+ oligodendrocytes were detected in the corpus callosum of wild-type and LtßR–/– mice. This data point is consistent with the severe demyelination shown in Figure 3A for both mouse strains at the 5 week time point.


Figure 4
View larger version (23K):
[in this window]
[in a new window]

 
Figure 4. Delayed loss of mature oligodendrocytes during demyelination in LtßR–/– mice. A, Mature oligodendrocytes were detected at midline corpus callosum of wild-type and LtßR–/– brains by GST{pi} immunohistochemistry. More GST{pi}+ cells were found in LtßR–/– mice compared with wild-type mice at 3 weeks (p = 0.09) (wild-type, gray bars; LtßR–/–, black bars). Significantly more GST{pi}+ cells were found in LtßR–/– mice at 3.5 weeks (p < 0.03), although no differences in oligodendrocytes were found at 4 and 5 weeks of cuprizone treatment. After the removal of cuprizone, no differences in oligodendrocyte repopulation of the corpus callosum were observed between wild-type and LtßR–/– mice. B, Representative pictures of GST{pi}+ cells from wild-type and LtßR–/– mice at 3 and 3.5 weeks of cuprizone treatment. C, Microglial/macrophage accumulation at midline corpus callosum is unaffected by LtßR. Microglia/macrophages were detected by RCA-1 lectin staining of paraffin sections from wild-type and LtßR–/– mice during demyelination and remyelination time points. No significant difference in numbers of RCA-1+ cells was observed between wild-type and LtßR–/– mice at any time point.

 
Normal oligodendrocyte repopulation of corpus callosum in LtßR–/– mice during remyelination
Although oligodendrocytes were rarely detected in the corpus callosum of 5 week cuprizone-treated mice, just 1 week after the removal of cuprizone (7 weeks), the corpus callosum was repopulated to ~75% of the original number of mature oligodendrocytes. No difference in oligodendrocyte number was observed between wild-type and LtßR–/– mice. By week 10, the number of mature oligodendrocytes residing in the corpus callosum recovered to pretreatment levels in both wild-type and LtßR–/– mice. Thus, LtßR is not required for oligodendrocyte progenitor proliferation and maturation during the remyelination phase. This differs from our previous study that demonstrated a profound role for TNF{alpha} and TNFRII in the proliferation of oligodendrocyte progenitors (Arnett et al., 2001Go).

Recruitment of microglia/macrophage is not changed in LtßR–/– mice
Cuprizone induces a chronic inflammatory state in the brain including the recruitment of activated microglia and macrophages to the sites of insult (Matsushima and Morell, 2001Go). Paraffin sections from LtßR–/– and wild-type mice were stained with the lectin RCA-1, and microglia/macrophages at midline corpus callosum were quantitated. We found no difference between LtßR–/– and wild-type mice in the recruitment of activated microglia/macrophage during the demyelination or remyelination phases of this model (Fig. 4C).

Inhibition of functional LtßR reduces demyelination
It has been well established that mice lacking LtßR from birth have significant developmental abnormalities (Futterer et al., 1998Go). Functional inhibition of LtßR in wild-type mice is possible using a fusion decoy protein and has been shown to affect the time course of EAE as well as prevent disease relapse (Gommerman et al., 2003Go). To assess the validity of our findings in LtßR–/– mice demonstrating a detrimental role for LtßR during cuprizone-induced demyelination, we treated C57BL/6 mice with either LtßR–hIg fusion decoy protein or control human IgG during cuprizone treatment. LtßR–hIg was shown previously to effectively inhibit Lt{alpha}ß–LtßR signaling (Gommerman et al., 2003Go). Mice were pretreated with either LtßR–hIg or control human Ig 1 d before start of the cuprizone (day –1) and weekly thereafter by intraperitoneal injection (5 mg/kg) and were maintained on an ad libitum diet of 0.2% cuprizone for 3.5 weeks (Fig. 5A). Mice were then perfused, and paraffin brain sections were stained with LFB–PAS to assess the extent of demyelination at the midline corpus callosum. Mice treated with control human Ig were significantly more demyelinated than mice that received the LtßR–hIg inhibitor (p < 0.02) (Fig. 5B,Ci–Civ). Immunohistochemistry for MBP confirmed the increase of myelinated fibers in mice treated with LtßR–hIg relative to mice treated with control human Ig. In conclusion, demyelination in cuprizone-treated mice can be significantly delayed by inhibition of LtßR. This is similar to the effect observed in the EAE disease models using both mice and rats (Gommerman et al., 2003Go). Our data demonstrates that LtßR–hIg can reduce demyelination in a model without T-cell involvement.


