Table 1.

List of primers used for the study

SpeciesGene identifierGene nameGenBank accession numberForward primer sequenceReverse primer sequence
MouseHmox1Heme oxygenase 1NM_010442.2GTCAAGCACAGGGTGACAGAATCACCTGCAGCTCCTCAAA
MouseNqo1NAD(P)H dehydrogenase, quinone 1NM_008706.5AGCGTTCGGTATTACGATCCAGTACAATCAGGGCTCTTCTCG
MouseGclcGlutamate-cysteine ligase, catalytic subunitNM_010295.1ATGATAGAACACGGGAGGAGAGTGATCCTAAAGCGATTGTTCTTC
MouseGclmGlutamate-cysteine ligase, modifier subunitNM_008129.3TGACTCACAATGACCCGAAAGATGCTTTCTTGAAGAGCTTCCT
MouseGsrGlutathione reductaseNM_010344.4AGTTCCTCACGAGAGCCAGACAGCTGAAAGAAGCCATCACT
MouseCd68Cd68 antigenNM_001291058.1GACCTACATCAGAGCCCGAGTCGCCATGAATGTCCACTG
MouseMcp1Monocyte chemoattractant protein-1NM_011333.3CATCCACGTGTTGGCTCAGATCATCTTGCTGGTGAATGAGT
MouseTnfaTumor necrosis factor-alphaNM_013693.2TCTTCTCATTCCTGCTTGTGGGGTCTGGGCCATAGAACTGA
Mousemt-Co1Mitochondrial cytochrome c oxidase INC_005089TCGCAATTCCTACCGGTGTCCGTGTAGGGTTGCAAGTCAGC
Mousemt-Nd1Mitochondrial NADH dehydrogenase subunit 1ENSMUSG00000064341GCACCTACCCTATCACTCACAGTTTGGGCTACGGCTCG
Mousemt-Nd2Mitochondrial NADH dehydrogenase subunit 2ENSMUSG00000064345AGGGATCCCACTGCACATAGTGAGGGATGGGTTGTAAGGA
Mousemt-Nd5Mitochondrial NADH dehydrogenase subunit 5ENSMUSG00000064367ATAACCGCATCGGAGACATCGAGGCCAAATTGTGCTGATT
Mousemt-Nd6Mitochondrial NADH dehydrogenase subunit 6ENSMUSG00000064368ATGTTGGAAGGAGGGATTGGGTACCCGCAAACAAAGATCACC
MouseSsbp1Single-stranded DNA binding protein 1, mitochondrialNM_212468.3GTCGGGCTCTGCGTGTCACCAAACTGCTGGCTACTTCA
MouseMterf1aMitochondrial transcription termination factor 1aNM_001013023.2GTCCAGAGGCGGAAGTGAAAAATCATCAGGTAGCCCAAAGTT
MouseMterf3Mitochondrial transcription termination factor 3NM_025547.3GTCTGGAGCCTGTGAAGGAAAGACGATGATGTGGTGGGGAA
MouseTfb1mTranscription factor B1, mitochondrialNM_146074.1AATTTCCTCCTGGACTTGAGGAGAGAGCATCTGTAACCCTGG
MouseTfb2mTranscription factor B2, mitochondrialNM_008249.4GTTCGAATGACTCCTCGTAGGCATTCTAGCAGCTGTGTCTCC
MousePolrmtPolymerase (RNA) mitochondrial (DNA directed)NM_172551.3GCTGCCTACATTTCCCACCTGTGCGGCGTAATGCTGTAAG
MousePolg2Polymerase (DNA directed), γ2, accessory subunitNM_015810.2TGGCTTGATTTCTGGTTGCGCGCTGCTGAAGTTAGAGGGA
MousePeo1 (Twinkle)Progressive external ophthalmoplegia 1NM_153796.3GACAGCATCCATTTTCGGCTCGCCCAGTCACCAGTTTCCTATC
Mousemt-CytbMitochondrial cytochrome bENSMUSG00000064370.1ATTCCTTCATGTCGGACGAGACTGAGAAGCCCCCTCAAAT
Mousemt-Co3Mitochondrial cytochrome c oxidase subunit IIIENSMUSG00000064358.1CAAGGCCACCACACTCCTATATTCCTGTTGGAGGTCAGCA
MouseTfamTranscription factor A, mitochondrialNM_009360.4TCCCCTCGTCTATCAGTCTTGTTCTTTGTATGCTTTCCACTCAGC
MouseGapdhGlyceraldehyde-3-phosphate dehydrogenaseNM_008084.2GCCAAAAGGGTCATCATCTCCACACCCATCACAAACATGG
MouseActbActin, βNM_007393.3CTAAGGCCAACCGTGAAAAGACCAGAGGCATACAGGGACA
RatHmox1Heme oxygenase 1NM_012580.2GTCAAGCACAGGGTGACAGACTGCAGCTCCTCAAACAGC
RatNqo1NAD(P)H dehydrogenase, quinone 1NM_017000.3AGCGCTTGACACTACGATCCCAATCAGGGCTCTTCTCACC
RatGclcGlutamate-cysteine ligase, catalytic subunitNM_017305.2CTGACTCACAATGACCCAAAAGTTCAATGTCAGGGATGCTTTC
RatGclmGlutamate-cysteine ligase, modifier subunitNM_012815.2GGCGATGTTCTTGAAACTCTGCAGAGGGTTGGGTGGTTG
RatGsrGlutathione reductaseNM_053906.2ATCAAGGAGAAGCGGGATGCAATGTTGCGTAGCCGTGGAT
RatGapdhGlyceraldehyde-3-phosphate dehydrogenaseNM_017008.4TGGGAAGCTGGTCATCAACGCATCACCCCATTTGATGTT
RatActbActin, βNM_031144.3CCCGCGAGTACAACCTTCTCGTCATCCATGGCGAACT