Fluorophore assisted light inactivation (FALI) of recombinant 5-HT3A receptor constitutive internalization and function
Introduction
The 5-hydroxytryptamine type 3 (5-HT3) receptor mediates the rapid excitatory currents evoked by serotonin both in the peripheral and central nervous systems (Maricq et al., 1991, Tecott et al., 1993). Currently 5-HT3 antagonists are used clinically to treat irritable bowel syndrome and nausea and emesis during chemotherapy (Hesketh, 2008). Furthermore, 5-HT3 receptor polymorphisms are associated with schizophrenia and bipolar disorder (Niesler et al., 2001). In addition, 5-HT3A receptors may have roles in addiction to alcohol and other drugs of abuse as well as anxiety (Hodge et al., 1993, Olivier et al., 2000 reviewed in Grant, 1995, McKinzie et al., 2000). Therefore, regulation of 5-HT3A receptors at the cell membrane may play important roles in a number of neural functions, including nausea, anxiety and drug addiction.
The 5-HT3 receptor is a member of the cysteine-loop pentameric ligand gated ion channel (pLGIC) family, which includes the nicotinic-acetylcholine receptor, γ-aminobutyric acid type A (GABAA), and glycine receptors. Nicotinic-acetylcholine and 5-HT3 receptors form cation channels, whereas GABA and glycine receptors form anion channels. Five 5-HT3 isoforms have been described and have been termed 5-HT3A–E (Maricq et al., 1991, Davies et al., 1999, Niesler et al., 2003, Karnovsky et al., 2003). The A subtype can combine to form functional homo-pentameric structures whereas B–E subunits must combine with A subunits to form functional hetero-pentameric receptors (Maricq et al., 1991, Davies et al., 1999, Niesler et al., 2007). Heteromeric 5-HT3AB receptors have larger single channel conductance and are less permeable to Ca2+ compared to 5-HT3A homomeric receptors (Davies et al., 1999). Despite our extensive knowledge of 5-HT3 receptor structure and function, little is known about the cell surface stability and trafficking of this receptor.
The development of fluorescent proteins and strategies for tagging proteins with other fluorescent molecules has made it possible to visualize specific proteins and investigate their localization and trafficking. Furthermore, fluorescent proteins and molecules have been used to specifically inhibit proteins upon the excitation of the fluorophore by light and this technique is known as fluorophore assisted light inactivation (FALI) or chromophore assisted light inactivation (CALI) (Jay, 1988; reviewed in Jacobson et al., 2008). Fluorescent proteins such as enhanced Green Fluorescent Protein (eGFP) (McLean et al., 2009, Rajfur et al., 2002, Tanabe et al., 2005, Vitriol et al., 2007) and synthetic fluorophores like fluorescein or red biarsenical dye (ReAsH) (McLean et al., 2009, Tour et al., 2003, Yan et al., 2006, Guo et al., 2006, Marek and Davis, 2002, Lee et al., 2008) have been used to produce FALI.
FALI is mediated by the actions of singlet oxygen and is dependent on the irradiation energy (Horstkotte et al., 2005, McLean et al., 2009). Singlet oxygen is a reactive oxygen species (ROS) that can cause oxidation of tryptophan, tyrosine, methionine, histidine, and cysteine residues that may result in the cross-linking of residues (reviewed in Davies, 2003). The generation of singlet oxygen is a byproduct of all fluorescence in the presence of oxygen. Due to the close proximity of the fluorophore and the target protein, the singlet oxygen most likely reacts with the target protein (McLean et al., 2009). It has been suggested that FALI is specific to the protein labeled (Jay, 1988, Rajfur et al., 2002, Tanabe et al., 2005, Surrey et al., 1998, Yan et al., 2006, Marek and Davis, 2002, Tour et al., 2003). However, it has also been shown that FALI can lead to collateral damage to non-targeted proteins (Guo et al., 2006, Rahmanzadeh et al., 2007).
In this study, we identified robust constitutive internalization of recombinant 5-HT3A receptors expressed in HEK-293 cells and N1E-115 neuroblastoma cells in the absence of an agonist. Furthermore, we show that receptor internalization and function were attenuated by fluorophore assisted light inactivation.