Figure 5
View larger version (52K):
[in this window]
[in a new window]

 
Figure 5. Therapeutic inhibition of LtßR significantly delays demyelination. A, C57BL/6 mice were treated with 0.2% cuprizone for 3.5 weeks. Mice received weekly injections (indicated by small arrows) of either LtßR–hIg or control human Ig beginning at day –1 of cuprizone treatment. B, Significant differences in demyelination were observed between LtßR–hIg-treated and control human Ig-treated mice after 3.5 weeks of cuprizone treatment (p < 0.02). LFB–PAS-stained paraffin sections were graded on a scale of 0 (normal myelination) to 3 (complete demyelination) by three double-blinded investigators. Each circle represents an individual mouse: open circles, control human Ig-treated mice; filled circles, LtßR–hIg-treated mice. Horizontal lines indicate the median score of each group. C, Representative LFB–PAS pictures at 3.5 weeks of treatment demonstrate the delay in demyelination in control human Ig-treated mice (i) compared with LtßR–hIg-treated mice (ii). High-magnification images of the corpus callosum of control human Ig-treated mice (iii) and LtßR–hIg-treated mice (iv) demonstrate the lack of myelinated fibers and increased inflammation in control human Ig-treated mice during demyelination. Immunohistochemistry for MBP confirmed the presence of more myelinated fibers in LtßR–hIg-treated mice (vi) compared with control human Ig-treated mice (v).

 
Inhibition of LtßR enhances remyelination
Because our goal is to enhance the development of a therapeutic treatment for demyelinating disease, we investigated the ability of LtßR–Ig to alter the extent of remyelination after significant demyelination had already occurred. To investigate the role of LtßR in the process of remyelination, C57BL/6 mice were treated with cuprizone for 6 weeks. This period of cuprizone treatment reproducibly results in complete demyelination in all mice studied to date, including the wild-type C57BL/6 mice (Arnett et al., 2001Go; Plant et al., 2005Go). Because of the concern that human Fc might elicit an immune response in this prolonged experiment, a fusion protein consisting of LtßR–mIg was used in these studies. After 5 weeks plus 2 d of cuprizone treatment and weekly thereafter, mice were injected intraperitoneally with either LtßR–mIg or control mouse IgG-1. Cuprizone treatment was halted at the 6 week time point, and mice were returned to normal chow (Fig. 6A). Mice were killed after 10 weeks, and LFB-stained sections were analyzed as described above. Remarkably, mice treated with LtßR–mIg showed significantly enhanced remyelination (p < 0.007) relative to mice treated with the control mouse Ig as measured by LFB staining (Fig. 6B,Ci–Civ). Additionally, immunohistochemistry for MBP confirmed increased remyelination in mice treated with LtßR–mIg compared with control mouse Ig-treated mice (Fig. 6Cv,Cvi). The number of mature oligodendrocytes within the corpus callosum at 10 weeks was also quantitated. GST{pi}-positive oligodendrocytes were modestly more prevalent in the corpus callosum of LtßR–mIg-treated mice compared with control mouse Ig-treated mice, and this difference is statistically significant (p < 0.04) (Fig. 6Cvii,Cviii). In conclusion, remyelination in cuprizone-treated mice was significantly enhanced by posttreatment with an inhibitor of LtßR signaling.


