Skip to main content

Main menu

  • HOME
  • CONTENT
    • Early Release
    • Featured
    • Current Issue
    • Issue Archive
    • Collections
    • Podcast
  • ALERTS
  • FOR AUTHORS
    • Information for Authors
    • Fees
    • Journal Clubs
    • eLetters
    • Submit
  • EDITORIAL BOARD
  • ABOUT
    • Overview
    • Advertise
    • For the Media
    • Rights and Permissions
    • Privacy Policy
    • Feedback
  • SUBSCRIBE

User menu

  • Log in
  • My Cart

Search

  • Advanced search
Journal of Neuroscience
  • Log in
  • My Cart
Journal of Neuroscience

Advanced Search

Submit a Manuscript
  • HOME
  • CONTENT
    • Early Release
    • Featured
    • Current Issue
    • Issue Archive
    • Collections
    • Podcast
  • ALERTS
  • FOR AUTHORS
    • Information for Authors
    • Fees
    • Journal Clubs
    • eLetters
    • Submit
  • EDITORIAL BOARD
  • ABOUT
    • Overview
    • Advertise
    • For the Media
    • Rights and Permissions
    • Privacy Policy
    • Feedback
  • SUBSCRIBE
PreviousNext
ARTICLE, Behavioral/Systems

Elimination of the ρ1 Subunit Abolishes GABACReceptor Expression and Alters Visual Processing in the Mouse Retina

Maureen A. McCall, Peter D. Lukasiewicz, Ronald G. Gregg and Neal S. Peachey
Journal of Neuroscience 15 May 2002, 22 (10) 4163-4174; DOI: https://doi.org/10.1523/JNEUROSCI.22-10-04163.2002
Maureen A. McCall
1Departments of Psychological and Brain Sciences,
2Ophthalmology and Visual Sciences, and
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
Peter D. Lukasiewicz
4Department of Ophthalmology and Visual Sciences, Washington University, St. Louis, Missouri 63110,
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
Ronald G. Gregg
2Ophthalmology and Visual Sciences, and
3Biochemistry and Molecular Biology, University of Louisville, Louisville, Kentucky 40292,
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
Neal S. Peachey
5Cleveland Veterans Affairs Medical Center, Cleveland, Ohio 44106,
6Cole Eye Institute, Cleveland Clinic Foundation, Cleveland, Ohio 44195, and
7Department of Neurosciences, Case Western Reserve University, Cleveland, Ohio 44106
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
  • Article
  • Figures & Data
  • Info & Metrics
  • eLetters
  • PDF
Loading

Abstract

Inhibition is crucial for normal function in the nervous system. In the CNS, inhibition is mediated primarily by the amino acid GABA via activation of two ionotropic GABA receptors, GABAA and GABAC. GABAA receptor composition and function have been well characterized, whereas much less is known about native GABAC receptors. Differences in molecular composition, anatomical distributions, and physiological properties strongly suggest that GABAA receptors and GABAC receptors have distinct functional roles in the CNS. To determine the functional role of GABAC receptors, we eliminated their expression in mice using a knock-out strategy. Although native rodent GABAC receptors are composed of ρ1 and ρ2 subunits, we show that after ρ1 subunit expression was selectively eliminated there was no GABAC receptor expression. We assessed GABAC receptor function in the retina because GABAC receptors are highly expressed on the axon terminals of rod bipolar cells and because this site modulates the visual signal to amacrine and ganglion cells. In GABACρ1 null mice, GABA-evoked responses, normally mediated by GABAC receptors, were eliminated, and signaling from rod bipolar cells to third order cells was altered. These data demonstrate that elimination of the GABACρ1 subunit, via gene targeting, results in the absence of GABAC receptors in the retina and selective alterations in normal visual processing.

  • knock-out
  • rod bipolar cell
  • electroretinogram
  • IPSC
  • whole-cell patch clamp
  • TPMPA
  • ionotropic receptor
  • chloride channel
  • inhibition

In the CNS, inhibition is mediated primarily by GABA, which activates two ionotropic GABA receptors, GABAA and GABAC (Sivilotti and Nistri, 1991). GABAA and GABAC receptors are molecularly distinct, differing in both subunit composition and subunit complexity (GABAA: α1–6, β1–3, γ1–3, δ, ε, and π subunits; GABAC: ρ1–3 subunits) (for review, see Enz, 2001; Moss and Smart, 2001; Zhang et al., 2001). In addition, each receptor type or subtype forms a chloride channel whose pharmacology, current kinetics, and affinities for GABA differ. Most CNS neurons express GABAA receptors, and many express more than one subtype (Persohn et al., 1992; Wisden and Seeburg, 1992; Fritschy et al., 1998). In contrast, GABAC receptors are simpler (Enz and Cutting, 1999a; Zhang et al., 2001), and their expression is more restricted (Johnston, 1994; Boue-Grabot et al., 1998; Rozzo et al., 1999), primarily to the terminals of a class of retinal interneurons, the bipolar cells (Enz et al., 1996; Lukasiewicz, 1996; Koulen et al., 1997; Boue-Grabot et al., 1998; Feigenspan and Bormann, 1998; Fletcher et al., 1998; Wassle et al., 1998).

Both GABAA and GABACreceptors modulate inhibition in the retina (Lukasiewicz and Shields, 1998). In particular, the GABAC receptors are thought to modulate the response properties of retinal ganglion cells, such as their center-surround antagonism, the sustained or transient nature of their responses, and contrast gain (Thibos and Werblin, 1978;Lukasiewicz and Werblin, 1994; Pan and Lipton, 1995; Cook and McReynolds, 1998a,b; Dong and Werblin, 1998; Bloomfield and Xin, 2000;Flores-Herr et al., 2001). The relatively restricted expression of GABAC receptors and their late expression in postnatal development (Greka et al., 2000) make them particularly amenable for study using gene targeting.

We inactivated the gene encoding the GABACρ1 subunit in mice and investigated the effects of the elimination of this subunit in the retina. We assessed the specific roles of GABAC receptors in the inhibitory circuit mediated by the rod bipolar cell. Overall retinal and rod bipolar cells to cell morphology were intact, and both electrophysiological and immunohistochemical experiments showed that eliminating expression of the ρ1 subunit eliminated expression of the GABAC receptor. Electroretinogram (ERG) measurements showed that only inner retinal function was altered in GABACρ1 null mice, a result consistent with an alteration in the balance of excitation and inhibition between second and third order retinal neurons. These data show that the GABAC receptor is not expressed in the retina of GABACρ1 null mice and represent the first use of gene targeting to alter inhibition in a specific retinal circuit. These mice will allow us to enhance our understanding of the role of GABAC receptor-mediated inhibition in visual processing.

MATERIALS AND METHODS

Production of GABACρ1 null mice

Targeting vector

A P1 clone was identified using a PCR strategy with two primers within the 3′ end of the cDNA encoding the GABACρ1 subunit gene and was purchased from IncyteGenomics. From this genomic clone, two fragments of the GABACρ1 subunit gene were isolated: an 18 kbpHindIII fragment containing the promoter, exon 1, and a portion of intron 1, and a 2.2 kbp EcoRI–XhoI fragment containing exon 10 and part of the 3′ untranslated region (see Fig. 1A). These fragments were used to construct the targeting vector (see Fig. 1B), which consisted of four cassettes: a 4.4 kbp 5′ homology unit, which included 4.0 kbp of the GABACρ1 promoter, exon 1 (220 bp) and 210 bp of intron 1; a 1.4 kbp 3′ homology unit from the 3′ untranslated region of the gene, and two selectable markers, a neomycin resistance gene (neo) and a thymidine kinase gene (TK) in pBluescript (Stratagene, La Jolla, CA). When homologous recombination occurs (see Fig. 1A, dashed Xs), exons 2–9 are replaced with the neo cassette, yielding the modified locus (see Fig. 1C).

Production of targeted embryonic stem cells and GABACρ1 null mice

The general strategy for the production of targeted embryonic stem (ES) cells has been described previously (McCall et al., 1996a). Five micrograms of the GABACρ1 targeting vector was linearized by digestion with SalI and introduced via electroporation into 5 × 106 HM-1 ES cells. Two hundred and thirty-two G418 and 1-(2′-deoxy-2′-fluoro-β-d-arabinofuranosyl)-5-iodouracil-resistant ES cell clones were analyzed by PCR to determine which were correctly targeted on the 3′ end. The primers (indicated byarrows, labeled 3F and 3R) were located in the neo gene and in the 3′ end of the GABACρ1 cognate gene (see Fig. 1C). Their sequences were 3F: 5′ CGTTGGCTACCCGTGATATT 3′; 3R: 5′ GAATTCCAGACTGACCCGCTTCT 3′. PCRs contained: 1× Gitschier buffer (Kogan et al., 1987) and Taq Enhancer, 1 U Taqpolymerase (Eppendorf, Hamburg, Germany), 0.5 μm of each primer, 0.15 mm dNTP, and 25–50 ng of DNA in a final volume of 25 μl. Cycling conditions for all PCRs were determined empirically, but in general were: 2 min at 94°C, followed by 30 cycles of 1 min at 94°C, 1 min at the annealing temperature, and 2 min at 72°C, followed by a final incubation for 10 min at 72°C. Amplified samples were analyzed by agarose gel electrophoresis. A 2.2 kbp fragment was amplified in three of the 232 ES cell clones, indicating correct targeting at the 3′ end of the gene (see Fig.2B).

Southern blotting was used to determine which of the three ES cell clones were correctly targeted on the 5′ end (see Fig.2A). Genomic DNA from each ES cell was digested withHindIII, size separated by agarose gel electrophoresis, denatured, and transferred to a nylon membrane. The membrane was hybridized at 65°C with a 32P radioactively labeled probe from the 5′ end of the gene, outside of the region of homology. One correctly targeted ES cell clone, E11 (see Fig.2A) was identified and contained an 18 kbpHindIII fragment from the cognate gene [wild-type (WT)] and a 12 kbp HindIII fragment representing the targeted allele (Target). This clone was expanded and used for blastocyst injections.

Production of GABACρ1 null mice

All procedures using animals were approved by the Institutional Animal Care and Use Committees at each institution. The expanded ES cell clone was injected into C57BL/6J blastocysts at the Transgenic Facility at the University of Wisconsin. Three male chimeric founders transmitted the GABACρ1 targeted allele through the germline and were crossed to C57BL/6J females to produce mice heterozygous for the targeted allele. The heterozygotes were intercrossed, and their offspring were genotyped by PCR for the deleted (WT) and targeted (Target) alleles (see Fig. 2C). DNA for the PCRs was isolated from tail biopsies of each offspring using Chelex 100 resin (Bio-Rad, Hercules, CA) (McCall et al., 1996b). The location of the primers (indicated by arrows) for the WT allele are shown in Figure 1A and for the targeted allele (Target) in Figure 1C. Their sequences were WT F: 5′ CAGGGACAATCGGCTGTAGG 3′ and R: 5′TTGTTGGAGCTGGGGAAAGA3′ and Target F: 5′CCACATGAAGCAGCACGA 3′ and R: 5′AGGATGTTGCCGTCCTCCTT3′. The composition of the PCR solution and cycling conditions are described above.

