Abstract
Memantine is a blocker of Ca2+-permeable glutamate and nicotinic acetylcholine receptors (nAChR). We investigated the action of memantine on cholinergic synaptic transmission at cochlear outer hair cells (OHCs). At this inhibitory synapse, hyperpolarization of the postsynaptic cell results from opening of SK-type Ca2+-activated K+ channels via a highly Ca2+-permeable nAChR containing the α9 subunit. We show that inhibitory postsynaptic currents recorded from OHCs were reversibly blocked by memantine with an IC50 value of 16 μM. RT-PCR revealed that a newly cloned nAChR subunit, α10, is expressed in OHCs. In contrast to homomeric expression, coexpression of α9 and α10 subunits in Xenopus laevis oocytes resulted in robust acetylcholine-induced currents, indicating that the OHC nAChR may be an α9/α10 heteromer. Accordingly, nAChR currents evoked by application of the ligand to OHCs and currents through α9/α10 were blocked by memantine with a similar IC50value of about 1 μM. Memantine block of α9/α10 was moderately voltage dependent. The lower efficacy of memantine for inhibition of inhibitory postsynaptic currents (IPSCs) most probably results from a blocking rate that is slow with respect to the short open time of the receptor channels during an IPSC. Thus, synaptic transmission in OHCs is inhibited by memantine block of Ca2+ influx through nAChRs. Importantly, prolonged receptor activation and consequently massive Ca2+ influx, as might occur under pathological conditions, is blocked at low micromolar concentrations, whereas the fast IPSCs initiated by short receptor activation are only blocked at concentrations above 10 μM.
The adamantane derivative 3,5-dimethyl-1-adamantanamine (memantine) is a well established blocker of ligand-gated ion channels permeable for Ca2+ such as the NMDA-type glutamate receptor (Chen et al., 1992; Parsons et al., 1993; Bresink et al., 1996) or nicotinic acetylcholine receptors (Buisson and Bertrand, 1998). In either case, memantine acts as an open channel blocker, that enters the channel pore and sterically occludes the ion pathway (Chen et al., 1992; Buisson and Bertrand, 1998). For NMDA-receptors, this pore-block strongly depends on the transmembrane voltage, with highest efficacy at hyperpolarized potentials (Bresink et al., 1996); for nAchRs, the voltage-dependence is less pronounced (Buisson and Bertrand, 1998). Therapeutically, memantine is used to prevent excitotoxic neuronal cell death associated with neurodegeneration and stroke and is induced by massive influx of Ca2+ through overactivated NMDA receptors (Chen et al., 1992; Parsons et al., 1999).
Cochlear outer hair cells (OHCs) are the central element of the active mechanical amplification mechanism that is crucial for the exquisite sensitivity and frequency-resolving capacity of the mammalian hearing organ (Dallos, 1992; Dallos and Evans, 1995). Mechanistically, this amplification is based on the ability of OHCs to alter their cell length in response to changes in membrane potential, a process that works at frequencies of up to at least 70 kHz (Brownell et al., 1985; Gale and Ashmore, 1997; Frank et al., 1999). Cochlear amplification is controlled by the cholinergic medial olivocochlear system that synapses onto OHCs (reviewed by Guinan, 1996). This inhibitory synapse uses an excitatory nAchR to supply the postsynaptic OHC with Ca2+ that initiates an inhibitory hyperpolarization by opening Ca2+-activated SK2 channels (Fig. 1A) (Fuchs and Murrow, 1992; Blanchet et al., 1996; Evans, 1996; Oliver et al., 2000).