Figure 6
View larger version (56K):
[in this window]
[in a new window]

 
Figure 6. Therapeutic inhibition of LtßR significantly enhances remyelination in a posttreatment paradigm. A, C57BL/6 mice were treated with 0.2% cuprizone for 6 weeks and allowed to remyelinate for 4 weeks before they were killed. Mice received weekly injections of either LtßR–mIg or control mouse Ig beginning 5 weeks plus 2 d after the start of cuprizone treatment (the approximate height of demyelination), as indicated by small arrows. B, Remyelination was enhanced on inhibition of LtßR signaling. LFB–PAS-stained paraffin sections were graded on a scale of 0 (normal myelination) to 3 (complete demyelination) by three double-blinded investigators. Each circle represents an individual mouse: open circles, control mouse Ig-treated mice; filled circles, LtßR–mIg-treated mice. Horizontal lines indicate the median score of each group. Significant enhancement of remyelination was observed in LtßR–mIg-treated mice compared with mice treated with control mouse Ig (p < 0.007). C, Representative LFB–PAS pictures at 10 weeks demonstrate the enhanced remyelination in LtßR–mIg-treated mice (ii) compared with control mouse Ig-treated mice (i). High-magnification images of the corpus callosum of LtßR–mIg-treated (iv) and control mouse Ig-treated (iii) mice demonstrate the lack of myelinated fibers and greater inflammation in control mouse Ig-treated mice during remyelination. Immunohistochemistry for MBP confirmed enhanced remyelination in LtßR–mIg-treated mice (vi) compared with control mouse Ig-treated mice (v). Representative GST{pi}-immunostained images of the corpus callosum demonstrating more oligodendrocytes in mice treated with LtßR–mIg inhibitor (viii) than mice treated with the control mouse Ig (vii).

 

    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
The results of our study demonstrate an exacerbatory role for LtßR in cuprizone-induced oligodendrocyte death and demyelination. Furthermore, they show a beneficial role of inhibitory LtßR–Ig proteins in both the demyelination and remyelination phases of this model. Initially, our comparison of LtßR–/– and wild-type mice demonstrates a strong exacerbatory role for LtßR during the demyelination phase, suggesting LtßR as a possible therapeutic target for treating demyelinating disorders. However, the moderate delay observed in LtßR–/– mice during remyelination raised concerns regarding the potential efficacy of using LtßR inhibitors to treat such disorders. Because of the severe developmental abnormalities in LtßR–/– mice, it was necessary to directly analyze LtßR inhibition in mice with an otherwise functional immune system and without the developmental abnormalities seen in LtßR–/– mice. The most important result of this study is the significant delay in demyelination and acceleration of remyelination induced by LtßR–Ig treatment of wild-type mice. The latter was observed in a posttreatment paradigm (Fig. 6). Despite the fact that mice exhibited complete demyelination at the initiation of posttreatment, LtßR–mIg significantly enhanced remyelination relative to treatment with control mouse Ig.

We recently reported that the presence of Lt{alpha} exacerbated demyelination induced by cuprizone treatment (Plant et al., 2005Go). We further showed that the lack of Lt{alpha} did not alter the course of remyelination or the proliferation of oligodendrocyte progenitors during the remyelination phase of the cuprizone model. Lt{alpha} can function as a homotrimeric molecule signaling through the TNF receptors, as well as a heterotrimeric molecule with Ltß to signal through the LtßR. The role of TNF receptors in the cuprizone model has been analyzed previously (Arnett et al., 2001Go), but the role of LtßR in this model was unknown before this study.

