Abstract
Guanylate cyclase activating protein 2 (GCAP2) is a recoverin-like Ca2+-sensor protein known to modulate guanylate cyclase activity in photoreceptor outer segments. GCAP2 is also present in photoreceptor ribbon synapses where its function is unknown. Synaptic ribbons are active zone-associated presynaptic structures in the tonically active photoreceptor ribbon synapses and contain RIBEYE as a unique and major protein component. In the present study, we demonstrate by various independent approaches that GCAP2 specifically interacts with RIBEYE in photoreceptor synapses. We show that the flexible hinge 2 linker region of RIBEYE(B) domain that connects the nicotinamide adenine dinucleotide (NADH)-binding subdomain with the substrate-binding subdomain (SBD) binds to the C terminus of GCAP2. We demonstrate that the RIBEYE–GCAP2 interaction is induced by the binding of NADH to RIBEYE. RIBEYE–GCAP2 interaction is modulated by the SBD. GCAP2 is strongly expressed in synaptic terminals of light-adapted photoreceptors where GCAP2 is found close to synaptic ribbons as judged by confocal microscopy and proximity ligation assays. Virus-mediated overexpression of GCAP2 in photoreceptor synaptic terminals leads to a reduction in the number of synaptic ribbons. Therefore, GCAP2 is a prime candidate for mediating Ca2+-dependent dynamic changes of synaptic ribbons in photoreceptor synapses.
Introduction
The guanylate cyclase activating protein 2 (GCAP2) is a recoverin-like neuronal Ca2+-sensor protein highly expressed in photoreceptors (for review, see Koch et al., 2002; Palczewski et al., 2004). Three members of the GCAP family (GCAP1, GCAP2, and GCAP3) are known in the mammalian retina: GCAP1 and GCAP2 are expressed both in rod and cone photoreceptors, whereas GCAP3 is found exclusively in cone photoreceptors (Imanishi et al., 2002). GCAP2 contains four EF-hands from which the first EF-hand is nonfunctional. GCAP2 contains an N-terminal myristoylation signal and is myristoylated in situ (Olshevskaya et al., 1997). GCAP2 is well known to modulate the activity of photoreceptor guanylate cyclases in a Ca2+-dependent manner (for review, see Koch et al., 2002). GCAPs are not restricted to outer and inner segments of photoreceptors but are also present in the presynaptic terminals (Otto-Bruc et al., 1997; Duda et al., 2002, Pennesi et al., 2003; Makino et al., 2008). The significance of GCAP2 in the presynaptic terminals is unknown.
Photoreceptor synapses are ribbon-type synapses (for review, see Heidelberger et al., 2005; Sterling and Matthews, 2005; tom Dieck and Brandstätter, 2006). These synapses are tonically active and reliably transmit a broad range of stimulus intensities. Morphologically, ribbon synapses are characterized by the presence of large presynaptic structures, the synaptic ribbons. Synaptic ribbons are anchored in the active zone complex and are associated with numerous synaptic vesicles and also other membranes (for review, see Heidelberger et al., 2005; Sterling and Matthews, 2005; tom Dieck and Brandstätter, 2006). The protein RIBEYE is the major component of synaptic ribbons (Schmitz et al., 2000; Zenisek et al., 2004; Wan et al., 2005; Magupalli et al., 2008). RIBEYE consists of a unique A domain and a B domain that is mostly identical to the protein C-terminal-binding protein 2 (CtBP2) (Schmitz et al., 2000). RIBEYE(B) domain binds nicotinamide adenine dinucleotide (NADH) with high affinity (Schmitz et al., 2000). RIBEYE(B) domain/CtBP2 is highly related to CtBP1 (for review, see Chinnadurai, 2002). The crystal structure of a truncated CtBP1 (tCtBP1) that lacks the hydrophobic C-terminal region (CTR) and a small N-terminal stretch has been resolved (Kumar et al., 2002; Nardini et al., 2003). CtBP proteins (including RIBEYE) belong to a family of d-isomer-specific 2-hydroxyacid dehydrogenases (for review, see Chinnadurai, 2002). Structural analyses of this class of proteins demonstrated the presence of two distinct subdomains: a central NADH-binding subdomain (NBD) and the bipartite substrate-binding subdomain (SBD) (Kumar et al., 2002; Nardini et al., 2003). SBD and NBD are connected by two flexible hinge regions, hinge 1 and hinge 2. Hinge 1 connects the N-terminal portion of the SBD (SBDa) with the NBD; hinge 2 connects the NBD with the C-terminal portion of the SBD (SBDb) (for review, see Chinnadurai, 2002). After NADH binding, NBD and SBD move relative to each other and adopt a “closed” conformation (Lamzin et al., 1994; Nardini et al., 2003).
Ca2+- and illumination-dependent synaptic ribbon dynamics have been described previously (Spiwoks-Becker et al., 2004). However, the underlying mechanism is unclear. We identified GCAP2 as a RIBEYE-interacting protein that could mediate Ca2+-dependent synaptic ribbon dynamics.
Materials and Methods
Materials
Plasmids
Details on all plasmids used in the present study are posted in the supplemental material (available at www.jneurosci.org).
Bacterial strains
The Escherichia coli DH10B genotype is F-mcrA Δ(mrr-hsdRMS-mcrBC) Φ80lacZΔM15 ΔlacX74 recA1 endA1 araD139 Δ(ara, leu)7697 galU galKλ-rpsL nupG. The E. coli BL21(DE 3) genotype is [F− ompT hsdSB(rB−mB−) gal dcm (DE3)].
Antibodies
A polyclonal antibody against full-length bovine GCAP2-fusion protein was generated in rabbits by using purified, bacterially expressed glutathione-S-transferase (GST)-tagged full-length bovine GCAP2(amino acids 1-204) as antigen. The sixth immune bleed (obtained 90 d after initial immunization) was used in the present experiments. A mouse monoclonal antibody against human GCAP2 that reacts with bovine GCAP2 but not with bovine GCAP1 (supplemental Fig. 3F, available at www.jneurosci.org as supplemental material) was purchased from Santa Cruz Biotechnology (clone A1, sc-59543). Two antibodies against RIBEYE were used in the present study: one rabbit polyclonal antibody (U2656) (Schmitz et al., 2000) and one monoclonal antibody against RIBEYE(B) domain/CtBP2 (BD Transduction Laboratories) (Alpadi et al., 2008). Additional antibodies used in the present study are mouse monoclonal anti-GST (Sigma) and mouse monoclonal anti-maltose-binding protein (anti-MBP; New England Biolabs). More details on the antibodies used are given in Table 1.
Methods
Yeast-two-hybrid methods
Yeast-two-hybrid (YTH) methods (generation of electrocompetent yeasts, electroporation of yeasts, and yeast matings) were performed exactly as described previously (Alpadi et al., 2008; Magupalli et al., 2008).
