Table 1.

Oligonucleotide primers used in RT-PCR

Protein/geneAccession numberForward primer (5′→3′)Reverse primer (5′→3′)Product (bp)Annealing temperature (°C)
NTPDase2/Entpd2NM_009849agctggaggatgccacagaggagagcaacccaggagctga29963
PLCβ2/Plcb2NM_177568gagcaaatcgccaagatgatccttgtctgtggtgaccttg16360
SNAP25/Snap25NM_011428ggcaataatcaggatggagtagagatttaaccacttcccagca31058
T1R1/Tas1r1NM_031867ctggaatggacctgaatggacagcagcagtggtgggaac18560
T1R2/Tas1r2NM_031873aagcatcgcctcctactccggctggcaactcttagaacac11458
T1R3/Tas1r3NM_031872gaagcatccagatgacttcagggaacagaaggacactgag28358
T2R5/Tas2r105NM_020501gaatcatagaaacaggacctcgctttacaaaggcttgctttagc40657
T2R8/Tas2r108NM_020502ttctgatttcagccctcaccccaaaagctggtcctgtttc24560
A1/Adora1NM_001008533atccctctccggtacaagacagtactcaggttgttccagccaaac12060
A2A/Adora2aNM_009630ccgaattccactccggtacacagttgttccagcccagcat12060
A2B/Adora2bNM_007413tcttcctcgcctgcttcgtccagtgaccaaacctttatacctga12160
A3/Adora3NM_009631acttctatgcctgccttttcatgtaaccgttctatatctgactgtcagctt12860
NT5E, CD73/Nt5eNM_011851ggaatccatgtggtgtacggaaagcttccctggtaatg31760
ACPP, PAP/AcppNM_207668cagccacgtttgtaatggaaaaaaggctgtcatcgaatgg25858