Histology

Light microscopy

Retinal tissue was prepared as described previously (McCall et al., 1996b). Mice were killed by anesthetic overdose, and their eyes were removed and fixed by immersion in 4% paraformaldehyde in 0.1 m phosphate buffer (PB), pH 7.4, for 18 min, and the fixed eyecups were rinsed (three times for 10 min each) in 0.1 m PB. For plastic sections, eyecups were dehydrated through a graded series of alcohols (70, 80, 90, and 95%) for 1 hr each and infiltrated overnight in JB-4 (Electron Microscopy Sciences, Fort Washington, PA). The eyecups were then submerged in JB-4 plus polymerizer in BEEM capsules. After the plastic had hardened, 1 μm transverse sections were cut on an ultramicrotome, stained with cresyl violet, and coverslipped. Images were captured on a Nikon Optiphot-2 with a cooled CCD camera and associated software (Spot 2; Diagnostic Instruments, Sterling Heights, MI).

Immunohistochemistry

Eyecups were prepared and fixed as described above. The retinas were dissected out of the eyecup, cryoprotected through a graded series of sucrose, and frozen in OCT–20% sucrose (at a ratio of 2:1) (Barthel and Raymond, 1990). For most experiments the retinas from WT and GABACρ1 null littermates were sandwiched together, embedded in the same mold, and when cut and mounted onto slides were separated at most by 150 μm. Sixteen micrometer sections were cut on a cryostat and mounted onto slides and stored at −70°C. Before immunohistochemistry the slides were warmed to 37°C and washed in 0.1 m PB three times for 15 min. Sections were incubated in 0.5% Triton X-100 in 0.1 m PB (PBX), followed by incubation at room temperature (RT) for 1 hr in a blocking solution consisting of 10% normal goat serum in PBX. Sections were incubated overnight at RT in one of the following primary antibodies diluted in blocking solution: anti-PKC [1:1000 (rabbit polyclonal antibody to α isoenzymes (Amersham Biosciences, Arlington Heights, IL) and anti-GABAC [1:100 (rabbit polyclonal antibody to GABACρ1, ρ2, and ρ3 subunits of the receptor (Enz et al., 1995)]. The sections were rinsed in 0.5% PBX for 1 hr at RT before incubation with fluorescent secondary antibody (either anti-rabbit Alexa 488 or 546; Molecular Probes, Eugene, OR) diluted 1:1000 in blocking solution for 1 hr at RT. The sections were rinsed three times for 5 min in PB and then coverslipped with Immumount (Shandon, Pittsburgh, PA). As a control, primary antibodies were omitted from sections on one slide. The protocols for double labeling were similar to those described above, with each primary and secondary antibody incubated sequentially.

Confocal images were acquired using the Zeiss (Oberkochen, Germany) LSM 510 laser-scanning microscope equipped with an Argon and a HeNe laser. Images were captured using a Plan-Apochromat 63×/1.4 water immersion objective. Laser lines and emission filters were optimized with theZeiss LSM510 software. High-resolution scanning was performed at 1024 × 1024 pixels. Confocal images were analyzed, and brightness and contrast were adjusted using the LSM510 analysis package. Serial optical sections (n = 5), collapsed into a single plane, are shown in Figure 4A–C (z-axis step size, 0.6 μm).

Electrophysiology

Patch-clamp experiments

Preparation of mouse retinal slices. The experimental techniques were identical to those described for studies in ferret retinal slices (Lukasiewicz and Wong, 1997; Shields et al., 2000). Briefly, mice aged postnatal day 28 to adult were killed using carbon dioxide, and their eyes were enucleated. The cornea, lens, and the vitreous were removed, and the retina was dissected in cold, oxygenated extracellular medium (see Electrode and bath solutions). Slices were prepared as previously described and maintained in oxygenated media at room temperature (Werblin, 1978; Lukasiewicz and Wong, 1997).

Whole-cell patch recordings. Whole-cell patch recordings were obtained from rod bipolar cells in the mouse retinal slices. IPSCs were recorded when rod bipolar cells were voltage clamped to 0 mV, the reversal potential for nonspecific cation currents. Rod bipolar cells were identified by their characteristic morphology after filling them with Lucifer yellow (0.015%), which was included in the recording electrode (Euler and Wassle, 1998; Shields et al., 2000) (see Fig.4D,E). The recording procedures and microscope system have been described in detail previously (Lukasiewicz and Roeder, 1995). Electrodes were pulled from borosilicate glass (1B150F-4; World Precision Instruments, Sarasota, FL) on a P97 Flaming–Brown puller (Sutter Instruments, Novato, CA) and had measured resistances of <5 MΩ. Patchit software (White Perch Software, Somerville, MA) was used to generate voltage command outputs, acquire data, gate the drug perfusion valves, and trigger the Picospritzer (General Valve, Fairfield, NH). The data were digitized and stored with a Pentium personal computer using a Labmaster DMA data acquisition board (Scientific Solutions, Solon, OH). Responses were filtered at 1 kHz with the four-pole Bessel low-pass filter on the Axopatch 200B (Axon Instruments, Foster City, CA) and sampled at 1–2 kHz.

Data analysis. Tack software (White Perch Software) was used to average records and to measure the peak amplitude, decay time, and charge transfer for each cell. The decay time was measured by computing the D37, the time at which the current has declined to 37% of its peak amplitude. Student's t tests (two-tailed, unequal variance) were used to compare these aspects of the current from WT and GABACρ1 null rod bipolar cells. To obtain the mean current for each cell, three to five leak-subtracted responses were averaged. Data in the text and figure legends are expressed as mean ± SE. Measures of the current from individual cells obtained in the presence of GABAA and GABAC receptor antagonists and after drug wash out were normalized to the predrug, control current.

Solutions and drugs. The standard bathing medium (normal mouse Ringer's solution) contained (in mm): 137 NaCl, 5 KCl, 1 MgCl2, 2.5 CaCl2, 28 glucose, and 10 HEPES. The standard intracellular electrode solution for puff experiments consisted of (in mm): 120 Cs gluconate, 1 CaCl2, 2 MgCl2, 10 Na HEPES, 11 EGTA, and 30 glucose, adjusted to a pH of 7.2 with CsOH. Unless otherwise indicated, all chemicals were obtained from Sigma (St. Louis, MO).

The control bathing solution used in these slice experiments was formulated to pharmacologically isolate rod bipolar cell responses to GABA. In all experiments, glycine receptors were antagonized with strychnine (10 μm), AMPA–kainate (AMPA–KA) receptors were blocked with 6-cyano-7-nitroquinoxaline-2,3-dione (10 μm) (NBQX), and NMDA receptors were blocked withd-2-amino-5-phosphonopentenoic acid (d-AP5) (50 μm). NBQX and d-AP5 were both obtained from Precision Biochemicals (Vancouver, British Columbia, Canada). GABAA receptors were antagonized with bicuculline methbromide (either 200 or 500 μm), and bicuculline-resistant GABA responses were blocked with (1,2,5,6-tetrahydropyridine-4yl) methyphosphinic acid (50 or 100 μm) (TPMPA; RBI, Natick, MA). Antagonists were applied to a region of the slice under study (several millimeters in width) by a gravity-driven superfusion system described previously (Lukasiewicz and Roeder, 1995).

Puffing agonist onto bipolar cell terminals. GABA (100–300 μm) was puffed onto the terminals of bipolar cells in the inner plexiform layer (IPL) in the slice preparation with a Picospritzer at 45 or 60 sec intervals. The pipette was positioned near the Lucifer yellow-labeled axon terminal to optimize the response of the cell to the puff, by minimizing response rise time and maximizing response amplitude. The puff pressure and duration (typically 10–30 msec) were then adjusted to give no larger than a half-maximal response. Because the slice was continuously superfused, which diluted the puff, and because puff duration and pressure were submaximal, the GABA concentration at the receptors was most likely much lower than the pipette concentration.

Electroretinography. The methods used to prepare the mice for electroretinography are similar to those described in detail previously (Pardue et al., 1998; Xu et al., 2000). After overnight dark adaptation, anesthesia was induced with an intramuscular injection of a mixture of ketamine–xylazine in saline (80 mg/kg; 16 mg/kg, respectively). Eye drops were used to dilate the pupils (2.5% phenylephrine HCl, 1% mydriacyl, 1% cyclopentolate). For ERG recordings, body temperature was maintained using a heating pad. Retinal responses were recorded using a stainless steel wire contacting the corneal surface through a layer of 1% methylcellulose, and electrodes were placed in the cheek and tail to serve as reference and ground leads, respectively. ERG responses were obtained to strobe flash stimuli presented in the dark. Flash intensities ranged from −4.4 to 5.0 log cd sec/m2 and interstimulus intervals increased from 1.4 sec at lower intensities to 45 sec at the highest stimulus levels. Stimuli were presented in order of increasing intensity, and at least two responses were averaged at each flash intensity. ERG responses were differentially amplified using a frequency bandpass setting of 0.5–1500 Hz, and the frequency bandpass was changed to 30–1500 Hz to isolate the oscillatory potentials (OPs). Responses were averaged and stored using an LKC UTAS E-2000 (Gaithersburg, MD) signal averaging system. The amplitude of the a-wave was measured from the prestimulus baseline to the a-wave trough. The amplitude of the b-wave was measured from the a-wave trough to the peak of the b-wave. Time-to-peak (implicit time) was measured from the time of flash onset to the a-wave trough or the b-wave peak. Individual OP wavelets were measured from the initial negative trough to the positive peak. An ANOVA with repeated measures was used to determine statistical significance between these measures in the ERGs of WT and GABACρ1 null mice.

RESULTS

Homologous recombination disrupts the expression of the GABACρ1 subunit

Figure 1 illustrates the targeting scheme used to eliminate the expression of the GABACρ1 subunit gene. After homologous recombination, ES cells that were heterozygous for the modified locus were identified, using Southern blotting, for the 5′ homology unit (Fig. 2A) and PCR for the 3′ homology unit (Fig. 2B). Injections of the expanded ES clone into C57BL/6J blastocysts generated three male germline chimeras that were crossed to C57BL/6J mice and produced heterozygous offspring. These heterozygous mice were intercrossed, and their progeny were genotyped by PCR (Fig. 2C). The GABACρ1 null offspring resulting from these crosses were viable and fertile. Because the genetic background of these mice is a mixture of C57BL/6J and SV129 Olah, all comparisons are made between GABACρ1 null mice and their WT littermates.

Fig. 1.
  • Download figure
  • Open in new tab
  • Download powerpoint
Fig. 1.

The GABACρ1 subunit gene structure, targeting vector design, and the GABACρ1 subunit gene modified by homologous recombination. Schematic representations of the wild-type locus of the GABACρ1 subunit gene (A), the targeting vector used to inactivate the GABACρ1 subunit gene (B), and the modified locus for this gene that results from homologous recombination between the targeting vector and the cognate GABACρ1 subunit gene (C). (Diagrams are not drawn to scale.) The targeting vector (B) consists of two selection cassettes: the neomycin gene (neo) and the thymidine kinase gene (TK) as well as a 4.4 kbp 5′ homology unit that included the GABACρ1 subunit promoter, exon 1, and a portion of intron 1 and a 1.4 kbp 3′ homology unit that included the 3′UTR of the gene. When homologous recombination occurs between the targeting vector and the cognate gene (large Xs) exons 2–9 are replaced by the neo cassette resulting in the modified allele (C).