Studies to assess the role of LtßR in normal or pathological states involving the CNS are limited. Using the Theilers murine encephalomyelitis virus model of demyelination, it has been shown that Lt{alpha} and LtßR are important for viral clearance and the prevention of demyelination within the CNS, but this role is primarily mediated by functional cytotoxic T cells, which require Lt{alpha} and LtßR for their development (Lin et al., 2003Go). Specific LtßR pathway inhibitors administered in the EAE model revealed a detrimental role of Lt{alpha}ß–LtßR signaling in demyelination, although the major cellular players in this model are also T cells (Gommerman et al., 2003Go).

In contrast to the above-mentioned disease models, cuprizone-induced demyelination is not a T-cell-mediated event. T cells are not prevalent during cuprizone-induced demyelination, and the onset of demyelination and remyelination is similar in recombination activating gene RAG-1–/– mice that lack T and B cells (Arnett et al., 2001Go; Matsushima and Morell, 2001Go). Although the CD4+ T-cell-mediated EAE models have provided significant insight, they have not always had predictive value for MS therapies. Furthermore, there is evidence to suggest that MS is not strictly a CD4+ Th1-mediated disease (Lassmann and Ransohoff, 2004Go), and some demyelinating lesions can be found in the brain that do not coincide with T-cell infiltration but are marked by glial infiltrates (Lucchinetti et al., 2000Go; Peterson et al., 2001Go; Barnett and Prineas, 2004Go). The demyelinating lesions in the cuprizone model of demyelination are also characterized by massive microglia/macrophage and astrocyte infiltrates without evidence of T cells and thus effectively mimic this subtype of MS lesion. Strikingly, in this report we also find LtßR upregulation primarily in the corpus callosum in which massive inflammation and demyelination is consistently observed (Fig. 1B). By in situ hybridization, LtßR was localized to areas enriched for activated microglia/macrophages (Fig. 1C), although some expression is also found in astroglial-enriched regions, suggesting that LtßR on glial cells actively participates in inflammation and demyelination during cuprizone treatment. The fact that mice lacking functional LtßR show delayed onset of demyelination reinforces this possibility.

In a previous publication, we used an antibody against Lt{alpha} to unequivocally demonstrate Lt{alpha} expression by astrocytes in the inflamed corpus callosum of cuprizone-treated mice (Plant et al., 2005Go). This result coupled with the present finding that microglia are a major source of LtßR expression suggests that Lt{alpha}ß–LtßR signaling between astrocytes and microglia is a primary mediator in the inflammatory demyelinating process that occurs during cuprizone treatment. In addition to Lt{alpha}ß, LtßR interacts with the membrane-bound ligand LIGHT. LIGHT has been studied to a lesser extent but appears to be localized primarily to T cells, immature dendritic cells, granulocytes, and monocytes (Gommerman and Browning, 2003Go). We show that LIGHT is present at very low to undetectable levels in the brain, and its expression level is not altered by the presence of LtßR or by cuprizone treatment (Fig. 2). These data suggest a scenario in which the Lt{alpha} produced by activated astrocytes binds and activates LtßR on microglia/macrophages. Because Lt{alpha} is known to signal through LtßR in a heterotrimeric membrane-bound complex with Ltß and not in the soluble Lt{alpha} form (Ware et al., 1995Go), this interaction likely requires cell-to-cell contact at the site of inflammation and demyelination. The present study indicates that glial-derived Lt{alpha}ß–LtßR signaling plays an important role in the demyelination process. Considering the large numbers of microglia and astrocytes that infiltrate the corpus callosum from 3–6 weeks of cuprizone treatment, this cell–cell interaction is highly plausible (Hiremath et al., 1998Go; Matsushima and Morell, 2001Go).