Fusion protein expression and purification
Fusion protein was expressed in BL21(DE3) as described previously (Schmitz et al., 2000; Magupalli et al., 2008; Alpadi et al., 2008).
Fusion protein pull-down experiments
Fusion protein pull-down experiments were performed as described previously (Alpadi et al., 2008; Magupalli et al., 2008). For fusion protein pull-down experiments, purified GST-tagged proteins (GST-GCAP2 and GST) were used as immobilized bait proteins, and eluted MBP-tagged proteins [RIBEYE(B)-MBP and MBP alone] as soluble prey proteins. GST and MBP alone served as control proteins. In the pull-down assays, all fusion proteins were used at an equimolar concentration of ∼0.8 μm in a volume of 500 μl incubation buffer containing 100 mm Tris, pH 8.0, 150 mm NaCl, 1 mm EDTA, 0.25% (w/v) Triton X-100 (Tx-100), and 1 mm β-mercaptoethanol (βME) if not denoted otherwise. After a 5–6 h incubation at 4°C, samples were washed by repeated centrifugation of the beads (3000 rpm, 2 min, 4°C) and subsequent resuspension with PBS. This procedure was repeated three times. Afterward, the final pellets were boiled with SDS-sample buffer (96°C, 5 min) and subjected to SDS-PAGE.
Preabsorption experiments
Preabsorption for Western blotting.
Fifty microliters of GCAP2 immune serum (sixth immune serum) were added to GST-GCAP2 (20 μg) and GST (20 μg) fusion protein bound to beads in a final volume of ∼75 μl and incubated overnight at 4°C in an overhead rotator. After incubation, samples were centrifuged at 13,000 rpm for 3 min at 4°C and the respective supernatants were taken for the subsequent experiments. For Western blot analyses of the bovine retina extract, the two preabsorbed antisera described above were used at a dilution of 1:1000 in blocking buffer (5% skim milk powder in PBS).
Preabsorption for immunofluorescence.
Preabsorption with fusion protein for immunofluorescence microscopy was done as described above for Western blotting. The preabsorbed antisera (preabsorbed either with GST or GCAP2-GST) were subsequently tested at identical dilutions for immunolabeling on cryostat sections of the bovine retina.
Coimmunoprecipitation analyses using extracts from the bovine retina
Experiments were performed mostly as described previously (Alpadi et al., 2008). In brief, for each assay, one freshly isolated bovine retina was incubated in 1 ml lysis buffer, containing 100 mm Tris-HCl, pH 8.0, 150 mm NaCl, 1 mm EDTA, and 1% Tx-100 for 45 min on ice. The sample was mechanically cracked by forcefully ejecting the retinal lysate through a 20 gauge needle. This procedure was repeated 10 times. After lysis, the extract was centrifuged at 13,000 rpm (Biofuge Fresco; Heraeus; #3329 rotor) for 30 min at 4°C. This centrifugation step was repeated once. Afterward, the lysate (see Fig. 4, “bovine retina lysate”) was precleared by the addition of 15 μl of preimmune serum and 20 μl of washed protein A-Sepharose beads (2 h incubation at 4°C with an overhead rotator). Next, samples were centrifuged at 13,000 rpm for 30 min at 4°C. The supernatant was split in two equal volumes, for the control and experimental assays. For the control assay, 15 μl of GCAP2 or RIBEYE preimmune serum was added; for the experimental assay, 15 μl of GCAP2 or RIBEYE immune serum was added and incubated overnight at 4°C using an overhead rotator. After overnight incubation, the assays were washed thrice by repeated centrifugation (3000 rpm, 1 min, 4°C) and resuspension with 1 ml of incubation buffer. The final pellet was boiled in 20 μl sample buffer, subjected to SDS-PAGE, and analyzed by Western blotting with the indicated antibodies.
Purification of synaptic ribbons
Purification of synaptic ribbons was performed as described previously (Schmitz et al., 1996, 2000; Alpadi et al., 2008; Magupalli et al., 2008). Purified ribbons were checked for their enrichment with RIBEYE, absence for synaptophysin, and presence of a high density of horseshoe-shaped synaptic ribbons by immunofluorescence microscopy of the synaptic ribbon fractions with antibodies against RIBEYE (U2656) (supplemental Fig. 3D,E, available at www.jneurosci.org as supplemental material). Bovine eyes were obtained from a local slaughterhouse.
Immunolabeling analyses
Immunolabeling analyses of retinal sections and fractions were performed as described previously (Schmitz et al., 2000, 2006; Alpadi et al., 2008) using a Zeiss inverted Axiovert 200 M microscope equipped for conventional epifluorescence microscopy. In brief, 10-μm-thick cryostat sections were heat fixed for 10 min at 50°C and subsequently treated with 0.5% BSA for 1 h at room temperature (RT) before the primary antibodies were applied at the indicated dilutions (see also Table 1). Primary antibodies were usually applied overnight at 4°C if not indicated otherwise. After removing unbound antibody by several washes with PBS, secondary antibodies were applied at the dilutions in PBS given in Table 1 (1 h, RT). After removing unbound antibody with PBS sections were mounted in N-propyl gallate (NPG) antifade (Magupalli et al., 2008). Incubations only with secondary antibody (without primary antibody) served as negative controls. Additional details of the applied antibodies are given in Table 1. Sections were analyzed with a Zeiss Axiovert 200 M microscope equipped with an apotome and the respective filter sets (Ex BP 450–490 nm/BS FT510/EM BP 515-565; EX BP 546/12/BS FT 580/EM LP 590). Confocal sections were obtained with an LSM710 confocal laser scanning microscope (Zeiss). Images were captured using a 63× objective (1.4 numerical aperture) with the ZEN2009 software.
Double-labeling of cryostat sections of the bovine retina with GCAP2 antibodies and Peanut agglutinin
Cryosections of bovine retina were heat fixed for 10 min at 50°C and incubated with blocking buffer (containing 0.5% BSA, 0.02% Tx-100 in PBS) at RT for 45 min. Sections were then incubated with primary polyclonal GCAP2 antibody at a 1:500 dilution in blocking buffer overnight at 4°C. After brief washing with blocking buffer, sections were incubated with secondary antibody GAR-CY3 (1 h, RT). Section were next incubated with Peanut agglutinin–Alexa 488 (1:250 dilution) in blocking buffer for 3 h at RT. After washing once with PBS, sections were mounted in NPG-antifade for microscopic analysis.
Generation of recombinant Semliki Forest virus
Cell culture.
Baby hamster kidney-21 (BHK-21) cells were cultured in OPTIMEM/GlutaMax medium (Invitrogen) supplemented with 10% (v/v) tryptose phosphate broth, 20 mm HEPES, 2.5% FCS at 37°C, 5% CO2, and used between passage numbers 5 to 25.
Generation of recombinant SFV particles.
