GPR50 interacts with neuronal NOGO-A and affects neurite outgrowth
Introduction
G protein-coupled receptors (GPCRs) are one of the largest superfamilies of proteins with over one thousand members identified in the human genome. GPCRs mediate 80% of transmembrane signal transduction in response to ligand binding, linking interactions between the cell and the environment (Lundstrom, 2006). They are involved in many diseases, including depression, anxiety, hypertension, obesity, inflammation, and pain. GPCRs are the therapeutic targets for approximately 50% of all recently released drugs, including serotonin (5-HT) antagonists which are used to treat depression (Lundstrom, 2006). However, only a small proportion of GPCRs have a known ligand or have been targeted for small molecule drug development. The focus of this study, the melotonin-related receptor GPR50, is an orphan receptor with no known ligand. Despite this, there is emerging genetic evidence suggesting a role for GPR50 in psychiatric illness and lipid metabolism (Bhattacharyya et al., 2006, Thomson et al., 2005). GPR50 is an orphan G protein-coupled receptor expressed in the pituitary, hypothalamus and hippocampus in the adult mammalian brain, suggesting a role in the neuroendocrine system (Hamouda et al., 2007, Reppert et al., 1996). A link between GPR50 and Alzheimer's disease has also been suggested (Hamouda et al., 2007). Little is known about its developmental pattern of expression although it has been detected in human foetal brain (Drew et al., 2001). GPR50 is found exclusively in mammals and is orthologous to Mel1c found in non-mammalian vertebrates (Dufourny et al., 2008), but has been modified, in part by the addition of a long C-terminal tail. The full-length gene encodes a protein of 617 amino acids that is 45% identical overall to human melatonin receptors MT1 and MT2, with identity increasing to 55% when the transmembrane domains alone are compared. Despite this close structural relationship GPR50 does not bind either [125I]melatonin or [3H]melatonin (Reppert et al., 1996). However, GPR50 is reported to interact with MT1 through its transmembrane domain, resulting in inhibition of MT1 receptor signalling, mediated by the GPR50 C-terminal tail (Levoye et al., 2006). Gpr50 knockout mice are hyperactive compared to wildtype, showing elevated metabolic rates and resistance to obesity when fed on a high-energy diet (Ivanova et al., 2008).
We sought to investigate the function of GPR50 through identification of proteins that interact with the C-terminal domain. There are two naturally occurring forms of the C-terminal domain of GPR50 which primarily differ in the presence of four amino acids (TTGH, amino acid residues 502–505) of lengths 617 and 613 amino acids (referred to as TTGH and ΔTTGH, respectively). The ΔTTGH form is rarer, but is common, with an allele frequency of approximately 30%. We performed yeast two-hybrid screens using both forms of the C-terminal tail as bait and identified multiple isoforms of Reticulon 4 (RTN4), also known as NOGO, as putative interactors. NOGO encodes three main isoforms: myelin-associated proteins NOGO-A, -B, and -C. NOGO-A is a potent inhibitor of neurite outgrowth in vitro and in vivo (Schwab, 2004). Expression differences for NOGO-A and -C have been shown in post mortem forebrain samples from individuals diagnosed with schizophrenia, bipolar disorder and Alzheimer's disease (Gil et al., 2006, Novak et al., 2002). An insertion/deletion polymorphism in the 3′ UTR of NOGO has shown association to schizophrenia in some, but not all studies (Novak et al., 2002, Tan et al., 2005). In this study we have established the interaction between GPR50 and neuronal NOGO-A in mammalian cells, shown enrichment of both proteins at the synapse, and have demonstrated a possible function of GPR50 in neurite outgrowth.
Section snippets
Identification of putative protein interactors
To identify GPR50 interaction partners, yeast-two-hybrid screens were performed using both of the naturally occurring forms of the C-terminal domain of GPR50 (aa Val292-Val617 of the TTGH form, Fig. 1A). All baits were screened against a human adult brain cDNA library using both LexA- and Gal4-based systems. We identified 23 putative protein interactors of the C-terminal domain of GPR50 (Table 1), including proteins involved in four areas of interest: neurodevelopment (ABCA2, CDH8, PCDH9, PAX6,
Discussion
GPR50 is an orphan G protein-coupled receptor with no known ligand and we sought to clarify the function of GPR50 though detection of proteins interacting with the C-terminal domain of the protein. Gene ontology analysis of the 23 proteins detected in screens of an adult human brain library with two naturally occurring forms of the protein implicated GPR50 in neuronal development and sterol/cholesterol metabolism. The identification of functional classes of putative interactors involved in
Yeast two-hybrid screens
Yeast two-hybrid screening was performed by Hybrigenics, S.A., Paris, France (http://www.hybrigenics-services.com). The coding sequence for amino acids 292–617 of human G protein-coupled receptor 50 were cloned from human genomic DNA of male individuals hemizygous for the insertion or deletion forms of the protein using tailed primers:
Left primer—ATGGCAACTAGTGTGATCTACGGGCTCCTCAAT,
Right Primer—ATGGCAACTAGTCCTGGCCACCTACGAGAG.
