Table 1.

The primers used for qPCR

Rat geneAccession no.Forward primer (5′ to 3′)Reverse primer (5′ to 3′)
Tsc2NM_012680.2GAGCTGTGTGACCAGAACGATGTTGATGAGGAGCACGAAG
GAPDHNM_017008AGACAGCCGCATCTTCTTGTCTTGCCGTGGGTAGAGTCAT
18SNR_046237.1GTAACCCGTTGAACCCCATTCCATCCAATCGGTAGTAGCG
Atf3NM_012912.2GACAGACAGCCCGCCTCTAGACCTGGCCTGGATGTTGAA
Ucp2NM_019354.2ACCATTGCACGAGAGGAAGGTCTTGACCACATCAACGGGG
Snap91NM_031728ATAGACCTTTTTGGGGATGCGCAGGTTATTCTGAGCTGGA
PrelpNM_053385.1AACAAGCTGTCGGATCGAGGACATCATGAGGTCCAACGGG
Il1r1NM_013123.3TTTGTTCCCGCCAAGATGGAAGGACGTGCGGCAAGTATAG
Emp3NM_030847.1ATCTGGCAGCCATGTCACTCACGTGCAGTCATACCACAGG
Hspb1NM_031970.3AGCACGAAGAAAGGCAGGATATTGTGTGACTGCTTTGGGC