Our data obtained in LtßR–/– mice indicate that LtßR has a significant exacerbatory effect on demyelination and a potentially modest beneficial effect during remyelination. This result is similar to our previous findings using Lt{alpha}–/– mice with respect to demyelination, but Lt{alpha}–/– mice remyelinated normally (Plant et al., 2005Go). There is evidence that mice lacking LtßR from birth have significant developmental abnormalities; LtßR–/– mice lack mesenteric lymph nodes, Peyer's patches, and colon-associated lymphoid tissues. In addition, T- and B-cell segregation is lost, follicular dendritic cell networks are not defined in the spleen, and antibody affinity maturation is defective (Futterer et al., 1998Go). It is known that LtßR exerts control over chemokine and cytokine synthesis (Chin et al., 2003Go), although the full impact on the CNS is not known. Furthermore, natural killer cells in LtßR–/– mice do not have surface expression of the NK1.1 receptor attributable to the proximity of the encoding gene and the Ltbr gene (Wu et al., 2001Go). For these reasons, it is possible that our results with LtßR–/– mice do not accurately reflect the true role of LtßR in inflammation and demyelination attributable to the developmental abnormalities found in LtßR–/– mice.

LtßR–Ig inhibitors have been successful in reducing disease severity in the EAE model of demyelination (Gommerman et al., 2003Go). The same inhibitory fusion Igs were used in conjunction with the cuprizone model here to analyze the effect of functional LtßR inhibition in wild-type C57BL/6 mice. Compared with human Ig protein-treated mice, LtßR–hIg-treated mice exhibited a significant delay in demyelination after 3.5 weeks of cuprizone treatment (Fig. 5B,C), providing support for the Gommerman et al. study (2003)Go. Variations observed between wild-type mice in these studies are within the normal range for the cuprizone model (Figs. 3, 5, 6), and, for this reason, wild-type animals are included in each experiment. However, this study was undertaken using an EAE model, and it was postulated that the effects of LtßR–Ig were mediated primarily by its action on T cells. Because cuprizone is not a T-cell-mediated model, our study represents the first evidence that LtßR inhibition effects pathology other than that induced by T cells. The role of LtßR in remyelination had not been analyzed before this study. Mice treated with LtßR–mIg showed an increased number of GST{pi}+ oligodendrocytes in the corpus callosum and were able to remyelinate more efficiently as determined by LFB and MBP staining (Fig. 6B,C). Thus, by inhibiting Lt{alpha}–LtßR signaling, both proliferation and maturation of oligodendrocyte progenitor cells were enhanced. The mechanism of action of LtßR–Ig is unclear but deserving of in depth analysis because it may unveil important regulatory events that lead to remyelination.

In conclusion, we hypothesize that LtßR on glial cells, likely through direct interaction with membrane Lt{alpha}ß heterotrimers on astrocytes, contribute to exacerbated demyelination and impede remyelination. This study bodes well for the use of LtßR–Ig as a candidate biological therapy in demyelinating disorders, because inhibition has dual beneficial outcomes, both delaying demyelination and promoting remyelination. This provides a substantial rationale to explore LtßR inhibitors for treating demyelinating disorders. The pharmacologic inhibition of TNF{alpha}, which once was believed to be strictly proinflammatory, was detrimental to MS patients and resulted in symptom exacerbation (van Oosten et al., 1996Go; The Lenercept Multiple Sclerosis Study Group and The University of British Columbia MS/MRI Analysis Group, 1999Go; Arnett et al., 2001Go). Since the realization that TNF{alpha} has dual roles, being both detrimental during demyelination but required for oligodendrocyte progenitor proliferation and remyelination (Liu et al., 1998Go; Arnett et al., 2001Go; Kassiotis and Kollias, 2001Go), the results of the clinical studies are easier to interpret. In contrast, we find that inhibition of Lt{alpha}ß–LtßR signaling is beneficial during both demyelination and remyelination, thus making lymphotoxin inhibitors better candidate biological therapies for the control of inflammatory demyelinating disorders.


    Footnotes
 
Received July 24, 2006; revised June 1, 2007; accepted June 4, 2007.