Fig. 2.
  • Download figure
  • Open in new tab
  • Download powerpoint
Fig. 2.

Characterization of embryonic stem cells and mice that carry the GABACρ1 targeted allele.A, Scanned images of Southern blots of genomic DNA isolated from WT and from WT ES cells (HM1), a targeted ES cell line (E11), a wild-type (WT), and a GABACρ1 null (Null) mouse. Genomic DNAs were digested withHindIII and separated by size using agarose gel electrophoresis. DNA was transferred to nylon membrane and hybridized to radiolabeled Probe 1 (Fig. 1A). The probe hybridizes to an 18 kbp HindIII fragment from the WT locus in DNA from untransfected ES cells and the WT mouse. The probe hybridizes to both the 18 kbp WT allele and a 12 kbp fragment in DNA from ES cell clone (E11) representing the presence of a targeted allele. Thus, E11 is correctly targeted on the 5′ end of the gene. A single 12 kbp fragment in the DNA from the GABACρ1 null mouse indicates the presence of only targeted alleles. B, PCR results indicating that ES cell clone, E11, is correctly targeted on the 3′ end of the GABACρ1 subunit gene. Arrows on the drawing of the modified locus (Fig. 1C) indicate the positions of the primers 3F/3R for this PCR, which amplified a 2.2 kbp fragment from within the neo gene through the 3′ UTR of the GABACρ1 subunit gene, indicative of correct targeting on the 3′ end. mm, Molecular weight marker;A10, non-targeted ES cell clone; E11, targeted ES cell clone; −, negative control, no DNA added to the reaction. C, PCR results indicating the genotypes of five littermates resulting from a cross between two mice heterozygous for the targeted allele. The primers for these PCRs are indicated in Figure 1A (WT F/R: located in intron 4 and exon 5) and Figure 1C (Target F/R: located in exon 1 and the neo gene) and amplify only wild-type (WT) fragments in WT mice, only targeted fragments (Target) in GABACρ1 null (Null) mice, and both fragments in heterozygous (Het) mice.

Retinal morphology is normal in GABACρ1 null mice

Experimental manipulations that eliminate a particular cell class or signaling pathway frequently cause neuronal loss and/or developmental abnormalities (McCall et al., 1996b; Peachey et al., 1997; Jiang et al., 1998; Rohrer et al., 1999). To determine if elimination of the GABACρ1 subunit altered retinal anatomy, we examined transverse sections of the retina of WT (Fig. 3A) and GABACρ1 null (Fig. 3B) mice at the light microscopic level. We found no differences in the overall morphology or laminar thickness between of the retinas of these mice, indicating that eliminating the expression of the GABACρ1 subunit did not alter retinal neurons or their processes.

Fig. 3.
  • Download figure
  • Open in new tab
  • Download powerpoint
Fig. 3.

Retinal morphology in GABACρ1 null mice is normal. Representative photomicrographs of 1 μm transverse, plastic sections of retina stained with cresyl violet from a WT littermate (A) and a GABACρ1 null mouse (B). No obvious differences are seen in the overall structure of any of the retinal layers or in the gross morphology of the cell bodies within the retinal layers.PE, Pigment epithelium; IS/OS, inner segments and outer segments of the photoreceptors; ONL,outer nuclear layer; OPL, outer plexiform layer;INL, inner nuclear layer; IPL, inner plexiform layer; GCL, ganglion cell layer.

Elimination of the GABACρ1 subunit results in the absence of retinal GABAC receptors

The GABAC receptor in rodent retina is thought to be a hetero-oligomeric channel, comprised of both ρ1 and ρ2 subunits, and is expressed primarily on the axon terminals of the rod bipolar cells (Enz et al., 1995; Zhang et al., 1995). To confirm that gene targeting eliminated expression of the ρ1 subunit and to determine if expression of any other ρ subunits was present, we compared the expression of the GABAC receptors in the retinas of GABACρ1 null and WT mice. Rod bipolar cells were identified using an antibody to protein kinase C (PKC) (Wassle et al., 1991), and the expression of GABAC receptor was characterized using a rabbit polyclonal antibody that recognizes all three of the GABACρ subunits (Enz et al., 1995). Figure4A is a confocal image of a transverse section through a WT mouse retina. PKC immunoreactivity (green) outlines the entire rod bipolar cell and GABAC receptor-immunoreactivity (red) produces a characteristic punctate staining pattern in the IPL. These puncta decorate the axon terminals of rod bipolar cells in the IPL, and to a lesser extent, their dendritic processes in the outer plexiform layer (OPL) (Enz et al., 1995; Koulen et al., 1998; Haverkamp and Wassle, 2000). The presence of GABAC receptors on the dendrites of the bipolar cells in the OPL, evident in the WT mice, also has been observed previously (Picaud et al., 1998; Haverkamp and Wassle, 2000; Vitanova et al., 2001). The rod bipolar cells in GABACρ1 null mice also are immunoreactive for PKC and have a similar morphology to that seen in WT mice. In contrast, no GABAC receptor immunoreactivity was evident in the GABACρ1 null mouse retina (Fig.4B). Figure 4C shows that there is little nonspecific GABAC receptor immunoreactivity in WT control sections when the GABAC receptor primary antibody is omitted from the reaction. These data indicate that the absence of the GABACρ1 subunit eliminates the expression of the ρ2 subunit and the GABACreceptor in both plexiform layers of the retina (IPL and OPL), but does not alter the gross morphology or PKC expression of rod bipolar cells. Similar observations were made in retinas of seven other WT and eight other GABACρ1 null mice.

Fig. 4.
  • Download figure
  • Open in new tab
  • Download powerpoint
Fig. 4.

Eliminating the expression of the GABACρ1 subunit results in the absence of expression of the GABAC receptor. Confocal images of transverse frozen sections of retina from a WT (A) and a GABACρ1 null (B) mouse reacted with antibodies to protein kinase C (green fluorescence) and all GABAC receptor subunits (red fluorescence). In retinas from both the WT and GABACρ1 null mice, protein kinase C immunoreactivity outlines the cell bodies of the rod bipolar cells, their dendritic processes in the OPL, and their axons and axon terminals in the IPL. In the WT animal, the punctate labeling that is characteristic of the GABAC receptors is distributed throughout the IPL and also found on the dendrites in the OPL. This immunoreactivity is completely absent in the retinas of the GABACρ1 null mice (B). This observation is the same in the other seven WT and eight GABACρ1 null retinas that we analyzed. A control WT retina (C) was reacted as described for the retinas shown in A and B, but the GABAC receptor primary antibody was omitted. The labeling pattern of this control is virtually identical to the GABACρ1 null mouse reacted with antibodies to both PKC and the GABAC receptor. D, E, Fluorescence photomicrographs of two Lucifer yellow-filled rod bipolar cells whose responses to GABA puffs were recorded intracellularly. These cells were classified as rod bipolars because their cell bodies were located in the top part of the INL, and their axon terminals were found in the IPL near its border with the ganglion cell bodies. (D, GABACρ1 null; E, WT rod bipolar cells.)

GABA responses from GABACρ1 null rod bipolar cells lack a GABAC receptor component

GABA current kinetics

Rod bipolar cells have the largest GABACreceptor-mediated currents in the retina (Euler and Wassle, 1998;Shields et al., 2000). Therefore, we examined the effects of eliminating the expression of the GABACρ1 subunit on GABA evoked responses in these cells. We targeted rod bipolar cells, using the locations of their somas in the INL near its border with the OPL. After each cell was filled with Lucifer yellow, its morphological identity was verified by the location of its cell body in the INL and its axon terminals in substratum 5 of the IPL, near the border with the ganglion cells (Euler and Wassle, 1998; Shields et al., 2000). Fluorescence images of filled cells from both groups of mice were examined under the light microscope, and no morphological differences in the dendritic or axonal arbors were found between WT and GABACρ1 null rod bipolar cells (see Fig.4D,E, for representative cells), which is consistent with our light microscopic observations described above.

In retinal slices of GABACρ1 null and WT mice, we recorded and averaged the responses of rod bipolar cells to focally applied GABA at their axon terminals in control bath solution. From the averaged response of each cell, we measured three aspects of current kinetics: charge transfer (measured by integrating the current response), peak amplitude, and decay time (time to decline to 37% of peak amplitude) and obtained mean values for WT and GABACρ1 null cells. In WT slices, rod bipolar cells responded to a brief puff (30 msec) of GABA with a rapidly rising but sustained current (Fig.5A). In GABACρ1 null retinas, rod bipolar cells responded to the GABA puff, but the duration of the GABA evoked current was significantly briefer, and their charge transfer and peak amplitudes were significantly smaller (Fig. 5B). The mean values for these parameters and the p values from thet tests comparing the means between the two groups of mice are shown in Table 1. The kinetics of the current evoked in the rod bipolar cells in the GABACρ1 null mice were identical to the GABA responses, which are mediated by only GABAAreceptors in ganglion cells of ferret (Lukasiewicz and Shields, 1998) and rat (Euler and Wassle, 1998; Euler and Masland, 2000), and in ganglion cells that we recorded in both WT and null retinas (data not shown). Each of the changes in current kinetics is consistent with the interpretation that a slow, sustained GABAC-mediated response is absent in GABACρ1 null cells.

Fig. 5.
  • Download figure
  • Open in new tab
  • Download powerpoint
Fig. 5.

GABA currents are mediated by only GABAA receptors in GABACρ1 null mice.A, Representative WT current responses to brief puffs (30 msec) of GABA delivered focally onto the axon terminals of rod bipolar cells (Control) and in the presence of antagonists to GABAA receptors (Bicuculline) or both GABAC and GABAA receptors (TPMPA & Bicuculline). Bicuculline (500 μm) reduced the amplitude of the WT GABA current slightly and delayed its time to peak. TPMPA (50 μm) combined with bicuculline eliminated this GABA current, indicating that both GABAA and GABACreceptors mediate the WT GABA response in the mouse. B,Representative GABACρ1 null current responses to brief GABA puffs delivered focally onto the axon terminals of rod bipolar cells in the presence of bicuculline or bicuculline and TPMPA. The response to GABA in GABACρ1 null bipolar cells is different in its kinetics and pharmacology compared with WT. In GABACρ1 null rod bipolar cells, the decay of the GABA response was much more rapid than in WT (compare Controltraces, A,B). Addition of bicuculline (500 μm) eliminated the GABA current (−) and the addition of TPMPA (100 μm) had no further effect (○), indicating that GABAC receptors did not contribute to the response. C, D, Responses to GABA in WT and GABACρ1 null rod bipolar cells were quantified by measuring charge transfer and changes in these responses in the presence of bicuculline or bicuculline + TPMPA expressed as a percentage of the response in the control bath solution (Q/Qmax).C, WT rod bipolar cell responses were reduced slightly by addition of bicuculline to the bath (86 ± 3%;n = 13). WT responses were almost completely eliminated when both TPMPA and bicuculline were added to the bath (6 ± 2%; n = 13). D, In contrast, GABACρ1 null responses were substantially reduced in the presence of only bicuculline (12 ± 3%; n = 9) and the addition of TPMPA had no further effect (10 ± 2%;n = 9), indicating that the residual current was not mediated by GABAC receptors.