Section snippets
α-bungarotoxin tagged 5-HT3A receptor construct
5-HT3A receptors were tagged with the binding sequence for α-bungarotoxin allowing us to label surface receptors with fluorescently conjugated α-bungarotoxin in live cells described previously (Sanders and Hawrot, 2004) and used by other groups (Wilkins et al., 2008, Sekine-Aizawa and Huganir, 2004, McCann et al., 2005, Guo et al., 2006). The bungarotoxin binding sequence (BBS) WRYYESSLEPYPD was added to the short extracellular c-terminus of the 5-HT3A receptor by primer addition PCR. The
Discussion
In the present study we were able to tag the 5-HT3A subunit with the α-bungarotoxin pharmatope tag (Sanders and Hawrot, 2004, McCann et al., 2005, Sekine-Aizawa and Huganir, 2004, Wilkins et al., 2008, Guo et al., 2006, Watschinger et al., 2008) on the extracellular carboxyl terminal. Using this method we were able to specifically label surface receptors in live cells with α-bungarotoxin conjugated to Alexa fluorophores. We show that 5-HT3A/BBS receptors are constitutively internalized in the
5-HT3A/BBS construct
The α-bungarotoxin binding sequence was added to the carboxyl terminal of the mouse 5-HT3A by primer addition PCR using the QuickChange system (Stratagene, USA). The stop codon was removed and the first bungarotoxin binding sequence were added using the following forward primer:
5′tggtccatttggcattatacttggagatactacgagagctccctggagccctaccctgactaatctagagggcccgtttaaacc3′
5′ggtttaaacgggccctctagattagtcagggtagggctccagggagctctcgtagtatctccaagtataatgccaaatggacca3′.
The second
Acknowledgments
We thank Dr. Henry H. Puhl III for the 5-HT3A/HA and the mGluR8/BBS constructs. We thank Dr. Stephen Vogel for use of the light power meter and comments on the manuscript. Thank you to Steve Ikeda for comments on the manuscript. And lastly, we thank Dr. Jennifer Gillette and Dr. Jennifer Lippincott-Schwartz for the use of the microscopes.
References (44)
Singlet oxygen-mediated damage to proteins and its consequences
Biochem. Biophys. Res. Commun.
(2003)The role of 5-HT3 receptors in drug dependence
Drug Alcohol Depend.
(1995)- et al.
Constitutive GABAA receptor endocytosis is dynamin-mediated and dependent on a dileucine AP2 adaptin-binding motif within the beta 2 subunit of the receptor
J. Biol. Chem.
(2003) - et al.
Specific decreases in ethanol – but not water-reinforced responding produced by the 5-HT3 antagonist ICS 205-930
Alcohol
(1993) - et al.
Chromophore-assisted laser inactivation in cell biology
Trends Cell Biol.
(2008) - et al.
A cluster of novel serotonin receptor 3-like genes on human chromosome 3
Gene
(2003) - et al.
Spatial specificity of chromophore assisted laser inactivation of protein function
Biophys. J.
(1992) - et al.
Transgenically encoded protein photoinactivation (FlAsH-FALI): acute inactivation of synaptotagmin I
Neuron
(2002) - et al.
Cloning, physical mapping and expression analysis of the human 5-HT3 serotonin receptor-like genes HTR3C, HTR3D and HTR3E
Gene
(2003) - et al.
5-HT(3) receptor antagonists and anxiety; a preclinical and clinical review
Eur. Neuropsychopharmacol.
(2000)
Electrophysiology of 5-HT3 receptors in neuronal cell lines
Trends Pharmacol. Sci.
A novel pharmatope tag inserted into the beta4 subunit confers allosteric modulation to neuronal nicotinic receptors
J. Biol. Chem.
Tracking cell surface GABAB receptors using an alpha-bungarotoxin tag
J. Biol. Chem.
Fluorophore-assisted light inactivation: a high-throughput tool for direct target validation of proteins
Proteomics
Chromophore-assisted light inactivation (CALI) using the phototoxic fluorescent protein KillerRed
Nat. Protoc.
The 5-HT3B subunit is a major determinant of serotonin-receptor function
Nature
Green fluorescent protein photobleaching: a model for protein damage by endogenous and exogenous singlet oxygen
Biol. Chem.
Fluorophore-assisted light inactivation produces both targeted and collateral effects on N-type calcium channel modulation in rat sympathetic neurons
J. Physiol.
Chemotherapy-induced nausea and vomiting
N. Engl. J. Med.
Toward understanding the mechanism of chromophore-assisted laser inactivation—evidence for the primary photochemical steps
Photochem. Photobiol.
Selective destruction of protein function by chromophore-assisted laser inactivation
Proc. Natl Acad. Sci. USA
Inactivation of clathrin heavy chain inhibits synaptic recycling but allows bulk membrane uptake
J. Cell Biol.
Cited by (7)
Optical manipulation of molecular function by chromophore-assisted light inactivation
2021, Proceedings of the Japan Academy Series B: Physical and Biological SciencesStimulus-Responsive Regulation of Enzyme Activity for One-Step and Multi-Step Syntheses
2019, Advanced Synthesis and CatalysisSingle-molecule labeling for studying trafficking of renal transporters
2018, American Journal of Physiology - Renal PhysiologyAgonist- and antagonist-induced up-regulation of surface 5-HT<inf>3</inf>A receptors
2015, British Journal of PharmacologyNeuronal phenotype dependency of agonist-induced internalization of the 5-HT<inf>1A</inf> serotonin receptor
2014, Journal of Neuroscience