*S.R.P. and H.A.I. contributed equally to this work. Back

S. R. Plant's present address: Division of Neurology, Duke University Medical Center, Duke University, Durham, NC 27710.

H. A. Arnett's present address: Department of Inflammation, Amgen, Seattle, WA 98119.

This work was supported by National Institutes of Health Grants NS34190 (J.P.-Y.T.), NS39508 (M.J.C.), NS045735 (M.J.C.), and DK58891 (Y.-X.F.) and National Multiple Sclerosis Society Grant RG1785 (J.P.-Y.T.). H.A.I. is a fellow of the National Multiple Sclerosis Society (Grant FG1605A). B.P.O. is a fellow of the Irvington Institute for Immunological Research. We thank Jeff Browning and Biogen Idec (Cambridge, MA) for generously supplying LtßR–human IgG-1 Fc, LtßR–mouse IgG-1 Fc, and matched controls human Ig and MOPC-21, as well as providing a critical review of this manuscript.

Correspondence should be addressed to Dr. Jenny P.-Y. Ting, Lineberger Comprehensive Cancer Center, Campus Box 7295, University of North Carolina, Chapel Hill, NC 27599. Email: panyun{at}med.unc.edu

Copyright © 2007 Society for Neuroscience 0270-6474/07/277429-09$15.00/0


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

Arnett HA, Mason J, Marino M, Suzuki K, Matsushima GK, Ting JP (2001) TNF alpha promotes proliferation of oligodendrocyte progenitors and remyelination. Nat Neurosci 4:1116–1122.[CrossRef][Web of Science][Medline]

Arnett HA, Hellendall RP, Matsushima GK, Suzuki K, Laubach VE, Sherman P, Ting JP (2002) The protective role of nitric oxide in a neurotoxicant-induced demyelinating model. J Immunol 168:427–433.[Abstract/Free Full Text]

Arnett HA, Wang Y, Matsushima GK, Suzuki K, Ting JP (2003) Functional genomic analysis of remyelination reveals importance of inflammation in oligodendrocyte regeneration. J Neurosci 23:9824–9832.[Abstract/Free Full Text]

Barnett MH, Prineas JW (2004) Relapsing and remitting multiple sclerosis: pathology of the newly forming lesion. Ann Neurol 55:458–468.[CrossRef][Web of Science][Medline]

Baud V, Karin M (2001) Signal transduction by tumor necrosis factor and its relatives. Trends Cell Biol 11:372–377.[CrossRef][Web of Science][Medline]

Chin R, Wang J, Fu YX (2003) Lymphoid microenvironment in the gut for immunoglobulin A and inflammation. Immunol Rev 195:190–201.[CrossRef][Web of Science][Medline]

Crowe PD, VanArsdale TL, Walter BN, Ware CF, Hession C, Ehrenfels B, Browning JL, Din WS, Goodwin RG, Smith CA (1994) A lymphotoxin-beta-specific receptor. Science 264:707–710.[Abstract/Free Full Text]

Dejardin E, Droin NM, Delhase M, Haas E, Cao Y, Makris C, Li ZW, Karin M, Ware CF, Green DR (2002) The lymphotoxin-beta receptor induces different patterns of gene expression via two NF-kappaB pathways. Immunity 17:525–535.[CrossRef][Web of Science][Medline]

Dempsey PW, Doyle SE, He JQ, Cheng G (2003) The signaling adaptors and pathways activated by TNF superfamily. Cytokine Growth Factor Rev 14:193–209.[CrossRef][Web of Science][Medline]

Futterer A, Mink K, Luz A, Kosco-Vilbois MH, Pfeffer K (1998) The lymphotoxin beta receptor controls organogenesis and affinity maturation in peripheral lymphoid tissues. Immunity 9:59–70.[CrossRef][Web of Science][Medline]

Gommerman JL, Browning JL (2003) Lymphotoxin/light, lymphoid microenvironments and autoimmune disease. Nat Rev Immunol 3:642–655.[CrossRef][Web of Science][Medline]