View this table:
  • View inline
  • View popup
Table 1.

Comparison of rod bipolar cell GABA current kinetics in control bathing solution

GABA current pharmacology

We characterized the pharmacology of the GABA response using GABAA and GABAC antagonists for all 13 WT and 9/18 GABACρ1 null rod bipolar cells, whose current kinetics were evaluated in control solution. To quantify changes in the current, we measured the charge transfer in the presence of antagonist and normalized this response to the charge transfer obtained in the control bath solution. When the GABAA receptor antagonist, bicuculline, was included in the bath, the peak amplitude of the GABA response in WT cells was smaller (Fig. 5A), although its decay was not significantly altered (control, 1394.5 ± 111.55 msec vs bicuculline, 1359.0 ± 112.92 msec). The charge transfer of the GABA response in WT bipolar cells in the presence of bicuculline was reduced to 86% of control (Fig. 5C). This indicates that the GABAA receptor contribution to the total GABA response is ∼14%, which is similar to results in rat (Euler and Wassle, 1995; Euler and Masland, 2000), rabbit (McGillem et al., 2000), and ferret rod bipolar cells (Shields et al., 2000). We found that when the GABAC antagonist, TPMPA, was administered alone to WT mouse ganglion cells, which express GABAA receptors but do not express GABAC receptors (M. A. McCall, unpublished observations), the drug reduced GABA responses by ∼15% of control. Therefore, we only assessed the effects of TPMPA on the bicuculline-insensitive component (GABAC-mediated component) of the GABA current in rod bipolar cells. When TPMPA was added in combination with bicuculline, the GABA response in WT rod bipolar cells was almost completely eliminated (Fig. 5A). On average, only 6% of the control current remained in the presence of both bicuculline and TPMPA (Fig. 5C), in agreement with findings in rabbit rod bipolar cells (McGillem et al., 2000). GABA responses recovered to their control levels (79 ± 5%) after wash out of the antagonists (data not shown). These data indicate that in WT mouse rod bipolar cells, the response to GABA at the axon terminal is composed primarily of a GABAC receptor component with a small GABAA receptor component and a third component that is neither GABAA or GABAC receptor-mediated.

In GABACρ1 null retinas, when the GABAA receptor antagonist, bicuculline, was added to the bath, the GABA response was almost completely eliminated, with the charge transfer reduced by 88% of control values (Fig.5B,D). Addition of TPMPA to the bath had no additional effect on this current (reduced by 90% of control), indicating that this small remaining current also was not mediated by GABAA or GABAC receptors. These responses recovered to their pretreatment levels after wash out of the antagonists from the bathing solution (81% of control). Thus, the pharmacology of the current in the GABACρ1 null cells also is identical to the GABA responses mediated by GABAA receptors in ferret (Lukasiewicz and Shields, 1998), rat (Euler and Wassle, 1998; Euler and Masland, 2000), and in ganglion cells that we recorded in both WT and null retinas (data not shown). These data indicate that in GABACρ1 null rod bipolar cells the response to GABA at the axon terminal is composed primarily of a GABAA receptor component.

Whether the GABAC receptor contributes to the GABA response is best illustrated by comparing the effects of TPMPA on the bicuculline-resistant component of the response from WT and GABACρ1 null rod bipolar cells. In WT cells, the bicuculline-resistant response was virtually eliminated by TPMPA (Fig. 5C) (reduced by 92 ± 3% of control values). In contrast, the very small bicuculline-resistant component that was observed in some of the GABACρ1 null rod bipolar cells was unaffected by TPMPA (Fig. 5D) (reduced by 4 ± 9% of control values). These data also indicate that in GABACρ1 null rod bipolar cells, the response to GABA is comprised almost exclusively of a GABAAreceptor-mediated current. The very small bicuculline and TPMPA-resistant current found in cells in both groups of mice could be mediated by a GABA transporter (Yang et al., 1997).

There is little evidence of interactions between the GABAA and GABAC receptors. However, whether there is a compensatory upregulation by GABAA receptors in the absence of GABAC receptors remains an important question. Our data indicate that the GABA current in WT rod bipolar cells is mediated by a combination of GABAA and GABAC receptors. Our results also demonstrate that the GABAC receptors are absent in rod bipolar cells of GABACρ1 null mice and that their GABA response is almost exclusively mediated by GABAA receptors. There is no direct way to determine the absolute numbers of GABAA receptors on rod bipolar cells from our data. However, we can use the charge transfer of the GABA response from WT and GABACρ1 null bipolar cells in the control bath solution and in the presence of bicuculline to estimate the relative contribution of the GABAA receptors to the total GABA current. The GABAA receptor contribution in WT bipolar cells can be estimated from the percentage reduction in the mean charge transfer in the presence of bicuculline relative to control. In the presence of bicuculline, WT charge transfer is reduced to 86% of the control (Fig. 5C), indicating that GABAA receptors contribute ∼14% of the total current. The GABAA receptor contribution in GABACρ1 null bipolar cells, which only express GABAA receptors, can be estimated from the percent reduction in the mean charge transfer in control solution relative to WT bipolar cells in control bath solution (Table 1). This ratio yields an estimate of 18% of the total WT current contributed by GABAA receptors in GABACρ1 null bipolar cells. Thus, these comparisons suggest that the GABAA receptor contribution to the total GABA current in bipolar cells is similar in the two groups of mice and that no compensation by GABAA receptors occurs in the absence of GABAC receptors.

Retinal function is altered in GABACρ1 null mice

Overall function of the rod pathway in the retina can be assessed by evaluating the dark-adapted ERG (Robson and Frishman, 1995). To assess the impact of the elimination of the GABACreceptor and its inhibitory modulation on visual signaling through the rod bipolar cells, we compared dark-adapted ERGs obtained from GABACρ1 null and WT mice. Figure6A shows representative dark-adapted ERGs recorded from a WT and a GABACρ1 null mouse to full-field, flash stimuli at nine different stimulus intensities. The ERGs from seven other WT and six other GABACρ1 null mice showed the same general shape. Under these stimulus conditions, the responses reflect rod-driven activity, with little or no contribution from cone photoreceptors (Xu et al., 2000). The responses to low-intensity stimuli (−4.4 to −1.9 log cd sec/m2) were dominated by the cornea-positive b-wave, which reflects depolarizing (ON) rod bipolar cell function (Masu et al., 1995; Robson and Frishman, 1995). Oscillatory potentials, seen as rhythmic oscillations superimposed on the b-wave, were present in ERGs in both groups of mice. The OPs are thought to reflect the feedback loops involving bipolar cell axon terminals, amacrine cell processes, and ganglion cell dendrites in the IPL (Wachtmeister, 1998). As flash intensity increased (−1.4 to 0.5 log cd sec/m2), the amplitudes of both the b-wave and the OPs increased, and a negative polarity a-wave appeared in advance of the b-wave. The a-wave reflects rod outer segment function (Hood and Birch, 1996; Lamb, 1996). We measured several aspects of the ERG waveform to determine if there were differences in signal processing between the WT and GABACρ1 null retinas. Figure 6, B and C, plots intensity response functions for peak amplitude and time-to-peak (implicit time) for the ERG a- and b-waves in the WT and GABACρ1 null mice. At all flash intensities, both measures of the a-wave were identical between the two groups of mice (Fig. 6B,C) (p = 0.99 andp = 0.24, respectively), as is the peak amplitude of their b-waves (Fig. 6C) ( p = 0.42). In contrast, the time-to-peak of the b-wave was significantly faster in GABACρ1 null mice (p = 0.001).

Fig. 6.
  • Download figure
  • Open in new tab
  • Download powerpoint
Fig. 6.

Dark-adapted photoreceptor function and synaptic transmission to bipolar cells are normal in GABACρ1 null mice. A, Representative dark-adapted ERG responses recorded from one wild-type (WT) and one GABACρ1 null (Null) mouse to brief full-field light flashes. The traces from top tobottom represent the responses of each mouse from the dimmest (−4.4 log cd sec/m2) to the brightest (0.5 log cd sec/m2) flash. At all intensities, the number and amplitude of the OPs are larger in GABACρ1 null mice than in WT mice (see Fig. 7 for quantification). The ERGs from seven other WT and six other GABACρ1 null mice were similar.B, The mean peak amplitudes (± 1 SEM) of the a- and b-waves of the dark-adapted ERG are plotted as a function of flash intensity for all WT (○) and GABACρ1 null (●) mice. No significant difference in the peak amplitude of either wave was observed when WT and GABACρ1 null data were compared. C, The mean time-to-peak (implicit time) for the a- and b-waves of the dark-adapted ERG are plotted as a function of flash intensity for all WT and GABACρ1 null mice. Conventions are the same as in B. Although no significant difference in the implicit time of the a-wave was observed, the implicit times of the b-wave in GABACρ1 null mice were significantly more rapid than in WT mice.

We isolated the OPs from the rest of the ERG using a high pass filter, and Figure 7A shows the resulting waveforms recorded at the highest flash intensity from eight WT and seven GABACρ1 null mice. Two aspects of this response were different between the WT and null mice. As shown in Figure 7B, at all flash intensities we found a significant increase in the number of OP wavelets in the ERGs of GABACρ1 null mice compared to WT mice (p < 0.0001). In addition, with the exception of the first wavelet (OP1), the mean peak amplitudes of the remaining wavelets were significantly larger in GABACρ1 null mice (Fig. 7C) (p < 0.0001). These results indicate that elimination of the GABAC receptor does not compromise rod photoreceptor signal transduction (a-wave), the transmission of this signal to the rod bipolar cells or the amplification of this signal by the rod bipolar cells (b-wave peak amplitude). However, the elimination of the GABAC receptor does alter transmission of the visual signal from the rod bipolar cells to third order neurons in the retina.

Fig. 7.
  • Download figure
  • Open in new tab
  • Download powerpoint
Fig. 7.

Dark-adapted ERG components that reflect bipolar cell output are altered in GABACρ1 null mice.A, Dark-adapted ERGs to the brightest flash stimulus, filtered to isolate the OPs, in eight WT and seven GABACρ1 null mice. In the filtered responses from every GABACρ1 null mouse, there were more OPs, and their amplitude was larger than the number and amplitude of the response in WT mice. B, Mean number of OP wavelets (± 1 SEM) as a function of stimulus intensity in WT (open bars) and in GABACρ1 null mice (filled bars). At all stimulus intensities, significantly more OPs are observed in responses of GABACρ1 null mice. C, Mean peak amplitude of each of the individual OPs from WT and GABACρ1 null mice elicited by the brightest flash (0.5 log cd sec/m2). Conventions are the same as inB. Note that OP5 is present in all GABACρ1 null mice but absent in all WT mice.