The Semliki forest (SLF) virus expression vector GCAP2-EGFPpSFV was constructed in three steps. First, PCR was used to generate a BglII-BamHI-flanked enhanced green fluorescent protein (EGFP) fragment using the following forward and reverse primers: 5′-TTTAGATCTGCCACCATGGTGAGCAAGGGCGA (forward) and 5′-TTTGGATCCCTTGTACAGCTCGTCCAT (reverse) for ligation into the BamHI site of the pSFV1 expression vector. Next, a BamHI-BssHII-flanking GCAP2 insert was amplified by PCR (5′-TTTTGGATCCATGGGGCAGCAGTTCAGC, forward primer; 5′- TTTTGCGCGCTCAGAACATGGCACTTTTCC, reverse primer) using GCAP2(amino acids 1-204)pGEX as a template. The PCR product was cloned into the BamHI-BssHII site of EGFPpSFV (Ashery et al., 1999). The internal ribosomal entry site of pSFV was deleted by digestion with BssHII-ClaI, fill in with Klenow, and religation of the vector. EGFPpSFV was used as control plasmid/control virus (Ashery et al., 1999). mRNA was generated from the pSFV1 expression vector (GCAP2-EGFPpSFV; EGFPpSFV) and pSFV2 helper vector by linearizing both vectors with SpeI and in vitro transcription using SP6 RNA polymerase according to the manufacturer's instructions (mMessage mMachine SP6 Kit; Ambion). Ten micrograms of purified mRNA were electroporated into 1 × 107 BHK-21 cells in OPTIMEM/GlutaMax medium without supplements at 360 V, 75 μF and pulsed twice using a Bio-Rad GenePulser II apparatus. Cells were resuspended in 10 ml of complete OPTIMEM/GlutaMax growth medium (see above, Cell culture) and plated for 24 h at 31°C, 5% CO2. Medium was recovered from the flasks and centrifuged at 400 × g for 5 min. The supernatants were aliquoted and stored at −80°C. Virus titer was determined exactly as described previously (Ashery et al., 1999).
Infection of mouse organotypic retinal cultures.
The virus-containing stock was supplemented with an equal volume of OPTIMEM/GlutaMax containing 0.2% BSA. Virus was activated by the addition of chymotrypsin (0.2 mg/ml; Sigma-Aldrich) and subsequent incubation for 40 min at room temperature. Proteolytic activation of the virus was stopped by the addition of aprotinin (0.6 mg/ml; Sigma-Aldrich). Organotypic retina cultures were incubated with the respective virus (4–5 × 107 infectious units/ml). After 16–24 h at 31°C, 5% CO2, the virus-containing medium was replaced by normal growth medium.
Organotypic culture of retinal explants
Preparation of organotypic cultures was performed mostly as described previously (Fischer et al., 2000; Pérez-León et al., 2003; Zhang et al., 2008), with some modifications. Briefly, freshly isolated eyes enucleated from adult mice housed under ambient light conditions were immediately immersed into ice-cold RPMI 1640 (supplemented with 10% fetal calf serum, 10 mm HEPES, 2 mm l-glutamine, 1 mm sodium pyruvate, 50 μm βME, 100 U/ml penicillin, and100 μg/ml streptomycin). The anterior portion of the eye was removed by incision along the ora serrata. After removal of lens and vitreous body, the optic nerve was cut and the retina subsequently gently removed from the posterior eyecup. The retina was mounted photoreceptor side down on polyethylene terephthalate cell culture inserts (8.0 μm pore size; Falcon) placed in six-well plates containing 1 ml of RPMI 1640 with the above described supplements. Explants were incubated for 1 h at 31°C, 5%CO2, and then infected with recombinant Semliki Forest virus. For infection with recombinant Semliki Forest virus, RPMI 1640 medium was replaced by 1 ml of the activated virus solution (see above; virus titer typically between 4–5 × 107 infectious units per ml) and incubated overnight at 31°C, 5% CO2. After 16–24 h of infection, the virus-containing medium was removed from the cell culture dishes by three washes with RPMI (with supplements). The explants were allowed to recover for several hours before being processed for whole-mount immunostaining.
Whole-mount immunostaining of organotypic retinal explants
One day after infection, retinal explants were fixed in 4% paraformaldehyde (PFA) for 20 min at 4°C. Explants were permeabilized for 30 min at RT in incubation buffer (PBS with 0.3% Tx-100 and 0.5% BSA) and subsequently incubated with primary antibody (U2656, 1:500 dilution in incubation buffer) overnight at 4°C. Unbound antibody was removed by intensive washing with washing buffer (PBS, 0.5% Tween-20, 0.5% BSA). Explants were then incubated with the indicated fluorophore-conjugated secondary antibody (1:1000 in incubation buffer) (Table 1) overnight at 4°C. Unbound antibody was again removed by intensive washing with washing buffer. Explants were then fixed with 4% PFA (15 min, 4°C), cut with a cryostat (10-μm-thick sections), and thawed on uncoated Superfrost coverslides. Sections were analyzed with a Zeiss Axiovert 200 M microscope equipped with an apotome and the respective filter sets (EX BP 450–490 nm/BS FT510/EM BP 515-565; EX BP 546/12/BS FT 580/EM LP 590). For counting, terminals were observed in the apotome mode.
Three-dimensional reconstruction of immunolabeled structures in retinal explants
For three-dimensional (3D) reconstructions, retina sections were observed with the Zeiss Axiovert 200 M microscope. Z-stacks were taken using the apotome and 3D-reconstruction was performed using the Inside4D software module from Zeiss.
Electron microscopy
Electron microscopy of organotypical retinas was performed as described previously (Schmitz et al., 1996, 2000; Schoch et al., 2006).
In situ proximity ligation assays
Proximity ligation assays (PLAs) are a highly sensitive and specific way to detect protein–protein interaction in situ, e.g., in tissue sections (Gustafsdottir et al., 2005; Söderberg et al., 2006, 2008). Proximity ligation reactions critically depend on the distance of the two interaction partners. Positive PLA interaction signals indicate that the interacting proteins are localized in <40 nm distance from each other (Söderberg et al., 2006). PLA components (Gustafsdottir et al., 2005) were purchased from Eurogentec and performed according to the manufacturer's instructions. The following components were purchased from Eurogentec: anti-rabbit immunoglobulins coupled to the “PLUS” oligonucleotide (PLA PLUS probe), anti-mouse immunoglobulins coupled to the PLA “MINUS” probe, and the fluorescence detection kit 563 containing the linker oligonucleotide, enzymes for rolling circle amplification, and fluorescent probe for product detection.