Gommerman JL, Giza K, Perper S, Sizing I, Ngam-Ek A, Nickerson-Nutter C, Browning JL (2003) A role for surface lymphotoxin in experimental autoimmune encephalomyelitis independent of LIGHT. J Clin Invest 112:755–767.[CrossRef][Web of Science][Medline]

Granger SW, Ware CF (2001) Turning on LIGHT. J Clin Invest 108:1741–1742.[CrossRef][Web of Science][Medline]

Hiremath MM, Saito Y, Knapp GW, Ting JP, Suzuki K, Matsushima GK (1998) Microglial/macrophage accumulation during cuprizone-induced demyelination in C57BL/6 mice. J Neuroimmunol 92:38–49.[CrossRef][Web of Science][Medline]

Kassiotis G, Kollias G (2001) Uncoupling the proinflammatory from the immunosuppressive properties of tumor necrosis factor (TNF) at the p55 TNF receptor level: implications for pathogenesis and therapy of autoimmune demyelination. J Exp Med 193:427–434.[Abstract/Free Full Text]

Korner H, Lemckert FA, Chaudhri G, Etteldorf S, Sedgwick JD (1997) Tumor necrosis factor blockade in actively induced experimental autoimmune encephalomyelitis prevents clinical disease despite activated T cell infiltration to the central nervous system. Eur J Immunol 27:1973–1981.[Web of Science][Medline]

Lassmann H, Ransohoff RM (2004) The CD4-Th1 model for multiple sclerosis: a crucial re-appraisal. Trends Immunol 25:132–137.[CrossRef][Web of Science][Medline]

Lin X, Ma X, Rodriguez M, Feng X, Zoecklein L, Fu YX, Roos RP (2003) Membrane lymphotoxin is required for resistance to Theiler's virus infection. Int Immunol 15:955–962.[Abstract/Free Full Text]

Liu J, Marino MW, Wong G, Grail D, Dunn A, Bettadapura J, Slavin AJ, Old L, Bernard CC (1998) TNF is a potent anti-inflammatory cytokine in autoimmune-mediated demyelination. Nat Med 4:78–83.[CrossRef][Web of Science][Medline]

Locksley RM, Killeen N, Lenardo MJ (2001) The TNF and TNF receptor superfamilies: integrating mammalian biology. Cell 104:487–501.[CrossRef][Web of Science][Medline]

Lucchinetti C, Bruck W, Parisi J, Scheithauer B, Rodriguez M, Lassmann H (2000) Heterogeneity of multiple sclerosis lesions: implications for the pathogenesis of demyelination. Ann Neurol 47:707–717.[CrossRef][Web of Science][Medline]

Mason JL, Jones JJ, Taniike M, Morell P, Suzuki K, Matsushima GK (2000) Mature oligodendrocyte apoptosis precedes IGF-1 production and oligodendrocyte progenitor accumulation and differentiation during demyelination/remyelination. J Neurosci Res 61:251–262.[CrossRef][Web of Science][Medline]

Matsushima GK, Morell P (2001) The neurotoxicant, cuprizone, as a model to study demyelination and remyelination in the central nervous system. Brain Pathol 11:107–116.[Web of Science][Medline]

Peterson JW, Bo L, Mork S, Chang A, Trapp BD (2001) Transected neurites, apoptotic neurons, and reduced inflammation in cortical multiple sclerosis lesions. Ann Neurol 50:389–400.[CrossRef][Web of Science][Medline]

Plant S, Arnett H, Ting J (2005) Astroglial-derived lymphotoxin-alpha exacerbates inflammation and demyelination, but not remyelination. Glia 49:1–14.[CrossRef][Web of Science][Medline]

Probert L, Eugster HP, Akassoglou K, Bauer J, Frei K, Lassmann H, Fontana A (2000) TNFR1 signalling is critical for the development of demyelination and the limitation of T-cell responses during immune-mediated CNS disease. Brain 123:2005–2019.[Abstract/Free Full Text]