The OHC nAChR contains the α9 subunit (Elgoyhen et al., 1994;Glowatzki et al., 1995; Vetter et al., 1999) and exhibits a high permeability for Ca2+ (Jagger et al., 2000; Katz et al., 2000). This high permeability allows for significant Ca2+ influx into the OHC that may lead to globally increased cytoplasmic [Ca2+] (Doi and Ohmori, 1993). In analogy to excitotoxic processes in CNS neurons, abnormally high Ca2+ levels may initiate or support degradation of OHC; loss of functional OHCs is well known to be a major cause of sensorineural hearing loss induced by various harmful stimuli including noise or ototoxic agents (Cody and Russell, 1985;Patuzzi et al., 1989). So far, it has been shown that Ca2+ entering through the nicotinic receptor can trigger structural alterations of OHCs, resulting in a decreased axial stiffness (Dallos et al., 1997; Sridhar et al., 1997), and elevated intracellular Ca2+ has been implicated in the impairment of OHC function after acoustic overstimulation (Fridberger et al., 1998). Here we test the effect of memantine on efferent synaptic transmission and Ca2+-influx in OHCs and investigate block of the nAChR as the mechanism underlying the observed inhibitory effects.
Materials and Methods
Patch-Clamp Recordings on Outer Hair Cells.
The apical turn of the organ of Corti was dissected from cochleae of three- to six-week-old Wistar rats as described previously (Oliver et al., 2000). The preparation was performed in a solution containing 144 mM NaCl, 5.8 mM KCl, 0.1 mM CaCl2, 2.1 mM MgCl2, 10 mM HEPES, 0.7 mM Na2HPO4, and 5.6 mM glucose, pH adjusted to 7.3 with NaOH. For recordings, OHCs located between half and one turn from the apex of the cochlea were chosen. If necessary, supporting cells were removed with gentle suction from a cleaning pipette carefully avoiding mechanical disturbance of the efferent nerve terminals.
Whole-cell, patch-clamp recordings were performed with an Axopatch 200B amplifier (Axon Instruments, Foster City, CA) at room temperature (22–25°C). Electrodes were pulled from quartz glass, had resistances of 2–3 MΩ and were filled with intracellular solution: 135 mM KCl, 3.5 mM MgCl2, 0.1 mM CaCl2, 5 mM EGTA, 5 mM HEPES, and 2.5 Na2ATP. For one series of experiments, an intracellular solution containing the Ca2+-chelator BAPTA was used: 120 mM KCl, 3.5 mM MgCl2, 10 mM BAPTA, 5 mM HEPES, and 2.5 mM Na2ATP. The pH of both solutions was adjusted to pH 7.3 with KOH. Membrane potential was corrected for the electrode junction potential (−4 mV). Whole-cell series resistance ranged from 4 to 9 MΩ and was not compensated. Currents were filtered at 1 kHz and sampled at 5 kHz.
The specimen were continuously superfused with extracellular solution (144 mM NaCl, 5.8 mM KCl, 2 mM CaCl2, 0.9 mM MgCl2, 10 mM HEPES, 0.7 mM Na2HPO4, and 5.6 mM glucose, pH adjusted to 7.3 with NaOH). Chemicals as well as depolarizing solutions were applied via a glass capillary (diameter approximately 80 μm) positioned close to the organ of Corti. For the depolarizing external solution, KCl was substituted for an equal amount of NaCl to result in [K+]ex of 47 mM. Memantine and acetylcholine (both from Sigma, St. Louis, MO) were added to the extracellular solution from aqueous stock solutions. To block the large OHC resting K+ current, Ik, n, 10 μM linopirdine (Sigma/RBI, Natick, MA) or 1–5 μM XE991 (obtained from DuPont Pharmaceuticals, Wilmington, DE) was added to the standard extracellular medium from stock solutions made with dimethyl sulfoxide (final concentration ≤ 0.1%) (Housley and Ashmore, 1992; Marcotti and Kros, 1999). XE991 is a M-current blocker (Wang et al., 1998) that inhibits Ik, nat submicromolar concentrations in a poorly reversible manner (D.O., unpublished observations).
Postsynaptic responses evoked by K+depolarization were quantified as the mean response over a 10-s period; current was baseline-subtracted, averaging started 5 s after switching to high K+ solution. Evaluation with this method included all postsynaptic events and yielded stable values for a given cell despite some variation in response time course between individual K+ applications.
Electrophysiology on Heterologously Expressed Channels.