In summary, although rodent GABAC receptors are thought to be comprised of ρ1 and ρ2 subunits, we found that in GABACρ1 null mice, deletion of exons 2 through 9 of the GABACρ1 subunit gene eliminated the GABAC receptors in the retina. Using an antibody that recognizes all of the GABACρ subunits (Enz et al., 1995), we showed that there was no ρ subunit labeling in the retinas of GABACρ1 null mice. Our patch-clamp recordings showed that the normally large GABACreceptor current present in WT rod bipolar cells was completely absent in GABACρ1 null rod bipolar cells. Although a GABAA receptor current was present in the GABACρ1 null rod bipolar cells, this did not compensate for the loss of GABAC receptors because our ERG recordings showed that inner retinal function was altered in GABACρ1 null mice.

DISCUSSION

Is expression of the GABACρ1 subunit required for expression of GABAC receptors?

Although initial studies indicated that native retinal GABAC receptors were homomeric channels, more recent results suggest that they are heteromeric channels, composed of ρ1 and ρ2 subunits (Yeh et al., 1990; Shimada et al., 1992; Enz et al., 1995; Zhang et al., 1995; Shingai et al., 1996; Boue-Grabot et al., 1998; Wegelius et al., 1998; Qian and Ripps, 1999; Wotring et al., 1999). Thus, the absence of GABAC receptor expression in GABACρ1 null mice is probably not caused by the loss of expression of homomeric ρ1 channels, but to one of several other possibilities. Our gene-targeting strategy deleted ∼30 kbp between intron 1 and exon 10 of the ρ1 subunit gene. It is possible that this change alters ρ2 expression, because it is located ∼40 kbp upstream of ρ1 (McCall, unpublished observations) on chromosome 4 (Cutting et al., 1992; Greka et al., 2000). Such an alteration in neighboring gene expression has been observed for both the GABAAα1 and β2 subunits after gene targeting of the GABAAα6 subunit, which are all clustered on chromosome 11 (Garrett et al., 1997; Uusi-Oukari et al., 2000). The absence of GABAC receptor expression also could occur if a domain within the GABACρ1 subunit protein is required for the correct assembly or targeting of functional GABAC receptors into the bipolar cell terminals in vivo. Although little is known about the control of GABAC receptor targeting in vivo, in vitro, separate domains on ρ1 and ρ2 subunits have been found to control homomeric and heteromeric receptor assembly (Enz and Cutting, 1999b). Thus, the exact nature of the interactions that form and target the GABACreceptor both between the ρ1 and ρ2 subunits and with other proteins remains to be determined. Regardless of the mechanism of receptor loss, the GABACρ1 null mice lack the GABAC receptor and they provide a powerful background on which to express recombinant ρ subunits to study the structure and function of these receptors in vivo.

The GABAC receptor does not play a role in retinal development

Alterations in the expression of genes sometimes change either the development or maintenance of CNS structures. In the retina, there is evidence that GABA, via GABAA receptors, plays a trophic role during development (Redburn, 1992). Because the GABACρ1 subunit is not expressed until postnatal day 9 (Greka et al., 2000; Wu and Cutting, 2001), we hypothesized that its elimination would not effect overall retinal development. We compared the gross anatomy of the retina and Lucifer yellow-labeled rod bipolar cells of GABACρ1 null and WT mice at the light microscopic level and found no qualitative differences. The overall lamination pattern and thickness of each lamina are comparable and the morphology of GABACρ1 null rod bipolar cell processes appear normal. These data strongly suggest that the absence of the GABACρ1 subunit does not alter general retinal development.

The absence of the GABAC receptor alters inhibitory processing in the retina

Rod bipolar cells

The GABAC receptors are localized primarily on the axon terminals of the bipolar cells in the IPL (Enz et al., 1996; Euler and Wassle, 1998; Koulen et al., 1998; Euler and Masland, 2000) where they mediate a chloride current in response to focally applied GABA (Shields et al., 2000) or light stimulation of the retina (Roska et al., 1998; Euler and Masland, 2000). Pharmacological characterizations have established that this GABA current is a combination of GABAA and GABAC receptor-mediated responses, with GABAC dominating the combined current (Euler and Wassle, 1998; McGillem et al., 2000; Shields et al., 2000). In GABACρ1 null rod bipolar cells, GABA evoked a current that exhibited channel kinetics and pharmacology typical of a GABAA receptor channel (Feigenspan et al., 1993;Lukasiewicz et al., 1994; Lukasiewicz and Werblin, 1994; Lukasiewicz and Wong, 1997; Lukasiewicz and Shields, 1998). Thus, these data also clearly demonstrate that the ρ1 subunit eliminates expression of the GABAC receptors in rod bipolar cells.

In GABACρ1 null mice, the kinetics and pharmacology of the response to GABA are very different from WT responses. The total charge transfer of the GABA response in GABACρ1 null cells is significantly reduced to ∼20% of the WT response, which is mediated by both GABAA and GABAC receptors. In addition, the peak amplitude of the response in GABACρ1 null cells is significantly reduced. These data indicate that the inhibitory signal is reduced in GABACρ1 null rod bipolar cells by approximately the same proportion that we estimate for the GABAC receptor contribution to the WT GABA response (Fig. 5A–D, Table 1). As a consequence, these estimates suggest that compensation by GABAAreceptors in the absence of GABAC receptors is unlikely. Results from other studies support this conclusion. First, there is no evidence of interactions between any GABAA and GABAC receptors. Native GABAA and GABACρ subunits do not combine in mammals either in vivo orin vitro (Shimada et al., 1992; Hackam et al., 1998; Koulen et al., 1998), although in vitro mutant rat ρ1 subunits (Pan et al., 2000) and variants of a perch ρ subunit, ρ1B, can assemble with the GABAAγ2 subunit (Qian and Ripps, 1999). Our preliminary immunohistochemistry experiments in the retinas of GABACρ1 null and WT mice indicate that the location and expression levels of the most common GABAA subunits, α1 and γ2, are normal (data not shown). Finally, GABAA and GABAC receptors form distinct clusters in the IPL (Koulen et al., 1998), which suggests that these receptors may use different membrane localization mechanisms (Moss and Smart, 2001).

GABA-mediated inhibition is critical to normal processing of the visual signal through the bipolar cells to the amacrine and ganglion cells in the retina of most vertebrates (for review, see Lukasiewicz, 1996). For example, bipolar cell GABAC receptors reduce the depolarization-induced influx of Ca2+ ions through voltage-dependent calcium channels (Pan and Lipton, 1995), which in turn reduces both neurotransmitter release (Lukasiewicz and Werblin, 1994) and postsynaptic activity (Wellis and Werblin, 1995). The inhibitory feedback mediated by the GABACreceptors also has been suggested to modify the temporal tuning of this visual signal, making it more transient (Zhang et al., 1997; Dong and Werblin, 1998), and these cellular mechanisms may account for a significant proportion of surround inhibition (Cook and McReynolds, 1998a; Bloomfield and Xin, 2000; Flores-Herr et al., 2001).

The electroretinogram

Although the ERG does not pinpoint the functional role of the GABAC receptor in vision, we used this technique because it is the best tool to assess alterations in overall retinal processing. The ERG evaluates phototransduction and transmission of this signal to the bipolar cells. It also assesses the G-protein-mediated amplification of the signal that occurs in the bipolar cells and aspects of inner retinal function (Robson and Frishman, 1998). Dark-adapted conditions were chosen because they limited our assessment of retinal function to the rod pathway (Xu et al., 2000), where our patch-clamp experiments also had assessed the GABA currents in rod bipolar cells and where the role of the GABAC receptor has been most thoroughly characterized (Euler and Wassle, 1998; Fletcher et al., 1998; Euler and Masland, 2000). Specifically, its role at the feedback synapse between the A17 amacrine and the rod bipolar cell terminal has been examined (Kolb and Nelson, 1983; Fletcher and Wassle, 1999) and has been proposed to create the robust surround inhibition that is found in dark-adapted AII amacrine cells (Bloomfield and Xin, 2000).

Our results are consistent with previous evidence that the photoreceptor response is unaffected by exogenous GABA application (Wachtmeister and Dowling, 1978; Wachtmeister, 1980; Dick and Miller, 1985; Naarendorp and Sieving, 1991; Verweij et al., 1996; Arnarsson and Eysteinsson, 1997; Vitanova et al., 2001). The amplitude of the b-wave, which corresponds to the transmission of the visual signal from the photoreceptors to the depolarizing bipolar cells, also was unaffected. This result was somewhat unexpected because b-wave changes have been reported after application of exogenous GABA or GABAergic agents (Wachtmeister and Dowling, 1978; Wachtmeister, 1980; Dick and Miller, 1985; Naarendorp and Sieving, 1991; Arnarsson and Eysteinsson, 1997;Vitanova et al., 2001). These reports on the effects of GABA are however, variable and probably reflect differences in species, recording techniques, and concentrations of pharmacological agents. Of particular importance is the lack of a selective GABAC receptor antagonist, one that does not also act as a weak agonist or antagonist of GABAAreceptors and GABAB receptors (Ragozzino et al., 1996; Flores-Herr et al., 2001).

The decreased time-to-peak (implicit time) of the b-wave is our most unexpected ERG result, particularly in light of its normal amplitude. The explanation for this result is unclear and requires further investigation, but could reflect a functional role for the GABAC receptor in the OPL where we, and others, have observed its presence (Wassle et al., 1998; Picaud et al., 1998;Pattnaik et al., 2000; Du and Yang, 2000; Vitanova et al., 2001). It is possible that the GABAC receptors provide tonic inhibition that contributes to setting the light adaptation level in the outer retina. In the absence of the GABACreceptor, the functional equivalent of a more light-adapted retina could occur and would shorten the b-wave time-to-peak.

In GABACρ1 null mice, both the amplitude and number of OPs are increased. These data confirm a role for the GABAC receptors in inner retinal circuitry of the rod pathway that generates or modulates the OPs (Wachtmeister and Dowling, 1978; Dick and Miller, 1985; Green and Kapousta-Bruneau, 1999). Evidence suggests that some of the OPs are generated by a negative feedback loop in the IPL between the A17 GABAergic amacrine cells and the axon terminals of the rod bipolar cells (Kolb and Nelson, 1981; Wachtmeister, 1998). Consistent with our results are increases in OP amplitude that also were noted in the rat ERG in the presence of GABAC receptor antagonists (Wachtmeister, 1998;Kapousta-Bruneau, 2000) and increases in both bipolar cell synaptic drive to this circuit (Lukasiewicz and Werblin, 1990) and the sustained nature of this drive when GABACreceptors are blocked (Dong and Werblin, 1998). A similar increase in the amplitude of an oscillatory response was observed when GABAAβ3 expression in an olfactory bulb interneuron was eliminated (Nusser et al., 2001). Thus, similar functions may be performed by these inhibitory receptors in different sensory systems (Hartveit, 1999). Post hoc comparisons of individual OP amplitudes between the GABACρ1 null mice and controls suggest that OP1 is not altered, which is compatible with data indicating that independent mechanisms may generate some of the OPs (Wachtmeister, 1998).