In brief, 10-μm-thick sections of flash-frozen mouse eyes (prepared as described above) were heat fixed for 10 min at 50°C and subsequently treated with the Duolink blocking solution supplied by the manufacturer (Olink Biosciences) for 30 min at 37°C. Next, sections were incubated with primary antibody dilutions (in Duolink antibody dilution solution; Olink Bioscience, Eurogentec). The following antibodies were used at the indicated dilutions: polyclonal rabbit GCAP2 antibody (1:500); monoclonal anti-RIBEYE(B)/CtBP2 (BD Biosciences; 1:500); polyclonal rabbit RIBEYE antibody (U2656, 1:500); mouse monoclonal antibody against opsin (Rho1D4, 1:500); polyclonal antibody against mGluR6 (Neuromics/Acris Antibodies; RA13105; 1:500). Duolink in situ PLAs were performed as described by the manufacturer: After incubation with the primary antibodies, combinations of the PLA probes (anti-rabbit PLUS probe, anti-mouse MINUS probe, both diluted 1:8 in Duolink antibody dilution buffer) were added to the sections for 2 h at 37°C in a wet chamber. After washing the sections with TBS (two times for 5 min each), hybridization with the linker oligonucleotide was performed for 15 min at 37°C. Tissue was washed for 1 min with TBS before ligation was performed for 15 min at 37°C in a humid chamber. After washes with TBS for 5 min, rolling circle amplification was done for 90 min at 37°C precisely following the manufacturer's protocol. The product of the rolling circle amplification was detected with the Duolink detection kit 563 (Olink Bioscience, purchased via Eurogentec) using Duolink fluorophore 563-labeled oligonucleotide diluted 1:5 with H2O. The detection reaction was performed for 60 min at 37°C. As negative controls, PLAs were done without primary antibodies or with only one primary antibody. Sections were subsequently washed with 2× SSC (2 min), 1× SSC (2 min), 0.2× SSC (2 min), and 0.02× SSC (1 min). Afterward, sections were mounted with Duolink mounting medium, sealed with a coverslip and analyzed by epifluorescence microscopy as described above. As an additional control to test for the spatial sensitivity/proximity requirements of the in situ PLA reactions, we also analyzed for PLA signals between a presynaptic marker (RIBEYE) and a postsynaptic marker at the tips of invaginating ON bipolar cells (mGluR6) (see Fig. 7M). As positive controls, we used a combination of the following two antibodies [rabbit polyclonal RIBEYE U2656/mouse anti-RIBEYE(B)/CtBP2] (see Fig. 7L) and mouse monoclonal anti-opsin (Rho1D4/rabbit polyclonal GCAP2) (see Fig. 7K). The antibodies that were used in the Olink PLAs are summarized as follows with their indicated working dilutions: rabbit polyclonal GCAP2 antibody (1:500); rabbit polyclonal antibody against RIBEYE U2656 (1:500); rabbit polyclonal antibody against mGluR6 (1:500); mouse monoclonal antibody against RIBEYE(B)/CtBP2; mouse monoclonal antibody against opsin (Rho1D4) (1:500). Antibody combinations were used as indicated in Figure 7.
Results
The C terminus of GCAP2 interacts with the hinge 2 region of RIBEYE(B)
In a YTH screen using RIBEYE(B) as bait construct, we identified GCAP2 as a potential interaction partner of RIBEYE (Fig. 1; supplemental Fig. 1, available at www.jneurosci.org as supplemental material). The GCAP2 prey clone we obtained started at histidine H95 of bovine GCAP2 [GCAP2(95-204)] and coded for the two C-terminal EF-hands and the CTR of GCAP2 (Fig. 1D, prey 4). The prey clone was not autoactivating as judged by the respective control matings (Fig. 1C), thus pointing to an interaction between RIBEYE and GCAP2 in the YTH system. To further consolidate these findings, we cloned full-length GCAP2 and the indicated GCAP2 constructs from bovine retinal cDNA (Fig. 1C,D) into the respective yeast vectors and tested them for interaction with RIBEYE(B) in the YTH system. The GCAP2 constructs (Fig. 1D) were designed based on the known domain structure of GCAP2 (Ames et al., 1999). All of the tested GCAP2 constructs (except for full-length GCAP2 with an intact N-terminal myristoylation signal) interacted with RIBEYE(B) (Fig. 1C,D; supplemental Fig. 1A, available at www.jneurosci.org as supplemental material). If the N-terminal myristoylation signal in full-length GCAP2 (encoded by the first N-terminal amino acids, methionine and glycine) was deleted either by point-mutating glycine 2(G2) into alanine (G2A) or by deleting the first two N-terminal amino acids, GCAP2 interacted with RIBEYE(B) in the YTH system (Fig. 1C,D; supplemental Fig. 1A,B, available at www.jneurosci.org as supplemental material). Thus, the myristoylation of GCAP2 at glycine G2 and the resulting membrane association prevent GCAP2 from entering the nucleus where the interaction needs to take place in the Gal4-based YTH system. The mapping analyses revealed that RIBEYE interacted with GCAP2 even when all EF-hands of GCAP2 were deleted by N-terminal truncations (Fig. 1C,D). The C-terminal region of GCAP2 that starts after the fourth EF-hand (abbreviated as CTR in the following text) retained the capability to interact with RIBEYE(B) in the YTH system. Therefore, we conclude that the CTR of GCAP2 mediates the interaction with RIBEYE. This assumption is further supported by our finding that point mutants of the CTR of GCAP2 no longer interacted with RIBEYE(B) (supplemental Fig. 1B, available at www.jneurosci.org as supplemental material).
To map the parts of RIBEYE(B) that are important for the interaction with GCAP2, we tested whether the SBD and NBD of RIBEYE(B) alone can interact with GCAP2. Surprisingly, both the SBD and NBD alone did not interact with GCAP2 in the YTH system (Fig. 2A,C). Since the applied NBD and SBD constructs did not contain the connecting hinge regions, hinge 1 and hinge 2, we tested next whether the hinge regions of RIBEYE(B) might mediate interaction with GCAP2. Indeed, the hinge 2 region (amino acids 856-891) of RIBEYE(B) interacted with GCAP2, whereas the hinge 1 region (amino acids 663-691) did not (Fig. 2B,D). Therefore, the flexible hinge 2 region that connects the NBD with the SBDb is the essential binding site for GCAP2 (Fig. 2B,D). This assumption is further supported by the analysis of point mutants of the hinge 2 region, i.e., RIBEYE(B)W867E and RIBEYE(B)T865S (supplemental Fig. 2A,B, available at www.jneurosci.org as supplemental material). These points mutants of the hinge 2 region of RIBEYE(B) no longer interacted with GCAP2 in the YTH system (supplemental Fig. 2A,B, available at www.jneurosci.org as supplemental material). In contrast, various point mutants on the outer face of the NBD of RIBEYE(B) (Alpadi et al., 2008; Magupalli et al., 2008) did not affect the binding of GCAP2 (supplemental Fig. 2C, available at www.jneurosci.org as supplemental material).