AChR subunits and SK2 channels were heterologously expressed inXenopus laevis oocytes. Oocytes were surgically removed from adult females and dissected manually. Four to 5 days before electrophysiological recordings, Dumont stage VI oocytes were injected with about 50 ng RNA. For coexpression experiments, the total amount of RNA was kept constant and the different RNAs were coinjected in equal concentrations.
Two-electrode voltage-clamp measurements were performed with a TurboTec 01C amplifier (npi, Tamm, Germany), using microelectrodes of 0.1 to 0.5 MΩ filled with 3 M KCl. Extracellular medium was CaNFR, containing 115 mM NaCl, 2.5 mM KCl, 2 mM CaCl2, and 10 mM HEPES, pH adjusted to 7.3 with NaOH. For experiments in the absence of extracellular Ca2+, the extracellular solution was MgNFR (115 mM NaCl, 2.5 mM KCl, 2 mM MgCl2, and 10 mM HEPES, pH adjusted to 7.3 with NaOH). ACh and memantine were added from stock solutions and applied through an application system, that allowed solution exchange with a time constant of ≈1 s. Currents were filtered at 100 Hz and sampled at a frequency of 1 kHz.
Dose-inhibition relations obtained from electrophysiological experiments were fitted with the empirical Hill equation,I norm = 1 / [1 + (c / IC50)nH], whereI norm is the normalized current,c is the blocker concentration, IC50is the half-inhibitory concentration, andn H is the Hill coefficient.
Data analysis and fitting was performed with IgorPro (Wavemetrics, Lake Oswego, OR) on a Macintosh PowerPC. Unless stated otherwise, data are presented as mean ± S.D.
Molecular Biology.
The coding region of the rat α10 gene (GenBank accession no. AF196344) was amplified from rat brain cDNA by PCR using 5′- and 3′- adapter-primers containing suitable restriction sites (GAGACCCGGGAGCTCCACC, ATGGGGACAAGGAGCCACTACC, and GAGTCTAGATTACAGGGCTTGCACCAGTACAATG). The amplified fragments were subcloned into the X. laevis oocyte expression vector pGEM-HE (gift of Dr. J. Tytgat), yielding pGEM-HE-nAchR-α10, verified by sequencing. Capped mRNAs for α9, α10, and SK2 were synthesized in vitro using the mMESSAGE mMACHINE kit (Ambion, Austin, TX). To detect α10 and α9 transcripts, PCR was performed using reverse transcribed RNA isolated from either OHCs (containing some Deiters cells) or supporting cells (Deiters and Hensen's cells) as template. Cells were collected from rat organs of Corti using suction glass micropipettes (diameter 10 μm). RNA was prepared from ∼100 cells of each fraction using the QIAGEN RNeasy kit (QIAGEN, Hilden, Germany) according to the manufacturers' instructions. The oligonucleotides used as primers in the PCR reactions were chosen to span an intron in the human α9 and α10 genes to allow differentiation between products originating from cDNA and products originating from contaminating genomic DNA (α9 sense, CGTCCTCATATCGTTCCTCGCTCCG; α9 antisense, TGGTAAGGGCTGTGGAGGCAGTGA; α10 sense, GCAGCCTACGTGTGCAACCTCCTGC; and α10 antisense, AGGTGTCCCAGCAGGAGAACCCGAG). For each PCR reaction, RNA corresponding to ∼3 cells was used as template; the number of cycles was 40 for amplification of α9 and α10, and 30 for GAPDH used as a control.