The data presented here establish that the retinal expression of the GABAC receptor is eliminated in GABACρ1 null mice. The absence of the GABAC receptor does not affect the development of the retina or the rod bipolar cells, but it does produce a discrete effect on retinal circuitry, which appears to be limited to GABAC receptor-mediated inhibition. Thus, these results firmly establish that the GABAC receptor modulates inner retinal circuitry, particularly with respect to the generation or modulation of the OPs. Previous studies have suggested that the GABAC receptor plays one of several roles in synaptic transmission from bipolar cells to third order cells (Dong and Werblin, 1998; Hartveit, 1999; Cook et al., 2000; Bloomfield and Xin, 2000; Flores-Herr et al., 2001). However, its exact role in shaping this signal remains to be resolved. Because GABACρ1 null mice lack the GABAC receptor, they represent a useful model system in which to tackle these important questions. In addition, they represent a system in which the separate roles of the GABAC receptor and GABAAreceptor-mediated inhibition in receptive field organization, visual sensitivity, and response properties of amacrine and ganglion cells can be further defined.

Footnotes

  • This work was supported by National Science Foundation (NSF) Grant IBN 007388 (M.A.M.), National Institutes of Health Grants EY12354 (R.G.G), EY08922, and EY02687 (P. D. L.), the Medical Research Service, Department of Veterans Affairs (N.S.P.), NSF-Experimental Program to Stimulate Competitive Research cooperative agreement OS-9452895 (University of Louisville), and the Research to Prevent Blindness (University of Louisville and Washington University). We thank Aaron DenDekker, Sherry Willer, Rita Hackmiller, Angela Mitchell (University of Louisville), and My Tran (Washington University) for technical assistance. In addition, we thank Drs. Ralf Enz and Heinz Wässle for the gift of the GABACρ1 antibody, Dr. Rachel Wong for advice with the immunohistochemistry, and Dr. Botir Sagdullaev for critically reading this manuscript.

  • Correspondence should be addressed to Dr. Maureen A. McCall, Department of Psychological and Brain Sciences, University of Louisville, Life Sciences Building, Louisville, KY 40292. E-mail:mo.mccall{at}louisville.edu.