The interaction between RIBEYE and GCAP2 was also observed when full-length RIBEYE(AB) [instead of RIBEYE(B) alone] was used as bait in the YTH analyses (supplemental Fig. 1C, available at www.jneurosci.org as supplemental material) indicating that the A domain of RIBEYE does not prevent the interaction between RIBEYE(B) and GCAP2. RIBEYE(B) is known to homodimerize (Magupalli et al., 2008). Analyses of a RIBEYE(B)-dimerization deficient mutant, [RIBEYE(B)ΔHDL] (Magupalli et al., 2008) revealed that RIBEYE(B)– GCAP2 interaction does not require RIBEYE(B) homodimerization. RIBEYE(B)ΔHDL interacted with GCAP2 in the YTH system (supplemental Fig. 1D, available at www.jneurosci.org as supplemental material), demonstrating that GCAP2 can interact with monomeric RIBEYE(B).
Confirmation of RIBEYE–GCAP2 interaction by various independent assays
The YTH analyses demonstrated RIBEYE–GCAP2 interaction in the YTH system. To verify this interaction by additional independent approaches, we first performed fusion protein pull-down analyses (Fig. 3). GST-tagged GCAP2 was used as an immobilized bait protein. GST alone served as control protein. RIBEYE(B)-MBP or MBP alone (control protein) was used as the soluble prey protein. GST-GCAP2 (but not GST alone) pulled down RIBEYE(B)-MBP (but not MBP alone), demonstrating a specific direct physical interaction between RIBEYE(B) and GCAP2 (Fig. 3). Based on semiquantitative evaluation, GCAP2-GST pulled down at least ∼15% of total RIBEYE(B)-MBP in these experiments (supplemental Fig. 7C, available at www.jneurosci.org as supplemental material). Using quantification of the bound proteins (supplemental Fig. 7C, available at www.jneurosci.org as supplemental material), we estimate a KD of 2.72 (±0.19) × 10−6 mol/L for GCAP2–RIBEYE interaction.
To test whether RIBEYE also interacts with GCAP2 in situ, we performed coimmunoprecipitation experiments using extracts from the bovine retina. In these experiments, GCAP2 immune serum but not GCAP2 preimmune serum coimmunoprecipitated RIBEYE (Fig. 4A), again demonstrating the specificity of the interaction. Identical results were obtained when RIBEYE antibodies were used for immunoprecipitation. RIBEYE immune serum but not RIBEYE preimmune serum specifically coimmunoprecipitated GCAP2 (Fig. 4B). The coimmunoprecipitation experiments suggest that the RIBEYE– GCAP2 interaction also occurs in situ in the retina and emphasize the physiological relevance of the RIBEYE–GCAP2 interaction. This assumption is further supported by our findings that GCAP2 is also a component of purified synaptic ribbons as shown both with a polyclonal as well as with the monoclonal GCAP2 antibody (Fig. 4B, lane 4; supplemental Fig. 3A,B,F, available at www.jneurosci.org as supplemental material).
RIBEYE and GCAP2 colocalize in photoreceptor ribbon synapses of the mammalian retina
Next, we performed immunolabeling experiments with a polyclonal GCAP2 antibody raised against bacterially expressed and purified full-length bovine GCAP2 as well as with a commercial monoclonal mouse GCAP2 antibody (Figs. 5A–F, 6; Table 1; supplemental Figs. 3A–C,F, 4B, 5, 6, available at www.jneurosci.org as supplemental material). Similar to the findings from other groups (Otto-Bruc et al., 1997, Cuenca et al., 1998; Kachi et al., 1999), we observed a strong GCAP2 immunolabeling in the synaptic terminals of bovine photoreceptors in addition to a strong expression particularly in the inner segments (Fig. 5A–F; supplemental Fig. 8F, available at www.jneurosci.org as supplemental material). A strong immunolabeling of the rod presynaptic terminals was observed (Fig. 5; supplemental Fig. 5, available at www.jneurosci.org as supplemental material); the labeling of the larger cone terminals was less intense (supplemental Fig. 5, available at www.jneurosci.org as supplemental material). Double immunolabeling demonstrated that RIBEYE and GCAP2 colocalized in the presynaptic terminals of photoreceptors (Figs. 5B–E, 6). GCAP2 was found at synaptic ribbon sites (immunolabeled by RIBEYE antibodies) and close to synaptic ribbons (Figs. 5, 6). Most but not all ribbons were labeled (Fig. 5; supplemental Figs. 5, 6, available at www.jneurosci.org as supplemental material). The GCAP2 immunosignals were specific because the signal could be completely blocked by preabsorbing the polyclonal antiserum with GCAP2-GST fusion protein but not GST protein alone (supplemental Figs. 3C, 6, available at www.jneurosci.org as supplemental material). Furthermore, identical results, as described above for the polyclonal GCAP2 antibody, were obtained with a commercially available monoclonal antibody against GCAP2 (Fig. 5D,E) that does not cross-react with GCAP1 (supplemental Fig. 3F, available at www.jneurosci.org as supplemental material). The polyclonal GCAP2 antibody raised against full-length GCAP2 cross-reacts with GCAP1 (supplemental Fig. 4B, available at www.jneurosci.org as supplemental material). Therefore, we analyzed whether GCAP1 interacts with RIBEYE in the YTH system. We found that RIBEYE(B) interacts only with the CTR of GCAP2 but not with the CTR of GCAP1 (supplemental Fig. 4C, available at www.jneurosci.org as supplemental material), indicating that RIBEYE specifically interacts with GCAP2 but not with GCAP1 (supplemental Fig. 4C, available at www.jneurosci.org as supplemental material). Qualitatively identical results as described above for immunolabeling of the bovine retina with polyclonal and monoclonal antibodies against GCAP2 were also obtained for the mouse retina (Fig. 6A,B; supplemental Fig. 8A–E, available at www.jneurosci.org as supplemental material). In the distal parts of the photoreceptors, the GCAP2 immunosignals were typically stronger in the inner segments compared to the outer segments. This was the case in the light-adapted bovine and mouse retina (Fig. 5A,B,D; supplemental Fig. 8A,B,F, available at www.jneurosci.org as supplemental material). High-resolution confocal laser scanning microscopy showed a clear colocalization between RIBEYE and GCAP2 signals, demonstrating that GCAP2 and synaptic ribbons are in close proximity to each other (Fig. 6).