Results
IPSCs were recorded from whole-cell voltage-clamped OHCs in acutely isolated organs of Corti during depolarization of the efferent presynaptic terminal with elevated extracellular [K+]. As shown previously, these IPSCs are K+-currents through SK2 channels activated by brief elevation of subsynaptic [Ca2+] (Oliver et al., 2000). Ca2+-transients are generated by the opening of postsynaptic nAChRs in response to presynaptically released ACh (Glowatzki and Fuchs, 2000; Oliver et al., 2000). In the presence of memantine, IPSCs were reversibly reduced in a concentration dependent manner (Fig. 1B). Data obtained from seven OHCs yielded a half-blocking concentration for memantine of 16.1 μM (Fig. 1C). Based on the known effect of memantine on ligand-gated ion channels, it seemed most likely that inhibition of the complex IPSCs resulted from block of Ca2+-entry via the nAChR. We therefore aimed at testing the action of memantine on the OHC nAChR expressed heterologously in X. laevis oocytes. However, application of 100 μM ACh to oocytes injected with α9-specific cRNA yielded very small currents (9.3 + 5.0 nA at −80 mV; Fig.2A), consistent with previous reports (Elgoyhen et al., 1994; Katz et al., 2000). No currents exceeding background levels were observed with the rat homolog of the α10 subunit, a member of the nAChR family recently identified by Boulter and colleagues (GenBank accession no. AF196344; Fig. 2, A and D). As shown in Fig. 2B by RT-PCR on OHCs isolated from the rat organ of Corti (see Materials and Methods), α10 mRNA is indeed present in these sensory cells, although it was not detected in the supporting cell fraction containing Hensen and Deiters cells. In a control experiment with RNA from OHCs that was not reverse transcribed, PCR amplified a fragment of ∼900 bp (Fig. 2B, lane 4) which most likely resulted from contamination with genomic DNA as the length of this fragment is in good agreement with the sequence defined by the primer pair in the human genome (bacterial artificial chromosome from chromosome 11; GenBank accession no. AC060812).
When both α9 and α10 were coexpressed in oocytes, large inward currents with peak amplitudes of up to −35 μA (at −80 mV) were recorded upon application of ACh (Fig. 2C, D). Similar to α9-mediated currents, the time-course was characterized by an initial transient declining to a smaller plateau of variable amplitude with respect to the peak current. The increase in current amplitude of more than 3 orders of magnitude (compared with homomeric α9 expression) together with the coexpression of α9 and α10 in OHCs suggest that heteromultimerization of both subunits is essential to give fully functional receptor channels. Moreover, the absence of any other of the known nAChR subunits (Morley et al., 1998) strongly suggests that the OHC nAChR is a heteromer composed of α9 and α10 subunits.
A characteristic feature of homomeric α9 channels is their exceptionally high Ca2+-permeability (Jagger et al., 2000; Katz et al., 2000). This Ca2+-permeability is thought to be essential for the OHC nAChR, since it allows for a Ca2+ influx sufficiently high to effectively activate SK-type potassium channels. However, high endogenous expression levels of Ca2+-activated Cl−-channels characterize the oocyte expression system (Stühmer and Parekh, 1995). Therefore, opening of Ca2+-permeable channels in an external medium containing Ca2+ leads to coactivation of a Cl− conductance. When external Ca2+ was substituted for Mg2+, currents induced by ACh application onto α9/α10 heteromeric channels were reduced by a factor of roughly 10 (Fig. 3A). Thus, a large fraction of the ACh-induced current measured in CaNFR was attributable to opening of Ca2+-activated Cl−-currents. This was also supported by the reversal potential of the current in CaNFR of about −25 mV (data not shown), close to the estimated Cl− equilibrium potential in X. laevis oocytes (Stühmer and Parekh, 1995). Consequently, α9/α10 heteromeric channels had a significant Ca2+-permeability, similar to what is known from homomeric α9 receptors. Application of ACh in the absence of extracellular Ca2+ allowed recording of α9/α10 currents in isolation. Heteromeric channels yielded currents that were 100-fold larger than currents recorded from α9 channels under the same conditions, confirming the large gain of receptor conductance by coexpression that was observed in the presence of external Ca2+ (Fig. 3, B and C). In the absence of Ca2+, α9/α10 also showed consistent kinetics characterized by slow desensitization on a time scale of seconds. Desensitization was not observed with α9 channels within the limits of the speed of solution exchange (Fig. 3B).