REFERENCES

  1. ↵
    1. Arnarsson A,
    2. Eysteinsson T
    (1997) The role of GABA in modulating the Xenopus electroretinogram. Vis Neurosci 14:1143–1152.
    OpenUrlPubMed
  2. ↵
    1. Barthel L,
    2. Raymond PA
    (1990) Improved method for obtaining 3-micron cryosections for immunocytochemistry. J Histochem Cytochem 38:1383–1388.
    OpenUrlCrossRefPubMed
  3. ↵
    1. Bloomfield SA,
    2. Xin D
    (2000) Surround inhibition of mammalian AII amacrine cells is generated in the proximal retina. J Physiol (Lond) 523:771–783.
    OpenUrlCrossRefPubMed
  4. ↵
    1. Boue-Grabot E,
    2. Roudbaraki M,
    3. Bascles L,
    4. Tramu G,
    5. Bloch B,
    6. Garret M
    (1998) Expression of GABA receptor rho subunits in rat brain. J Neurochem 70:899–907.
    OpenUrlPubMed
  5. ↵
    1. Cook PB,
    2. McReynolds JS
    (1998a) Lateral inhibition in the inner retina is important for spatial tuning of ganglion cells. Nat Neurosci 1:714–719.
    OpenUrlCrossRefPubMed
  6. ↵
    1. Cook PB,
    2. McReynolds JS
    (1998b) Modulation of sustained and transient lateral inhibitory mechanisms in the mudpuppy retina during light adaptation. J Neurophysiol 79:197–204.
    OpenUrlPubMed
  7. ↵
    1. Cook PB,
    2. Lukasiewicz PD,
    3. McReynolds JS
    (2000) GABA(C) receptors control adaptive changes in a glycinergic inhibitory pathway in salamander retina. J Neurosci 20:806–812.
    OpenUrlAbstract/FREE Full Text
  8. ↵
    1. Cutting GR,
    2. Curristin S,
    3. Zoghbi H,
    4. O'Hara B,
    5. Seldin MF,
    6. Uhl GR
    (1992) Identification of a putative gamma-aminobutyric acid (GABA) receptor subunit rho2 cDNA and colocalization of the genes encoding rho2 (GABRR2) and rho1 (GABRR1) to human chromosome 6q14- q21 and mouse chromosome 4. Genomics 12:801–806.
    OpenUrlCrossRefPubMed
  9. ↵
    1. Dick E,
    2. Miller RF
    (1985) Extracellular K+ activity changes related to electroretinogram components. I. Amphibian (I-type) retinas. J Gen Physiol 85:885–909.
    OpenUrlAbstract/FREE Full Text
  10. ↵
    1. Dong CJ,
    2. Werblin FS
    (1998) Temporal contrast enhancement via GABAC feedback at bipolar terminals in the tiger salamander retina. J Neurophysiol 79:2171–2180.
    OpenUrlPubMed
  11. ↵
    1. Du JL,
    2. Yang XL
    (2000) Subcellular localization and complements of GABA(A) and GABA(C) receptors on bullfrog retinal bipolar cells. J Neurophysiol 84:666–676.
    OpenUrlPubMed
  12. ↵
    1. Enz R
    (2001) GABA(C) receptors: a molecular view. J Biol Chem 382:1111–1122.
    OpenUrl
  13. ↵
    1. Enz R,
    2. Cutting GR
    (1999a) GABAC receptor rho subunits are heterogeneously expressed in the human CNS and form. Eur J Neurosci 11:41–50.
    OpenUrlCrossRefPubMed
  14. ↵
    1. Enz R,
    2. Cutting GR
    (1999b) Identification of 70 amino acids important for GABA(C) receptor rho1 subunit assembly. Brain Res 846:177–185.
    OpenUrlCrossRefPubMed
  15. ↵
    1. Enz R,
    2. Brandstatter JH,
    3. Hartveit E,
    4. Wassle H,
    5. Bormann J
    (1995) Expression of GABA receptor p1 and p2 subunits in the retina and brain of the rat. Eur J Neurosci 7:1495–1501.
    OpenUrlCrossRefPubMed
  16. ↵
    1. Enz R,
    2. Brandstatter JH,
    3. Wassle H,
    4. Bormann J
    (1996) Immunocytochemical localization of the GABAc receptor rho subunits in the mammalian retina. J Neurosci 16:4479–4490.
    OpenUrlAbstract/FREE Full Text
  17. ↵
    1. Euler T,
    2. Masland RH
    (2000) Light-evoked responses of bipolar cells in a mammalian retina. J Neurophysiol 83:1817–1829.
    OpenUrlPubMed
  18. ↵
    1. Euler T,
    2. Wassle H
    (1995) Immunocytochemical identification of cone bipolar cells in the rat retina. J Comp Neurol 361:461–478.
    OpenUrlCrossRefPubMed
  19. ↵
    1. Euler T,
    2. Wassle H
    (1998) Different contributions of GABAA and GABAC receptors to rod and cone bipolar cells in a rat retinal slice preparation. J Neurophysiol 79:1384–1395.
    OpenUrlPubMed
  20. ↵
    1. Feigenspan A,
    2. Bormann J
    (1998) GABA-gated Cl- channels in the rat retina. Prog Retin Eye Res 17:99–126.
    OpenUrlCrossRefPubMed
  21. ↵
    1. Feigenspan A,
    2. Wassle H,
    3. Bormann J
    (1993) Pharmacology of GABA receptor Cl- channels in rat retinal bipolar cells. Nature 361:159–162.
    OpenUrlCrossRefPubMed
  22. ↵
    1. Fletcher EL,
    2. Wassle H
    (1999) Indoleamine-accumulating amacrine cells are presynaptic to rod bipolar cells through GABA(C) receptors. J Comp Neurol 413:155–167.
    OpenUrlCrossRefPubMed
  23. ↵
    1. Fletcher EL,
    2. Koulen P,
    3. Wassle H
    (1998) GABAA and GABAC receptors on mammalian rod bipolar cells. J Comp Neurol 396:351–365.
    OpenUrlCrossRefPubMed
  24. ↵
    1. Flores-Herr N,
    2. Protti DA,
    3. Wassle H
    (2001) Synaptic currents generating the inhibitory surround of ganglion cells in the mammalian retina. J Neurosci 21:4852–4863.
    OpenUrlAbstract/FREE Full Text
  25. ↵
    1. Fritschy JM,
    2. Johnson DK,
    3. Mohler H,
    4. Rudolph U
    (1998) Independent assembly and subcellular targeting of GABAA-receptor subtypes demonstrated in mouse hippocampal and olfactory neurons in vivo. Neurosci Lett 249:99–102.
    OpenUrlCrossRefPubMed
  26. ↵
    1. Garrett KM,
    2. Haque D,
    3. Berry D,
    4. Niekrasz I,
    5. Gan J,
    6. Rotter A,
    7. Seale TW
    (1997) The GABAA receptor alpha 6 subunit gene (Gabra6) is tightly linked to the alpha 1-gamma 2 subunit cluster on mouse chromosome 11. Brain Res Mol Brain Res 45:133–137.
    OpenUrlPubMed
  27. ↵
    1. Green DG,
    2. Kapousta-Bruneau NV
    (1999) A dissection of the electroretinogram from the isolated rat retina with microelectrodes and drugs. Vis Neurosci 16:727–741.
    OpenUrlCrossRefPubMed
  28. ↵
    1. Greka A,
    2. Lipton SA,
    3. Zhang D
    (2000) Expression of GABAC receptor rho1 and rho2 subunits during development of the mouse retina. Eur J Neurosci 12:3575–3582.
    OpenUrlCrossRefPubMed
  29. ↵
    1. Hackam AS,
    2. Wang TL,
    3. Guggino WB,
    4. Cutting GR
    (1998) Sequences in the amino termini of GABA rho and GABA(A) subunits specify their selective interaction in vitro. J Neurochem 70:40–46.
    OpenUrlPubMed
  30. ↵
    1. Hartveit E
    (1999) Reciprocal synaptic interactions between rod bipolar cells and amacrine cells in the rat retina. J Neurophysiol 81:2923–2936.
    OpenUrlPubMed
  31. ↵
    1. Haverkamp S,
    2. Wassle H
    (2000) Immunocytochemical analysis of the mouse retina. J Comp Neurol 424:1–23.
    OpenUrlCrossRefPubMed
  32. ↵
    1. Hood DC,
    2. Birch DG
    (1996) Assessing abnormal rod photoreceptor activity with the a-wave of the electroretinogram: applications and methods. Doc Ophthalmol 92:253–267.
    OpenUrlCrossRefPubMed
  33. ↵
    1. Jiang M,
    2. Gold MS,
    3. Boulay G,
    4. Spicher K,
    5. Peyton M,
    6. Brabet P,
    7. Srinivasan Y,
    8. Rudolph U,
    9. Ellison G,
    10. Birnbaumer L
    (1998) Multiple neurological abnormalities in mice deficient in the G protein Go. Proc Natl Acad Sci USA 95:3269–3274.
    OpenUrlAbstract/FREE Full Text
  34. ↵
    1. Johnston GA
    (1994) GABAC receptors. Prog Brain Res 100:61–65.
    OpenUrlPubMed
  35. ↵
    1. Kapousta-Bruneau NV
    (2000) Opposite effects of GABA(A) and GABA(C) receptor antagonists on the b-wave of ERG recorded from the isolated rat retina. Vision Res 40:1653–1665.
    OpenUrlCrossRefPubMed
  36. ↵
    1. Kogan SC,
    2. Doherty M,
    3. Gitschier J
    (1987) An improved method for prenatal diagnosis of genetic diseases by analysis of amplified DNA sequences. Application to hemophilia A. N Engl J Med 317:985–990.
    OpenUrlCrossRefPubMed
  37. ↵
    1. Kolb H,
    2. Nelson R
    (1981) Amacrine cells of the cat retina. Vision Res 21:1625–1633.
    OpenUrlCrossRefPubMed
  38. ↵
    1. Kolb H,
    2. Nelson R
    (1983) Rod pathways in the retina of the cat. Vision Res 23:301–312.
    OpenUrlCrossRefPubMed
  39. ↵
    1. Koulen P,
    2. Brandstatter JH,
    3. Enz R,
    4. Bormann J,
    5. Wassle H
    (1998) Synaptic clustering of GABA(C) receptor rho-subunits in the rat retina. Eur J Neurosci 10:115–127.
    OpenUrlCrossRefPubMed
  40. ↵
    1. Koulen P,
    2. Brandstatter JH,
    3. Kroger S,
    4. Enz R,
    5. Bormann J,
    6. Wassle H
    (1997) Immunocytochemical localization of the GABA(C) receptor rho subunits in the cat, goldfish, and chicken retina. J Comp Neurol 380:520–532.
    OpenUrlCrossRefPubMed
  41. ↵
    1. Lamb TD
    (1996) Gain and kinetics of activation in the G-protein cascade of phototransduction. Proc Natl Acad Sci USA 93:566–570.
    OpenUrlAbstract/FREE Full Text
  42. ↵
    1. Lukasiewicz PD
    (1996) GABAC receptors in the vertebrate retina. Mol Neurobiol 12:181–194.
    OpenUrlCrossRefPubMed
  43. ↵
    1. Lukasiewicz PD,
    2. Roeder RC
    (1995) Evidence for glycine modulation of excitatory synaptic inputs to retinal ganglion cells. J Neurosci 15:4592–4601.
    OpenUrlAbstract/FREE Full Text
  44. ↵
    1. Lukasiewicz P,
    2. Shields CR
    (1998) A diversity of GABA receptors in the retina. Cell Dev Biol 9:293–299.
    OpenUrl
  45. ↵
    1. Lukasiewicz PD,
    2. Werblin FS
    (1990) The spatial distribution of excitatory and inhibitory inputs to ganglion cell dendrites in the tiger salamander retina. JNSCI 10:210–221.
    OpenUrl
  46. ↵
    1. Lukasiewicz PD,
    2. Werblin FS
    (1994) A novel GABA receptor modulates synaptic transmission from bipolar to ganglion and amacrine cells in the tiger salamander retina. J Neurosci 14:1213–1223.
    OpenUrlAbstract/FREE Full Text
  47. ↵
    1. Lukasiewicz PD,
    2. Wong RO
    (1997) GABAC receptors on ferret retinal bipolar cells: a diversity of subtypes in mammals? Vis Neurosci 14:989–994.
    OpenUrlCrossRefPubMed
  48. ↵
    1. Lukasiewicz PD,
    2. Maple BR,
    3. Werblin FS
    (1994) A novel GABA receptor on bipolar cell terminals in the tiger salamander retina. J Neurosci 14:1202–1212.
    OpenUrlAbstract/FREE Full Text
  49. ↵
    1. Masu M,
    2. Iwakabe H,
    3. Tagawa Y,
    4. Miyoshi T,
    5. Yamashita J,
    6. Fukuda Y,
    7. Sasaki H,
    8. Hiroi K,
    9. Nakamura Y,
    10. Shigemoto R,
    11. Takada M,
    12. Nakamura K,
    13. Nakao K,
    14. Katsuki M,
    15. Nakanishi S
    (1995) Specific deficit of the ON response in visual transmission by targeted disruption of the mGluR6 gene. Cell 80:757–765.
    OpenUrlCrossRefPubMed
  50. ↵
    1. McCall MA,
    2. Gregg RG,
    3. Behringer RR,
    4. Brenner M,
    5. Delaney CL,
    6. Galbreath EJ,
    7. Zhang CL,
    8. Pearce RA,
    9. Chiu SY,
    10. Messing A
    (1996a) Targeted deletion in astrocyte intermediate filament (GFAP) alters neuronal physiology. Proc Natl Acad Sci USA 93:6361–6366.
    OpenUrlAbstract/FREE Full Text
  51. ↵
    1. McCall MA,
    2. Gregg RG,
    3. Merriman K,
    4. Goto Y,
    5. Peachey NS,
    6. Stanford LR
    (1996b) Morphological and physiological consequences of the selective elimination of rod photoreceptors in transgenic mice. Exp Eye Res 63:35–50.
    OpenUrlCrossRefPubMed
  52. ↵
    1. McGillem GS,
    2. Rotolo TC,
    3. Dacheux RF
    (2000) GABA responses of rod bipolar cells in rabbit retinal slices. Vis Neurosci 17:381–389.
    OpenUrlCrossRefPubMed
  53. ↵
    1. Moss SJ,
    2. Smart TG
    (2001) Constructing inhibitory synapses. Nat Rev Neurosci 2:240–250.
    OpenUrlCrossRefPubMed
  54. ↵
    1. Naarendorp F,
    2. Sieving PA
    (1991) The scotopic threshold response of the cat ERG is suppressed selectively by GABA and glycine. Vision Res 31:1–15.
    OpenUrlCrossRefPubMed
  55. ↵
    1. Nusser Z,
    2. Kay LM,
    3. Laurent G,
    4. Homanics GE,
    5. Mody I
    (2001) Disruption of GABA(A) receptors on GABAergic interneurons leads to increased oscillatory power in the olfactory bulb network. J Neurophysiol 86:2823–2833.
    OpenUrlPubMed
  56. ↵
    1. Pan ZH,
    2. Lipton SA
    (1995) Multiple GABA receptor subtypes mediate inhibition of calcium influx at rat retinal bipolar cell terminals. J Neurosci 15:2668–2679.
    OpenUrlAbstract/FREE Full Text
  57. ↵
    1. Pan ZH,
    2. Zhang D,
    3. Zhang X,
    4. Lipton SA
    (2000) Evidence for coassembly of mutant GABAC rho1 with GABAA gamma2S, glycine alpha1 and glycine alpha2 receptor subunits in vitro. Eur J Neurosci 12:3137–3145.
    OpenUrlCrossRefPubMed
  58. ↵
    1. Pardue MT,
    2. McCall MA,
    3. LaVail MM,
    4. Gregg RG,
    5. Peachey NS
    (1998) A naturally occurring mouse model of X-linked congenital stationary night blindness. Invest Ophthalmol Vis Sci 39:2443–2449.
    OpenUrlAbstract/FREE Full Text
  59. ↵
    1. Pattnaik B,
    2. Jellali A,
    3. Sahel J,
    4. Dreyfus H,
    5. Picaud S
    (2000) GABAC receptors are localized with microtubule-associated protein 1B in mammalian cone photoreceptors. J Neurosci 20:6789–6796.
    OpenUrlAbstract/FREE Full Text
  60. ↵
    1. Peachey NS,
    2. Roveri L,
    3. Messing A,
    4. McCall MA
    (1997) Functional consequences of oncogene-induced horizontal cell degeneration in the retinas of transgenic mice. Vis Neurosci 14:627–632.
    OpenUrlPubMed
  61. ↵
    1. Persohn E,
    2. Malherbe P,
    3. Richards JG
    (1992) Comparative molecular neuroanatomy of cloned GABAA receptor subunits in the rat CNS. J Comp Neurol 326:193–216.
    OpenUrlCrossRefPubMed
  62. ↵
    1. Picaud S,
    2. Pattnaik B,
    3. Hicks D,
    4. Forster V,
    5. Fontaine V,
    6. Sahel J,
    7. Dreyfus H
    (1998) GABAA and GABAC receptors in adult porcine cones: evidence from a photoreceptor-glia co-culture model. J Physiol (Lond) 513:33–42.
    OpenUrlCrossRefPubMed
  63. ↵
    1. Qian H,
    2. Ripps H
    (1999) Response kinetics and pharmacological properties of heteromeric receptors formed by coassembly of GABA rho- and gamma 2-subunits. Proc R Soc Lond B Biol Sci 266:2419–2425.
    OpenUrlPubMed
  64. ↵
    1. Ragozzino D,
    2. Woodward RM,
    3. Murata Y,
    4. Eusebi F,
    5. Overman LE,
    6. Miledi R
    (1996) Design and in vitro pharmacology of a selective gamma- aminobutyric acidC receptor antagonist. Mol Pharmacol 50:1024–1030.
    OpenUrlAbstract
  65. ↵
    1. Redburn DA
    (1992) Development of GABAergic neurons in the mammalian retina. Prog Brain Res 90:133–147.
    OpenUrlPubMed
  66. ↵
    1. Robson JG,
    2. Frishman LJ
    (1995) Response linearity and dynamics of the cat retina: the bipolar cell component of the dark-adapted ERG. Vis Neurosci 12:837–850.
    OpenUrlCrossRefPubMed
  67. ↵
    1. Robson JG,
    2. Frishman LJ
    (1998) Dissecting the dark-adapted electroretinogram. Doc Ophthalmol 95:187–215.
    OpenUrlCrossRefPubMed
  68. ↵
    1. Rohrer B,
    2. Korenbrot JI,
    3. LaVail MM,
    4. Reichardt LF,
    5. Xu B
    (1999) Role of neurotrophin receptor TrkB in the maturation of rod photoreceptors and establishment of synaptic transmission to the inner retina. J Neurosci 19:8919–8930.
    OpenUrlAbstract/FREE Full Text
  69. ↵
    1. Roska B,
    2. Nemeth E,
    3. Werblin FS
    (1998) Response to change is facilitated by a three-neuron disinhibitory pathway in the tiger salamander retina. J Neurosci 18:3451–3459.
    OpenUrlAbstract/FREE Full Text
  70. ↵
    1. Rozzo A,
    2. Ballerini L,
    3. Nistri A
    (1999) Antagonism by (1,2,5,6-tetrahydropyridine-4-yl) methylphosphinic acid of synaptic transmission in the neonatal rat spinal cord in vitro: an electrophysiological study. Neuroscience 90:1085–1092.
    OpenUrlCrossRefPubMed
  71. ↵
    1. Shields CR,
    2. Tran MN,
    3. Wong RO,
    4. Lukasiewicz PD
    (2000) Distinct ionotropic GABA receptors mediate presynaptic and postsynaptic inhibition in retinal bipolar cells. J Neurosci 20:2673–2682.
    OpenUrlAbstract/FREE Full Text
  72. ↵
    1. Shimada S,
    2. Cutting G,
    3. Uhl GR
    (1992) gamma-Aminobutyric acid A or C receptor? Gamma-aminobutyric acid rho 1 receptor RNA induces bicuculline-, barbiturate-, and benzodiazepine-insensitive gamma-aminobutyric acid responses in Xenopus oocytes. Mol Pharmacol 41:683–687.
    OpenUrlAbstract
  73. ↵
    1. Shingai R,
    2. Yanagi K,
    3. Fukushima T,
    4. Sakata K,
    5. Ogurusu T
    (1996) Functional expression of GABA rho 3 receptors in Xenopus oocytes. Neurosci Res 26:387–390.
    OpenUrlCrossRefPubMed
  74. ↵
    1. Sivilotti L,
    2. Nistri A
    (1991) GABA receptor mechanisms in the central nervous system. Prog Neurobiol 36:35–92.
    OpenUrlCrossRefPubMed
  75. ↵
    1. Thibos LN,
    2. Werblin FS
    (1978) The properties of surround antagonism elicited by spinning windmill patterns in the mudpuppy retina. J Physiol (Lond) 278:101–116.
    OpenUrlCrossRefPubMed
  76. ↵
    1. Uusi-Oukari M,
    2. Heikkila J,
    3. Sinkkonen ST,
    4. Makela R,
    5. Hauer B,
    6. Homanics GE,
    7. Sieghart W,
    8. Wisden W,
    9. Korpi ER
    (2000) Long-range interactions in neuronal gene expression: evidence from gene targeting in the GABA(A) receptor beta2-alpha6-alpha1-gamma2 subunit gene cluster. Mol Cell Neurosci 16:34–41.
    OpenUrlCrossRefPubMed
  77. ↵
    1. Verweij J,
    2. Kamermans M,
    3. Spekreijse H
    (1996) Horizontal cells feed back to cones by shifting the cone calcium- current activation range. Vision Res 36:3943–3953.
    OpenUrlCrossRefPubMed
  78. ↵
    1. Vitanova L,
    2. Kupenova P,
    3. Haverkamp S,
    4. Popova E,
    5. Mitova L,
    6. Wassle H
    (2001) Immunocytochemical and electrophysiological characterization of GABA receptors in the frog and turtle retina. Vision Res 41:691–704.
    OpenUrlCrossRefPubMed
  79. ↵
    1. Wachtmeister L
    (1980) Further studies of the chemical sensitivity of the oscillatory potentials of the electroretinogram (ERG) I. Acta Ophthalmol (Copenh) 58:712–725.
    OpenUrlPubMed
  80. ↵
    1. Wachtmeister L
    (1998) Oscillatory potentials in the retina: what do they reveal. Prog Retin Eye Res 17:485–521.
    OpenUrlCrossRefPubMed
  81. ↵
    1. Wachtmeister L,
    2. Dowling JE
    (1978) The oscillatory potentials of the mudpuppy retina. Invest Ophthalmol Vis Sci 17:1176–1188.
    OpenUrlAbstract/FREE Full Text
  82. ↵
    1. Wassle H,
    2. Yamashita M,
    3. Greferath U,
    4. Grunert U,
    5. Muller F
    (1991) The rod bipolar cell of the mammalian retina. Vis Neurosci 7:99–112.
    OpenUrlCrossRefPubMed
  83. ↵
    1. Wassle H,
    2. Koulen P,
    3. Brandstatter JH,
    4. Fletcher EL,
    5. Becker CM
    (1998) Glycine and GABA receptors in the mammalian retina. Vision Res 38:1411–1430.
    OpenUrlCrossRefPubMed
  84. ↵
    1. Wegelius K,
    2. Pasternack M,
    3. Hiltunen JO,
    4. Rivera C,
    5. Kaila K,
    6. Saarma M,
    7. Reeben M
    (1998) Distribution of GABA receptor rho subunit transcripts in the rat brain. Eur J Neurosci 10:350–357.
    OpenUrlCrossRefPubMed
  85. ↵
    1. Wellis DP,
    2. Werblin FS
    (1995) Dopamine modulates GABAc receptors mediating inhibition of calcium entry into and transmitter release from bipolar cell terminals in tiger salamander retina. J Neurosci 15:4748–4761.
    OpenUrlAbstract/FREE Full Text
  86. ↵
    1. Werblin F
    (1978) Transmission along and between rods in the tiger salamander retina. J Physiol (Lond) 280:449–470.
    OpenUrlCrossRefPubMed
  87. ↵
    1. Wisden W,
    2. Seeburg PH
    (1992) GABAA receptor channels: from subunits to functional entities. Curr Opin Neurobiol 2:263–269.
    OpenUrlCrossRefPubMed
  88. ↵
    1. Wotring VE,
    2. Chang Y,
    3. Weiss DS
    (1999) Permeability and single channel conductance of human homomeric rho1 GABAC receptors. J Physiol (Lond) 521 Pt2:327–336.
    OpenUrlCrossRefPubMed
  89. ↵
    1. Wu Y,
    2. Cutting GR
    (2001) Developmentally regulated expression of GABA receptor rho1 and rho2 subunits, L7 and cone-rod homeobox (CRX) genes in mouse retina. Brain Res 912:1–8.
    OpenUrlPubMed
  90. ↵
    1. Xu X,
    2. Quiambao AB,
    3. Roveri L,
    4. Pardue MT,
    5. Marx JL,
    6. Rohlich P,
    7. Peachey NS,
    8. Al Ubaidi MR
    (2000) Degeneration of cone photoreceptors induced by expression of the Mas1 protooncogene. Exp Neurol 163:207–219.
    OpenUrlCrossRefPubMed
  91. ↵
    1. Yang CY,
    2. Brecha NC,
    3. Tsao E
    (1997) Immunocytochemical localization of gamma-aminobutyric acid plasma membrane transporters in the tiger salamander retina. J Comp Neurol 389:117–126.
    OpenUrlCrossRefPubMed
  92. ↵
    1. Yeh HH,
    2. Lee MB,
    3. Cheun JE
    (1990) Properties of GABA-activated whole-cell currents in bipolar cells of the rat retina. Vis Neurosci 4:349–357.
    OpenUrlPubMed
  93. ↵
    1. Zhang D,
    2. Pan ZH,
    3. Zhang X,
    4. Brideau AD,
    5. Lipton SA
    (1995) Cloning of a gamma-aminobutyric acid type C receptor subunit in rat retina with a methionine residue critical for picrotoxinin channel block. Proc Natl Acad Sci USA 92:11756–11760.
    OpenUrlAbstract/FREE Full Text
  94. ↵
    1. Zhang D,
    2. Pan ZH,
    3. Awobuluyi M,
    4. Lipton SA
    (2001) Structure and function of GABA(C) receptors: a comparison of native versus recombinant receptors. Trends Pharmacol Sci 22:121–132.
    OpenUrlCrossRefPubMed
  95. ↵
    1. Zhang J,
    2. Jung CS,
    3. Slaughter MM
    (1997) Serial inhibitory synapses in retina. Vis Neurosci 14:553–563.
    OpenUrlCrossRefPubMed
Back to top

