Table 1.

Primer sequences used in this study to quantify selected rat transcripts

Gene nameGenBank accession numberPrimer sequence 5′ to 3′
NR1X63255Fw, AATGACCCCAGGCTCAGAAAC
Rev, CCACGGAGCTCTGCTTTACAG
NR2ANM_012573Fw, GCCAGATAACAATAAGAACCACAAGA
Rev, TGCGGTCAACATCGCTACAG
NR2BNM_012574Fw, GACGACTTCAAGCGAGATTCG
Rev, GCCCGTTCCGTGTTTGAG
BdnfNM_01251Fw, ATGGCCCTGTGGAGGCTAA
Rev, GGATGGCCACTCAGAAATTCC
TrkBNM_012731Fw, GAAAAGCCATTGGATCAGCC
Rev, GTCAGTGCCGAACATGATCCT
GapdhNM_017008Fw, ACATGCCGCCTGGAGAAA
Rev, CTCGGCCGCCTGCTT
  • Fw, Forward; Rev, reverse.