Raine CS, Bonetti B, Cannella B (1998) Multiple sclerosis: expression of molecules of the tumor necrosis factor ligand and receptor families in relationship to the demyelinated plaque. Rev Neurol (Paris) 154:577–585.[Medline]

Robinson WH, Genovese MC, Moreland LW (2001) Demyelinating and neurologic events reported in association with tumor necrosis factor alpha antagonism: by what mechanisms could tumor necrosis factor alpha antagonists improve rheumatoid arthritis but exacerbate multiple sclerosis? Arthritis Rheum 44:1977–1983.[CrossRef][Web of Science][Medline]

Ruddle NH, Bergman CM, McGrath KM, Lingenheld EG, Grunnet ML, Padula SJ, Clark RB (1990) An antibody to lymphotoxin and tumor necrosis factor prevents transfer of experimental allergic encephalomyelitis. J Exp Med 172:1193–1200.[Abstract/Free Full Text]

Schmid CD, Sautkulis LN, Danielson PE, Cooper J, Hasel KW, Hilbush BS, Sutcliffe JG, Carson MJ (2002) Heterogeneous expression of the triggering receptor expressed on myeloid cells-2 on adult murine microglia. J Neurochem 83:1309–1320.[CrossRef][Web of Science][Medline]

Sicotte NL, Voskuhl RR (2001) Onset of multiple sclerosis associated with anti-TNF therapy. Neurology 57:1885–1888.[Abstract/Free Full Text]

Tansey FA, Cammer W (1991) A pi form of glutathione-S-transferase is a myelin- and oligodendrocyte-associated enzyme in mouse brain. J Neurochem 57:95–102.[CrossRef][Web of Science][Medline]

The Lenercept Multiple Sclerosis Study Group and The University of British Columbia MS/MRI Analysis Group (1999) TNF neutralization in MS: results of a randomized, placebo-controlled multicenter study. Neurology 53:457–465.[Abstract/Free Full Text]

van Oosten BW, Barkhof F, Truyen L, Boringa JB, Bertelsmann FW, von Blomberg BM, Woody JN, Hartung HP, Polman CH (1996) Increased MRI activity and immune activation in two multiple sclerosis patients treated with the monoclonal anti-tumor necrosis factor antibody cA2. Neurology 47:1531–1534.[Abstract/Free Full Text]

Ware CF, VanArsdale TL, Crowe PD, Browning JL (1995) The ligands and receptors of the lymphotoxin system. Curr Top Microbiol Immunol 198:175–218.[Medline]

Wu Q, Sun Y, Wang J, Lin X, Wang Y, Pegg LE, Futterer A, Pfeffer K, Fu YX (2001) Signal via lymphotoxin-beta R on bone marrow stromal cells is required for an early checkpoint of NK cell development. J Immunol 166:1684–1689.[Abstract/Free Full Text]

Zhang G (2004) Tumor necrosis factor family ligand-receptor binding. Curr Opin Struct Biol 14:154–160.[CrossRef][Web of Science][Medline]


This article has been cited by other articles:


Home page
BrainHome page
M. Dubois-Dalcq, A. Williams, C. Stadelmann, B. Stankoff, B. Zalc, and C. Lubetzki
From fish to man: understanding endogenous remyelination in central nervous system demyelinating diseases
Brain, July 1, 2008; 131(7): 1686 - 1700.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Supplemental Data
Right arrow Submit an eLetter
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Web of Science (2)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Plant, S. R.
Right arrow Articles by Ting, J. P.-Y.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Plant, S. R.
Right arrow Articles by Ting, J. P.-Y.

-
-

Home  |   Search  |   Archive  |   Subscribe  |   Contact  |   Help

-
Copyright 2009 by Society for Neuroscience ONLINE ISSN: 1529-2401
-