RIBEYE and GCAP2 are localized very close to each other in photoreceptor synapses as judged by in situ PLA
The close association of RIBEYE and GCAP2 in situ was further supported by in situ PLAs (Gustafsdottir et al., 2005) on flash-frozen mouse retinal sections (Fig. 7). PLA in situ interaction assays critically depend on the close proximity of the interaction partners (Söderberg et al., 2006). In PLAs, the secondary antibodies are labeled with specific oligonucleotides. Only if the two antigens detected by two different primary antibodies are in close proximity to each other (<40 nm) can a linker oligonucleotide hybridize to the distinct PLUS/MINUS oligonucleotides conjugated to the secondary antibodies and provide the template for a rolling circle amplification (Söderberg et al., 2006, 2008). The product of the rolling circle amplification is then specifically detected by a fluorescent oligonucleotide probe (Fig. 7). In the case of RIBEYE and GCAP2, a strong PLA interaction signal was observed in the outer plexiform layer (OPL) (Fig. 7A–E). There was no interaction signal present in the OPL if both primary antibodies were omitted or if only one primary antibody was applied (followed by incubation with the two oligonucleotide-conjugated secondary antibodies), demonstrating the specificity of the detection assay. As an additional negative control, RIBEYE and opsin were tested for interaction by PLA and did not produce any signal in the OPL, further demonstrating specificity of the PLA interaction assays (Fig. 7J). In contrast, a mixture of rabbit polyclonal RIBEYE (U2656) and mouse monoclonal CtBP2 antibodies (positive control) gave a strong PLA interaction system in the OPL (Fig. 7L). Remarkably, RIBEYE and mGluR6 did not produce a PLA interaction signal in the OPL (Fig. 7M). RIBEYE at the synaptic ribbon and mGluR6 at the tips of invaginating ON bipolar cells of the ribbon synapse obviously are not close enough to produce a PLA interaction signal, further emphasizing the very close proximity of GCAP2 and synaptic ribbons in the presynaptic terminal in situ (see Discussion).
In conclusion, using different independent assays, we have shown that RIBEYE interacts with GCAP2 in the synaptic terminals of photoreceptor cells.
Characterization of RIBEYE(B)–GCAP2 binding
To further characterize binding of GCAP2 to RIBEYE, we analyzed why the presence of 1 mm βME is essential for RIBEYE–GCAP2 interaction in the fusion protein pull-down experiments (Fig. 3). If βME was absent from the incubation buffer, RIBEYE(B) did not bind to GCAP2-GST in the fusion protein pull-down assays (Figs. 8A,B, 9A–D; supplemental Fig. 7A,B, available at www.jneurosci.org as supplemental material). It is well known that βME can cleave disulfide bridges (for review, see Berg et al., 2007). Rat RIBEYE(B) domain contains eight cysteine residues: RIBEYE(B)C587; RIBEYE(B)C603; RIBEYE(B)C667; RIBEYE(B)C683; RIBEYE(B)C781; RIBEYE (B)C786; RIBEYE(B)C861, and RIBEYE(B) C899. From these cysteines, only cysteine C667 and cysteine C899 in the SBD of RIBEYE are predicted to be close enough to form disulfide bridges in monomeric RIBEYE (Fig. 8D,E). RIBEYE(B)C667 is located in SBDa spatially close to RIBEYE(B)C899 in the SBDb, and a disulfide bridge between these residues would thus link the two different parts of the SBD with each other. We analyzed RIBEYE(B)C899S for its capability to interact with GCAP2 and tested whether this RIBEYE point mutant needs βME to interact with GCAP2 in pull-down assays. Most interestingly, RIBEYE(B)C899S interacted with GCAP2 in the absence of βME (Fig. 8B), demonstrating that RIBEYE(B)C899S does not need βME to bind to GCAP2. Similarly, RIBEYE(B)C667S, the putative partner of RIBEYE(B)C899S for disulfide bridge formation, also interacted with RIBEYE(B) in the absence of β-mercaptoethanol in protein pull-down analyses (supplemental Fig. 7A, available at www.jneurosci.org as supplemental material). We suggest that these cysteine residues, RIBEYE(B)C667 and RIBEYE(B)C899, which are located very close (within a few amgstroms) to each other (Fig. 8D,E), form a disulfide bridge that restricts movement of the SBD relative to the NBD, and thus also the conformational freedom of the connecting hinge 2 region (see Discussion). Mutating RIBEYE(B)C683 (which is located in the homodimerization interface of the NBD) (Fig. 8D) into RIBEYE(B)C683S did not change the dependency of GCAP2/RIBEYE interaction from the presence of βME (Fig. 8A, lanes 7,8), demonstrating that only specific cysteine mutations of RIBEYE(B) lead to an independence from βME for GCAP2 binding.
RIBEYE(B)C899S and RIBEYE(B)C667S, which were shown to be important in modulating GCAP2–RIBEYE interaction (Fig. 8B,D,E; supplemental Fig. 7A, available at www.jneurosci.org as supplemental material), are located in the SBD of RIBEYE(B). We also tested noncysteine mutants of the SBD—namely, RIBEYE(B)F904W and RIBEYE(B)ΔCTR—for their capability to interact with GCAP2. RIBEYE(B)F904 is located in the SBDb at the end of the modeled structure (Figs. 1B, 2A,B, 8D,E). RIBEYE(B)ΔCTR lacks the hydrophobic C-terminal region (CTR; aa912-918 of RIBEYE); the structure of the CTR has not yet been resolved (Kumar et al., 2002; Nardini et al., 2003). RIBEYE(B)F904W and RIBEYE(B)ΔCTR did not interact with GCAP2 in the YTH system, although these mutants are not within the proper binding region of RIBEYE for GCAP2 (Figs. 2, 8C–E). We interpret these data to mean that the latter mutants of the SBD are likely not relevant for a direct physical interaction with GCAP2 but are less well capable to stabilize a conformation of the hinge 2 region that can bind GCAP2 (see Discussion).
RIBEYE(B)–GCAP2 interaction is NADH dependent
We tested whether the reducing power of βME is important in promoting RIBEYE–GCAP2 interaction. RIBEYE(B) efficiently binds reduced NADH (Schmitz et al., 2000; Alpadi et al., 2008). Therefore, we analyzed whether NADH could replace βME in promoting RIBEYE–GCAP2 interaction. Indeed, GCAP2 bound to RIBEYE(B) in the absence of βME if NADH was present in the incubation buffer (Fig. 9A,C; supplemental Fig. 7Bb, available at www.jneurosci.org as supplemental material). Surprisingly, also the oxidized form of NADH, NAD+, induced RIBEYE(B)– GCAP2 interaction in the absence of βME (Fig. 9B,D; supplemental Fig. 7Ba), demonstrating that the reducing power of NADH does not play a major role in promoting GCAP2–RIBEYE interaction. Both the oxidized as well as the reduced form of NADH (NAD+ and NADH, respectively) stimulate RIBEYE–GCAP2 interaction. The NADH concentrations applied in these experiments are perfectly within the known physiological range of intracellular NADH concentrations (Zhang et al., 2002; Fjeld et al., 2003). The necessity of NADH binding to RIBEYE for GCAP2–RIBEYE interaction was further demonstrated by the analysis of a NADH binding-deficient RIBEYE mutant: RIBEYE(B)G730A (Magupalli et al., 2008). GCAP2 did not interact with this NADH binding-deficient RIBEYE point mutant in the YTH system (Fig. 9E), although this RIBEYE point mutant was able to efficiently heterodimerize with RIBEYE(B) wild-type protein (Fig. 9E).