The action of memantine was tested on the isolated α9/α10 current in MgNFR. Memantine blocked this current in a completely reversible manner with an IC50 value of 1.6 μM and a Hill coefficient of 1.2 (Fig. 3, D and E). Channel block by memantine has been analyzed most extensively at NMDA-type glutamate receptors (Chen et al., 1992; Bresink et al., 1996), where block of the open pore is strongly voltage-dependent. To address the issue of blocking mechanism and voltage dependence at α9/α10 channels, current-voltage relations were determined from voltage ramps in the absence and presence of memantine (Fig. 3F). In either case, current-voltage curves were highly nonlinear and showed considerable rectification at negative and positive potentials. The reversal potential was −6.4 + 1.0 mV (n = 3), consistent with a nonspecific cation channel. As shown in Fig. 3F, memantine block was observed over the whole voltage range tested. It increased by a factor of 1.6 from +50 mV to −80 mV and thus exhibited only mild voltage-dependence. We also measured the impact of memantine on the chloride current, activated secondarily in the presence of external Ca2+. Memantine inhibited the peak chloride current with an efficiency not significantly different from block of the isolated α9/α10 current (Fig. 3E).
In hair cells, Ca2+ influx via nAChRs activates SK2 channels to give rise to IPSCs. Figure4 shows, that this activation cascade may be reconstituted in X. laevis oocytes by coexpression of the α9/α10 nAChR with SK2 channels. In oocytes expressing both channel species, application of ACh evoked a biphasic response at −70 mV. An initial inward current carried mainly by chloride (see above) was followed by an outward current due to the activation of SK2 channels (Fig. 4A). With the Cl− driving force largely abolished and an increased driving force for K+at a membrane potential of −30 mV, ACh induced a monophasic potassium outward current, similar to the response of isolated OHCs to ACh application (Blanchet et al., 1996; Evans, 1996). However, in coinjected oocytes, SK channel activation occurred considerably more slowly than in OHCs (20–80% rise time of 1.8 ± 0.2 s,n = 3). Memantine block of the SK2 current showed a dose-response relation that was characterized by an IC50 value of 0.7 μM and a Hill coefficient of 1.1 (Fig. 4, B and C), very similar to the values obtained for the memantine block of α9/α10 receptors (see Fig. 3E).
However, these values were considerably different from those obtained for memantine-induced inhibition of IPSCs in OHCs (Fig. 1C). Thus, inhibition of IPSCs required 10-fold higher concentrations of memantine than inhibition of SK2 currents in the oocyte system (Fig. 4C). This difference might suggest that the nAChR underlying the generation of IPSCs is less susceptible to memantine block than α9/α10 and may thus be indicative for a different subunit composition of OHC nAChRs. To test this possibility, we examined the effect of memantine on the nAChR of OHCs directly. AChR currents can be measured in isolation by uncoupling SK channel activation from Ca2+ influx via the nAChR with the fast Ca2+-chelator BAPTA (Fuchs and Murrow, 1992; Blanchet et al., 1996). Application of ACh to OHCs dialyzed with 10 mM BAPTA from the recording pipette induced inward currents of 110 ± 39 pA at −94 mV (n = 4). These currents were blocked by memantine with an IC50 value of 1.1 μM and a Hill coefficient of 0.9 (Fig. 5A, B). This affinity is in close agreement with the values obtained for the block of α9/α10 receptors and strongly suggests that the observed differences in blocking potency of memantine are not caused by a different receptor; instead, they may result from the specific mechanism of coupling between nAChRs and SK channels in OHCs.
Discussion
We have examined the action of memantine, a pore blocker of ligand gated ion channels, on inhibitory synaptic input to cochlear OHCs. It is shown that memantine abolishes IPSCs in the micromolar range by blocking Ca2+ entry via the OHC nAChR. To be able to analyze this block at the molecular level, we aimed to reconstitute the nAChR in a heterologous expression system.
Identity of the nAChR of OHCs.
The nAChR of OHCs has been shown to contain the α9 subunit by a variety of methods including in situ hybridization (Elgoyhen et al., 1994; Morley et al., 1998), single-cell RT-PCR (Glowatzki et al., 1995), transgenic expression of green fluorescent protein controlled by the α9 promoter (Zuo et al., 1999), and inactivation of the α9 gene (Vetter et al., 1999). Homomeric α9 receptors, however, yield remarkably small currents when heterologously expressed in X. laevis oocytes (Figs. 2A and3B; see also Elgoyhen et al., 1994), raising the possibility that an additional subunit is needed to yield the fully functional OHC receptor. However, OHCs lack any other known nAChR subtypes (Morley et al., 1998).
