dKCNQ deletion fly lines
| Fly line | Deletion in genomic DNA | Deletion in cDNA | Predicted deletion in protein |
|---|---|---|---|
| 24B | None | None | None |
| 18B | +110 to +2053 | Exon 2-7 | S1-S6 + site 1 |
| 35B | −553 to +3368 | Exon 1-7 | S1-S6 + site 1 |
| 42B | +2062 to +3840 | Part of exon 8 | C-terminal sequences after site 1 |
| 53B | +1071 to +3303 | Exon 5-7 | S5-S6 + site 1 |
| 64B | +453 to +3493 | Exon 3-7 | Part of S1, S2-S6, + site 1 |
The first nucleotide of the ATG start codon for dKCNQ protein is numbered as + 1. Compared with precise excision line 24B, some deletion lines have short P-element sequences left between the breakpoints of excision. In line 53B, there is 1 bp (A); in 42B, there are 33 bp (CGTCTTACTTATTTACTTACTTATTTCATCATG); in 18B, there are 22 bp (CATGATGAAATAACAGAATAAC); and in 64B, there are 4 bp (GTTA).