The insertion form corresponds to the coding sequence for amino acids
Acknowledgments
The authors would like to thank Mark Bradley (UoE) for the HEK293T cells, Christoph Gruenewald and Becky Carlyle (UoE) for assisting with the neurite outgrowth experiment, Alan Serrels (ECRC, UoE) for the confocal microscopy facility and Sarah West-Alin for graphics assistance. We are grateful to J. Kirsty Millar for critical reading of the manuscript. This work was supported by the Medical Research Council (MRC-G0401041) and Research Councils UK (RCUK EP/E500145/1) grants. E.G. is funded by
References (48)
- et al.
Synaptic destabilization by neuronal Nogo-A
Brain Cell Biol.
(2006) - et al.
Using the two-hybrid system to detect protein–protein interactions
- et al.
Sequence variants in the melatonin-related receptor gene (GPR50) associate with circulating triglyceride and HDL levels
J. Lipid Res.
(2006) - et al.
DISC1, PDE4B, and NDE1 at the centrosome and synapse
Biochem. Biophys. Res. Commun.
(2008) - et al.
Disrupted in schizophrenia 1 interactome: evidence for the close connectivity of risk genes and a potential synaptic basis for schizophrenia
Mol. Psychiatry
(2007) - et al.
Isolation and characterization of postsynaptic densities from various brain regions: enrichment of different types of postsynaptic densities
J. Cell Biol.
(1980) - et al.
Nogo-A is a myelin-associated neurite outgrowth inhibitor and an antigen for monoclonal antibody IN-1
Nature
(2000) - et al.
The rat brain postsynaptic density fraction contains a homolog of the Drosophila discs-large tumor suppressor protein
Neuron
(1992) - et al.
Behavioral phenotypes of Disc1 missense mutations in mice
Neuron
(2007) - et al.
Nogo-A, -B, and -C are found on the cell surface and interact together in many different cell types
J. Biol. Chem.
(2005)
Localization of the melatonin-related receptor in the rodent brain and peripheral tissues
J. Neuroendocrinol.
GPR50 is the mammalian ortholog of Mel1c: evidence of rapid evolution in mammals
BMC Evol. Biol.
Protein interaction mapping: a Drosophila case study
Genome Res.
Identification of a receptor mediating Nogo-66 inhibition of axonal regeneration
Nature
Rho kinase inhibition enhances axonal regeneration in the injured CNS
J. Neurosci.
Toward a functional analysis of the yeast genome through exhaustive two-hybrid screens
Nat. Genet.
Nogo-A expression in the human hippocampus in normal aging and in Alzheimer disease
J. Neuropathol. Exp. Neurol.
Identification of the Nogo inhibitor of axon regeneration as a reticulon protein
Nature
Detection of the human GPR50 orphan seven transmembrane protein by polyclonal antibodies mapping different epitopes
J. Pineal. Res.
The GPR55 ligand L-alpha-lysophosphatidylinositol promotes RhoA-dependent Ca2+ signaling and NFAT activation
FASEB J.
Altered metabolism in the melatonin-related receptor (GPR50) knockout mouse
Am. J. Physiol. Endocrinol. Metab.
GPR92 as a new G12/13- and Gq-coupled lysophosphatidic acid receptor that increases cAMP, LPA5
J. Biol. Chem.
Synaptic function for the Nogo-66 receptor NgR1: regulation of dendritic spine morphology and activity-dependent synaptic strength
J. Neurosci.
The orphan GPR50 receptor specifically inhibits MT1 melatonin receptor function through heterodimerization
EMBO J.
Cited by (43)
The orphan GPR50 receptor interacting with TβRI induces G1/S-phase cell cycle arrest via Smad3-p27/p21 in BRL-3A cells
2022, Biochemical PharmacologyGPR50 Promotes Hepatocellular Carcinoma Progression via the Notch Signaling Pathway through Direct Interaction with ADAM17
2020, Molecular Therapy OncolyticsCitation Excerpt :These results strongly suggest that GPR50 regulates HCC progression through the ADAM17-mediated Notch signaling pathway. An orphan GPCR (GPR50) was shown to regulate bipolar-affective disorder, lipid metabolism, thermogenesis, adipogenesis, and neuronal development,21–25 although it has been claimed that GPR50 has high sequence similarity with melatonin receptors (MT1 and MT2), but melatonin does not bind to GPR50.19,20 GPR50 was also reported to interact directly with various proteins, such as TIP60, NOGO-A, MT1, and MT2, via heterodimerization through the large carboxyl-terminal tail (C-tail) of GPR50.24,51,52
Protein interaction partners of neuronal chloride transporters
2020, Neuronal Chloride Transporters in Health and DiseaseTransport-dependent and independent functions of KCC2 at excitatory synapses
2020, Neuronal Chloride Transporters in Health and DiseaseThe role of orphan G protein-coupled receptors in the pathophysiology of multiple sclerosis: A review
2019, Life SciencesCitation Excerpt :Inhibition of NOGO-A or its receptors has been reported to be involved in neuronal integrity, axonal sprouting, and regeneration in autoimmune insults such as MS [48]. In yeast two-hybrid screening, researchers identified a correlation between GPR50 and NOGO-A [49]. They confirmed the correlation in mammalian cells and found an enrichment of both GPR50 and neuronal NOGO-A at the primary cortical neurons.
Orphan G protein-coupled receptors: The role in CNS disorders
2018, Biomedicine and Pharmacotherapy