A GenBank search yielded a new subunit of the nAChR family (GenBank accession no. AF196344, submitted by J Boulter) designated α10. Therefore, we tested this subunit as a candidate subunit for the OHC receptor. RT-PCR using cDNA from OHCs as the template revealed that α10 is indeed expressed in these cells. Moreover, the robust currents measured in oocytes injected with RNAs coding for both α9 and α10 contrast with the lack of functional expression of homomeric α10 receptors and the weak expression of α9 receptors, indicating that both subunits assemble to functional heteromeric nAChRs. This conclusion is supported by the changed kinetics of the α9/α10 current compared with the current mediated by α9 alone. Taken together, these findings strongly suggest that both subunits form heteromeric α9/α10 receptors in OHCs.
The properties of α9/α10 receptors reported here, namely their sensitivity for memantine and their significant permeability for Ca2+, are in agreement with those of the OHC receptor. In particular, coexpression experiments showed that these receptors are able to effectively activate SK2 K+-channels, their primary function in OHCs.
Memantine Block of α9/α10 Receptors.
Heteromeric α9/α10 channels are reversibly blocked by memantine. This adamantane derivative is a well-characterized open-channel blocker of NMDA-type glutamate receptors with an IC50 value of around 1 μM (at −70 mV) and also blocks neuronal α4/β2 nAChRs with an IC50 value of 7 μM (at −100 mV) (Chen et al., 1992; Parsons et al., 1993; Buisson and Bertrand, 1998). Thus, the affinity for memantine of α9/α10 receptors (≈ 1 μM, see Figs. 3E and 5B) is considerably higher than of neuronal nAChRs and equals the affinity of NMDA receptors.
For NMDA receptors, however, this high affinity is observed only at hyperpolarized potentials because of the pronounced voltage dependence of the block [electrical distance (δ) of about 1; Bresink et al., 1996]. In contrast, block of α9/α10 receptors was only weakly voltage-dependent; i.e., the channels exhibit high affinity block over the entire voltage range tested (−100 to +50 mV) with only a moderate increase of blocking efficacy at negative voltages. The pore blocking observed with Mg2+ parallels this differential blocking by memantine. Although Mg2+ completely occludes NMDA receptors under physiological conditions for extracellular Mg2+ and membrane potential (Mayer et al., 1984; Burnashev et al., 1992), α9/α10 receptors are virtually left unchanged by Mg2+ as indicated by a lack of current decrease at negative potentials (Fig. 3F). Accordingly, amplitude or time-course of IPSCs in OHCs are not altered by removal of extracellular Mg2+ (D.O., unpublished observation).
The sensitivity of OHC IPSCs for inhibition by memantine was an order of magnitude lower than the sensitivity of the receptor itself (Figs.1C and 5B). This divergence may be explained by considering the blocking mechanism of memantine. As an open channel blocker, it will enter and occlude the pore only after the channel is opened by the ligand. AChRs underlying IPSCs open for some 20 ms, and complete activation of SK2 channels occurs within 10 ms after onset of the nAChR current (Oliver et al., 2000). Thus, memantine must occlude the channel within milliseconds to effectively block IPSCs. Consequently, blocking efficacy will be determined more by the on-rate of the pore block than by the equilibrium affinity of the blocker that was measured with steady-state nAChR currents. Because the blocking time constant decreases with the blocker concentration, efficacy of inhibition of fast IPSCs will increase with concentration of memantine. Blocking time constants on the order of seconds, as suggested by fast application of memantine at half-blocking concentration to open α4/β2 nAChRs (see Fig. 6B in Buisson and Bertrand, 1998), indicate that blocking speed may indeed be limiting for the inhibition of fast IPSCs. In accordance with this consideration, the increased Hill coefficient of 2 with respect to n H≈ 1 in all steady-state measurements suggests that inhibition of IPSCs is not determined by a simple steady-state pore block.