Viral overexpression of GCAP2 in presynaptic photoreceptor terminals promotes disassembly of photoreceptor synaptic ribbons
It is well established that the dynamics of synaptic ribbons is dependent on intracellular Ca2+ (Spiwoks-Becker et al., 2004). Synaptic ribbons tend to disassemble via spherical disassembly intermediates in response to illumination in the mouse retina when intracellular Ca2+ is low. Noteworthy, the disassembly of synaptic ribbons could be experimentally induced by chelating extracellular Ca2+ with EGTA/BAPTA (Spiwoks-Becker et al., 2004). Therefore, we tested whether GCAP2 could possibly be involved in these well-known Ca2+-dependent dynamic changes of synaptic ribbons and analyzed whether synaptic GCAP2 expression could be related to the Ca2+-dependent dynamic changes of synaptic ribbons.
For this purpose, we generated recombinant GCAP2-EGFP expressing SLF virus and used this recombinant virus for infecting retinal explants. EGFP-expressing SLF virus served as control virus. In organotypic retinal explant cultures, the recombinant SLF viruses preferentially infected photoreceptors (Fig. 10A–D). Photoreceptors were infected at a high density with the SLF viruses (Fig. 10A,B) and showed expression of GCAP2-EGFP (Fig. 10C) or EGFP (Fig. 10D) throughout all photoreceptor cell compartments including the synaptic terminals (Fig. 10). Our organotypical cultures did no longer contain outer segments as also observed in other organotypic retinal cultures. Interestingly, photoreceptor terminals that were infected with GCAP2-EGFP virus typically displayed a loss of synaptic ribbons as analyzed by coimmunolabeling with RIBEYE antibodies (U2656) (Fig. 10E–L). Photoreceptor terminals infected with EGFP virus (control virus) did not show loss of synaptic ribbons, indicating that the loss of synaptic ribbons in GCAP2-EGFP-infected photoreceptors is not attributable to a cytopathic effect of the virus infection itself (Fig. 10M–Q). In EGFP-infected photoreceptors, 77.3 ± 3.8% SD (482 synapses counted from four independent retinal cultures) of the synaptic terminals contained synaptic ribbons, whereas in GCAP2-EGFP-infected photoreceptors, only 30.1 ± 4.5% SD (389 synapses from four independent cultures) contained synaptic ribbons in their synaptic terminals as judged by RIBEYE immunolabeling. The same observation described above for the light microscopic analyses was also observed at the electron microscopic level using electron microscopic analyses of GCAP2-EGFP and EGFP (control)-infected retinas (Fig. 11). In GCAP2-EGFP-infected retinas, we observed a dramatic reduction in the number of synaptic ribbons in photoreceptor terminals in comparison to photoreceptor terminals of EGFP-infected control retinas [EGFP-infected retinas, 1.092 bar-shaped synaptic ribbons (longer than >150 nm) per photoreceptor synaptic terminal (±0.091 SD; n = 181 synapses from six independent cultures); GCAP2-EGFP-infected retinas, 0.164 bar-shaped synaptic ribbons (longer than >150 nm) per photoreceptor synaptic terminal (±0.033 SD, n = 181 synapses from six independent cultures].
Discussion
GCAP2 is a photoreceptor-enriched neuronal Ca2+-sensor protein. Its role as a Ca2+-dependent modulator of the phototransduction cascade is well known (for review, see Palczewski et al., 2004). Previous studies have shown that GCAP2 is not restricted to photoreceptor outer and inner segments, but is also present in photoreceptor presynaptic terminals (Otto-Bruc et al., 1997; Duda et al., 2002, Pennesi et al., 2003; Makino et al., 2008). The function of GCAP2 in photoreceptor synapses is not known. The analyses of GCAP2 knock-out mice suggested a synaptic function of GCAPs based on electroretinogram analyses that showed a defect in the b-wave of the electroretinogram (Pennesi et al., 2003). But the mechanism by which GCAPs might work in the synapse remained unclear. In the present study, we show with many different, independent approaches that GCAP2 binds to RIBEYE, the major component of synaptic ribbons in the active zone of photoreceptor synapses, and is involved in synaptic ribbon dynamics. The selective association of GCAP2 with photoreceptor synaptic ribbons but not with bipolar cell synaptic ribbons further contributes to known physiological differences between different types of retinal ribbon synapses (e.g., Heidelberger et al., 1994; von Gersdorff and Matthews, 1994; Neves and Lagnado, 1999; Thoreson et al. 2004; Innocenti and Heidelberger, 2008; Sheng et al., 2007; Schmitz, 2009).
RIBEYE–GCAP2 interaction requires structural rearrangements of RIBEYE(B) domain
Our YTH mapping analyses demonstrated that the hinge 2 region of RIBEYE(B) is responsible for the interaction with the CTR of GCAP2. This suggestion is further supported by point mutants of the hinge 2 region that abolished interaction with GCAP2. The hinge 2 region is structurally flexible, and its conformation is regulated by NADH binding and also by dimerization. This has been shown for various members of the d-isomer-specific hydroxyacid dehydrogenase family to which also RIBEYE belongs (Goldberg et al., 1994; Lamzin et al., 1994; Kumar et al., 2002; Nardini et al., 2003; for review, see Popov and Lamzin, 1994; Chinnadurai, 2002). NADH-binding induces movement of the SBD toward to the NBD via rotation around the hinge regions resulting in closure of the NADH binding cleft (“closed” conformation). Additionally, binding of NADH results in the structural organization of the CTR. The NADH-induced creation of a new α-helix that interacts with NADH stabilizes the “closed” conformation.
Thus, we suggest that binding of GCAP2 to the hinge 2 region of RIBEYE(B) requires the NADH-induced, closed conformation of RIBEYE(B). This hypothesis can explain the NADH-induced stimulation of GCAP2 binding and provides an explanation for the observed modulatory role of the SBD: the NADH-induced closed conformation requires considerable structural rearrangements in the SBD and movement of both SBDa and SBDb. The predicted disulfide bridge between C667 and C899 locks SBDb to SBDa and restricts the movements of the two portions of the SBD relative to each other (Fig. 8E). Therefore, the observed capability of RIBEYE(B)C899S and RIBEYE(B)C667S to bind GCAP2 in the absence of βME could be attributed to an enhanced conformational flexibility of the SBD. In these mutants, a disulfide bridge can no longer be formed between RIBEYE(B)C899 and RIBEYE(B)C667. This enhanced flexibility of the SBD will facilitate movement of the SBD toward the NBD. We propose that this enhanced flexibility of the SBD favors formation of the closed conformation of the hinge 2 region that can subsequently bind GCAP2.
