Table 1.

Primer sequences for RT-PCR gene expression analysis

GeneSequence
5′-sense-3′5′-anti-sense-3′
Mcl-1 TCTGAGATGTTTGGCCTGCGGAGA TCTAGACTATCTTATTAGATATGCCAGAC
Bcl-2 CTCGTCGCTACCGTCGTGACTTCG CAGATGCCGGTTCAGGTACTCAGTC
Bcl-W CGAGTTTGAGACCCGTTTCCGCC GCACTTGTCCCACCAAAGGCTCC
Bcl-xL AGGCAGGCGATGAGTTTGAA CGGCTCTCGGCTGCTGCATT
Bax AAGCTGAGCGAGTGTCTCCGGCG GCCACAAAGATGGTCACTGTCTGCC
Bak CACCCCCACCTCATCGTCCATTTC GCCCACCCCCTCCCCTGTCATA
S12 GGAAGGCATAGCTGCTGG CCTCGATGACATCCTTGG