Action of Memantine on Cochlear Efferent Transmission.
The block of OHC synaptic transmission by memantine establishes an impact on cochlear physiology by a drug that is used therapeutically (Parsons et al., 1999). The olivocochlear system acts on the cochlea by reducing its response to acoustic stimulation on two time scales. A “fast effect” caused by the quick opening of Ca2+-activated K+ channels by the nAChRs is followed by a slower effect, which is thought to involve second-messenger systems (Sridhar et al., 1995, 1997). Because the most obvious effect of memantine is the block of fast IPSCs, it can be expected to block the fast efferent effect, based on SK2 channel opening. Moreover, because this inhibition is caused by abolishment of Ca2+-influx via the OHC nAChR, the second, slower efferent effect that is thought to be triggered by the Ca2+ influx in the same synaptic events (Sridhar et al., 1997) is also expected to be blocked by memantine.
Memantine is used therapeutically to prevent excitotoxic neuronal cell death triggered primarily by massive Ca2+ influx via overstimulated NMDA-type glutamate receptors (Chen et al., 1992;Parsons et al., 1999). Loss or damage of OHCs in the cochlea is well known to be a major cause of sensorineural hearing loss (Cody and Russell, 1985; Patuzzi et al., 1989). The mechanisms of OHC degeneration are not fully understood, but in analogy to neurons it may be hypothesized that Ca2+-influx might contribute to this process. The main sources for Ca2+-influx into OHCs are mechanoelectrical transducer channels and P2X purinoceptors at the apex and nAChRs at the basal pole. Intracellular rise in [Ca2+] is thought to be highly localized to the respective entry site under physiological conditions (Lenzi and Roberts, 1994; Oliver et al., 2000). However, acoustic overstimulation has been shown to result in globally increased cytoplasmic Ca2+ levels of OHCs that coincide with an impairment of cochlear function (Fridberger et al., 1998). Moreover, Ca2+ signals induced by synaptic activity can trigger second-messenger mediated processes that may involve secondary release of Ca2+ from internal stores (Sridhar et al., 1995; Dallos et al., 1997; Sridhar et al., 1997). These processes, which probably underlie the slow efferent effect, are thought to act protectively under physiological conditions (Sridhar et al., 1995). However, if Ca2+ influx could reach a toxic scale [e.g., during a tonic ACh release from efferent terminals due to K+-depolarization as thought to occur in Ménière's disease (Dohlman, 1980)], block of nAChRs by memantine might exert a protective effect. It is important to note, that such a prolonged Ca2+-influx is blocked by memantine with a 10-fold higher sensitivity than the fast physiological IPSCs, as outlined above.
In conclusion, memantine is well suited to impair the efferent cochlear physiology as well as to prevent pathological massive Ca2+ influx at doses that are used to affect its primary therapeutical target, the NMDA receptor. While this article was being considered for publication, an article by Elgoyhen et al. (2001)appeared in print that supports the conclusion of the OHC nAChR being composed of at least α9 and α10 subunits.
Acknowledgments
We thank S. Eble and S. Weidemann for excellent technical assistance and Dr. C. Kros for the gift of linopirdine.
Footnotes
-
This work was supported by grants from the Human Frontier Science Program (RG0233) and the Deutsche Forschungsgemeinschaft (SFB 430, project A1) to B. F.
Abbreviations
- memantine
- 3,5-dimethyl-1-adamantanamine
- NMDA
- N-methyl-d-aspartate
- OHC
- outer hair cell
- nAChR
- nicotinic acetylcholine receptor
- BAPTA
- 1,2-bis(o-aminophenoxy)ethane-N,N,N′,N′-tetraacetic acid
- IPSC
- inhibitory postsynaptic current
- ACh
- acetylcholine
- RT-PCR
- reverse transcriptase-polymerase chain reaction
- Received January 25, 2001.
- Accepted April 5, 2001.
- The American Society for Pharmacology and Experimental Therapeutics