The incapability of the RIBEYE(B) mutants RIBEYE(B)F904W and RIBEYE(B)ΔCTR to bind to GCAP2 can be explained by a decreased capability of these mutants to stabilize the closed conformation. RIBEYE(B)ΔCTR lacks the hydrophobic CTR of RIBEYE(B), which undergoes enormous structural rearrangements after NADH binding (Lamzin et al., 1994; Nardini et al., 2003). RIBEYE(B)F904 is located at the beginning of the CTR in the SBD of RIBEYE(B) (Magupalli et al., 2008). The CTR has an important role in stabilizing the closed conformation in the d-isomer-specific 2-hydroxyacid dehydrogenase protein family (Lamzin et al., 1994). We propose that the decreased GCAP2 binding of these CTR mutants is based on their decreased capability to stabilize the closed conformation.
The regulation of RIBEYE/GCAP2 interaction in situ
We have shown that NADH and NAD+ are similarly effective in promoting RIBEYE/GCAP2 interaction. Very low concentrations of NADH (down to 10 nm) induced the binding of GCAP2 to RIBEYE. Since both the oxidized and reduced form of NADH are equally effective, the binding of GCAP2 to RIBEYE and synaptic ribbons does probably not critically depend on the metabolic state/redox state of the presynaptic terminal. Several proteins (e.g., E1A, ZEB) are known that interact with CtBP proteins in a redox-sensitive manner (Zhang et al., 2002; Garriga-Canut et al., 2006). The different redox sensitivities of these interactions are probably based on different binding sites. Whereas GCAP2 binds to the hinge 2 region of RIBEYE(B) in a redox-insensitive manner (this study), redox-sensitive interaction partners (e.g., E1A and ZEB) bind to a hydrophobic portion in the SBD in some distance from the hinge 2 region (Zhang et al., 2002; Nardini et al., 2003; Kuppuswamy et al., 2008). Binding of NADH is usually accompanied by dimerization of CtBP proteins (Balasubramanian et al., 2003; Thio et al., 2004; Nardini et al., 2009). Currently, we cannot discriminate whether binding of NADH to RIBEYE is the only or main event that promotes RIBEYE/GCAP2 interaction in the synapse or whether the dimerization of RIBEYE(B) is also involved. Both events (NADH binding and dimerization) are interconnected with each other and are expected to promote the closed conformation of RIBEYE(B). Additional factors, i.e., certain kinases such as p21-activated kinase 1 (Pak1) that were suggested to regulate dimerization and NADH-binding (Barnes et al., 2003) could also be relevant for the induction of GCAP2 binding. Since NADH binding and dimerization are tightly linked, we speculate that both events could promote interaction of RIBEYE with GCAP2 in situ. The concentrations of NADH in the presynaptic photoreceptor terminal and at the synaptic ribbon itself are unknown. Also, possible fluctuations in NADH concentrations in response to light and dark stimulations that could be particularly relevant for structural changes of synaptic ribbons during light and dark adaption have not yet been investigated so far. But regardless from these limitations, the concentrations necessary to promote RIBEYE/GCAP2 interaction are low and within the known physiological range of cellular NADH concentrations (Fjeld et al., 2003).
GCAP2, a candidate to mediate Ca2+- and illumination-dependent synaptic ribbon dynamics
The number and shape of synaptic ribbons are dynamic in nature, and structural changes of synaptic ribbons are important determinants of synaptic performance (Hull et al., 2006; Johnson et al., 2008; Meyer et al., 2009). Spiwoks-Becker et al. (2004) demonstrated disassembly of synaptic ribbons in photoreceptor terminals during illumination when exocytosis is low. Illumination of photoreceptors also reduces the presynaptic Ca2+ concentration in photoreceptor ribbon terminals (Jackman et al., 2009). Interestingly, the tendency of synaptic ribbons to disassemble during environmental illumination could be mimicked by removing (chelating) extracellular Ca2+, indicating that Ca2+ is an important mediator of synaptic ribbon dynamics. We propose that GCAP2 mediates the known Ca2+-dependent structural changes of synaptic ribbons during light and darkness.
As mentioned above, Ca2+ is needed to maintain the structural integrity of synaptic ribbons, and consequently, chelating of Ca2+, e.g., by GCAP2 that has been recruited to RIBEYE via a NADH-dependent mechanism at the synaptic ribbon, could reduce number and/or size of synaptic ribbons. Viral overexpression of GCAP2 in photoreceptors reduced the number of synaptic ribbons (present study), qualitatively similar to chelating extracellular Ca2+ (Spiwoks-Becker et al., 2004). The stronger ribbon disassembly in GCAP2-overexpressing photoreceptors is not surprising because intracellular overexpression of a Ca2+-binding protein can be expected to induce a stronger effect than the indirect manipulation of intracellular Ca2+ through chelation of extracellular Ca2+.
In addition to a mechanism that is based on Ca2+-buffering, GCAP2 could also exert its function by alternative molecular mechanisms: GCAP2 binds to guanylate cyclases in the outer segments in a Ca2+-dependent manner during phototransduction and light-/dark adaptation. Based on several findings (Liu et al., 1994, Rieke and Schwartz, 1994; Cooper et al., 1995; Savchenko et al., 1997, Duda et al., 2002; Müller et al., 2003; Venkataraman et al., 2003; Spiwoks-Becker et al., 2004; Zhang et al., 2005), GCAP2 could possibly also influence guanylate cyclases in the presynaptic photoreceptor terminals. Based on that thinking, GCAP2 could regulate the activity of synaptic guanylate cyclases, which in turn could regulate synaptic ribbon structure, e.g., via cGMP-dependent mechanisms. Photoreceptor terminals express guanylate cyclases (Liu et al., 1994, Cooper et al., 1995; Duda et al., 2002; Venkataraman et al., 2003), and studies on synaptic ribbons of the pineal gland strongly support a role for cGMP in synaptic ribbon dynamics (for review, see Vollrath and Spiwoks-Becker, 1996). By this way of thinking, the modulation of synaptic cGMP levels and guanylate cyclases by GCAP2 would appear to be an alternative molecular mechanism that could regulate synaptic ribbon dynamics. The further characterization of GCAP2-dependent synaptic functions and mechanisms, i.e., whether pure Ca2+ buffering or modulation of enzymatic activity or both regulate ribbon structure, and the modulation of GCAP2-effector interactions by intracellular Ca2+ and NADH in the synapse, remain to be elucidated by future analyses.
Footnotes
This work was supported by research grants from the German Research Community Deutsche Forschungsgemeinschaft (SFB530, Teilprojekt C11; GRK1326) and funding from the Saarland University (HOMFOR, ZFK) to F.S., HOMFOR to K.S., and by Research to Prevent Blindness and National Eye Institute-National Institutes of Health Grant EY11307 to C.-H.S. The sequences obtained in the present study for bovine GCAP2 are identical to the sequences of bovine GCAP2 that have been deposited previously at GenBank (L430001.1 and U32856.1). We thank Prof. Jens Rettig, Dr. Ulf Matti, and Carolin Bick (Saarland University, Institute of Physiology) for help with making recombinant Semliki Forest virus.
- Correspondence should be addressed to Dr. Frank Schmitz at the above address. frank.schmitz{at}uniklinik-saarland.de