In this issue

The Journal of Neuroscience: 22 (10)
Journal of Neuroscience
Vol. 22, Issue 10
15 May 2002
  • Table of Contents
  • Index by author
Email

Thank you for sharing this Journal of Neuroscience article.

NOTE: We request your email address only to inform the recipient that it was you who recommended this article, and that it is not junk mail. We do not retain these email addresses.

Enter multiple addresses on separate lines or separate them with commas.
Elimination of the ρ1 Subunit Abolishes GABACReceptor Expression and Alters Visual Processing in the Mouse Retina
(Your Name) has forwarded a page to you from Journal of Neuroscience
(Your Name) thought you would be interested in this article in Journal of Neuroscience.
CAPTCHA
This question is for testing whether or not you are a human visitor and to prevent automated spam submissions.
Print
View Full Page PDF
Citation Tools
Elimination of the ρ1 Subunit Abolishes GABACReceptor Expression and Alters Visual Processing in the Mouse Retina
Maureen A. McCall, Peter D. Lukasiewicz, Ronald G. Gregg, Neal S. Peachey
Journal of Neuroscience 15 May 2002, 22 (10) 4163-4174; DOI: 10.1523/JNEUROSCI.22-10-04163.2002

Citation Manager Formats

  • BibTeX
  • Bookends
  • EasyBib
  • EndNote (tagged)
  • EndNote 8 (xml)
  • Medlars
  • Mendeley
  • Papers
  • RefWorks Tagged
  • Ref Manager
  • RIS
  • Zotero
Respond to this article
Request Permissions
Share
Elimination of the ρ1 Subunit Abolishes GABACReceptor Expression and Alters Visual Processing in the Mouse Retina
Maureen A. McCall, Peter D. Lukasiewicz, Ronald G. Gregg, Neal S. Peachey
Journal of Neuroscience 15 May 2002, 22 (10) 4163-4174; DOI: 10.1523/JNEUROSCI.22-10-04163.2002
Reddit logo Twitter logo Facebook logo Mendeley logo
  • Tweet Widget
  • Facebook Like
  • Google Plus One

Jump to section

  • Article
    • Abstract
    • MATERIALS AND METHODS
    • RESULTS
    • DISCUSSION
    • Footnotes
    • REFERENCES
  • Figures & Data
  • Info & Metrics
  • eLetters
  • PDF

Keywords

  • knock-out
  • rod bipolar cell
  • electroretinogram
  • IPSC
  • whole-cell patch clamp
  • TPMPA
  • ionotropic receptor
  • chloride channel
  • inhibition

Responses to this article

Respond to this article

Jump to comment:

No eLetters have been published for this article.

Related Articles

Cited By...

More in this TOC Section

ARTICLE

  • Salicylate Induces Tinnitus through Activation of Cochlear NMDA Receptors
  • Visuomotor Behaviors in Larval Zebrafish after GFP-Guided Laser Ablation of the Optic Tectum
  • Conditional Expression in Corticothalamic Efferents Reveals a Developmental Role for Nicotinic Acetylcholine Receptors in Modulation of Passive Avoidance Behavior
Show more ARTICLE

Behavioral/Systems

  • Efferent Protection from Acoustic Injury Is Mediated via α9 Nicotinic Acetylcholine Receptors on Outer Hair Cells
  • Attenuation of Nicotine-Induced Antinociception, Rewarding Effects, and Dependence in μ-Opioid Receptor Knock-Out Mice
  • Electroconvulsive Seizure Behavior in Drosophila: Analysis of the Physiological Repertoire Underlying a Stereotyped Action Pattern in Bang-Sensitive Mutants
Show more Behavioral/Systems
  • Home
  • Alerts
  • Visit Society for Neuroscience on Facebook
  • Follow Society for Neuroscience on Twitter
  • Follow Society for Neuroscience on LinkedIn
  • Visit Society for Neuroscience on Youtube
  • Follow our RSS feeds

Content

  • Early Release
  • Current Issue
  • Issue Archive
  • Collections

Information

  • For Authors
  • For Advertisers
  • For the Media
  • For Subscribers

About

  • About the Journal
  • Editorial Board
  • Privacy Policy
  • Contact
(JNeurosci logo)
(SfN logo)

Copyright © 2023 by the Society for Neuroscience.
JNeurosci Online ISSN: 1529-2401

The ideas and opinions expressed in JNeurosci do not necessarily reflect those of SfN or the JNeurosci Editorial Board. Publication of an advertisement or other product mention in JNeurosci should not be construed as an endorsement of the manufacturer’s claims. SfN does not assume any responsibility for any injury and/or damage to persons or property arising from or related to any use of any material contained in JNeurosci.