Abstract
A majority of neurons that form the ventral nerve cord send out long axons that cross the midline through anterior or posterior commissures. A smaller fraction extend longitudinally and never cross the midline. The decision to cross the midline is governed by a balance of attractive and repulsive signals. We have explored the role of a G-protein, Gαq, in altering this balance inDrosophila. A splice variant of Gαq,dgqα3, is expressed in early axonal growth cones, which go to form the commissures in theDrosophila embryonic CNS. Misexpression of a gain-of-function transgene of dgqα3(AcGq3) leads to ectopic midline crossing. Analysis of the AcGq3 phenotype in roundabout andfrazzled mutants shows that AcGq3 function is antagonistic to Robo signaling and requires Frazzled to promote ectopic midline crossing. Our results show for the first time that a heterotrimeric G-protein can affect the balance of attractive versus repulsive cues in the growth cone and that it can function as a component of signaling pathways that regulate axonal pathfinding.
Axons use cues present at different choice points in the cellular environment to reach their targets. These cues are attractive and repulsive in nature and function at short range by contact or through long range by diffusion (Tessier-Lavigne and Goodman, 1996). The midline of the CNS in vertebrates and invertebrates functions as one such choice point for axons that need to project to their targets on the opposite side in the CNS. Cells at the midline provide cues that are both attractive and repulsive and thus enable axons to make appropriate decisions at the midline. Attractive cues are encoded by molecules called Netrins (Ishii et al., 1992; Kennedy et al., 1994; Harris et al., 1996; Mitchell et al., 1996), whereas repulsive cues are encoded by a class of molecules called Slit. These cues and their receptors Frazzled/DCC and the Roundabout (Robo) family, respectively, are also highly conserved (Chan et al., 1996; Keino-Masu et al., 1996; Kolodziej et al., 1996; Kidd et al., 1998a; Rajagopalan et al., 2000a,b; Simpson et al., 2000a,b). Studies inDrosophila and vertebrates have shown that attraction and repulsion are a consequence of the signaling pathways triggered by the two receptors and are not intrinsic to the nature of the individual ligands. (Bashaw and Goodman, 1999; Hong et al., 1999). Studies inDrosophila have also shown that all cells in the nervous system are competent to respond to attractive and repulsive cues, thereby suggesting that the balance between attraction and repulsion determines the final response of the growth cone (Bashaw and Goodman, 1999). This is achieved in part by regulating expression of individual receptors (Kidd et al., 1998a) and in part by modulating the activity of the signaling pathways (Menon and Zinn, 1998; Bonkowsky et al., 1999; Sun et al., 2000; Bashaw et al., 2000). Thus, identifying the signaling pathways and their regulation in response to various cues is important in understanding how this balance is achieved and maintained.
In vitro studies in vertebrate systems have shown that altering cyclic nucleotide levels and calcium in the growth cone can convert attraction into repulsion (Song et al., 1997; Hong et al., 2000; Zheng, 2000), suggesting that G-protein-coupled signaling pathways are involved in this process. In this study we have examined the role of the heterotrimeric G-protein Gq in growth cone guidance inDrosophila. The gene dgq encodes the α subunit of the Gq class of heterotrimeric G-proteins in Drosophila. This family of G-proteins is known to activate the phosphoinositide cascade within cells, which involves generation of inositol 1,4,5,trisphosphate (IP3) followed by release of intracellular calcium through the IP3 receptor (Exton, 1994). In Drosophila, the role of this gene in mediating phototransduction in the adult eye has been well established (Lee et al., 1994; Scott et al., 1995). We find that a splice variant of the Gq gene (dgqα3;Talluri et al., 1995; Alvarez et al., 1996) is expressed in the embryonic CNS during development. In this study we show for the first time that a dominant active form ofdgqα3 modulates repulsive signaling in the growth cone, possibly in response to attractive cues. Our results suggest that Gq signaling could function as a part of the regulatory network that functions to tilt the balance from repulsion to attraction during midline crossing of axons.
MATERIALS AND METHODS
cDNA isolation and sequencing. Embryonic and appendage cDNA libraries were screened using a probe generated by a PCR using degenerate primers on an appendage library (Wang et al. 1999). The primer sequences were as follows: (1) 5′AC(T/C/A/G)TT(T/C)AT(T/C/A)AA(G/A)CA(A/G)ATG 3′; (2) 5′(A/G)AA(A/G)CA(A/G/T/C)TG(A/G/T)ATCCA(C/T)TT 3′.
They correspond to the conserved amino acid sequences “TFIKQM” and “KWIQHCF” in the helical domain of Gαq proteins. Standard PCR conditions for degenerate primers were used (Hasan and Rosbash. 1992). The PCR product was reamplified using an internal primer: 5′T(T/C)(A/G)TC(A/G)AA(A/T/C/G)GG(A/G)TA(T/C)TC3′, which corresponds to the conserved amino acid sequence “EYPFDL”. A 400 bp product was obtained using the internal primer. This was subcloned into the plasmid pBluescript (Stratagene, La Jolla, CA) and sequenced. The sequenced clone was then used to screen appendage and embryonic cDNA libraries. cDNA clones obtained from the two libraries were sequenced manually (Sanger et al., 1977).
RT-PCR analysis. Poly(A+) RNA was isolated from various tissues following standard procedures (Sambrook et al., 1989). Primers complementary to exon 9 and 10 (see Fig. 1A) were used for RT-PCR analysis ofdgqα3. Their sequences are as follows: PE-3 (exon 9): 5′AACTCGAGTACGATGGTCCTCAGCGAG 3′ and PE-4 (exon 10): 5′ AAGGATCCTCCAAATCCAGTTTAGACC 3′. Reverse transcription and PCR (RT-PCR) was according to published procedures (Sinha and Hasan, 1999).
In situ hybridization to whole mount embryos. In situhybridization to embryos was according to the procedure described byTautz and Pfiefle (1989). A 210 bp dgqα3-specific probe was generated and labeled by PCR using primers to exons 11 and 14. Digoxygenin-dUTP from Boehringer Mannheim (Mannheim, Germany) was included in the PCR mix.
Western blot analysis. Protein extracts from adult tissues and 0–8, 8–16, and 16–24 hr embryos were made by homogenization in polyacrylamide gel sample buffer at twice its normal concentration (Sambrook et al., 1989). The samples were run on a 10% SDS-polyacrylamide gel and transferred to nitrocellulose membranes. Detection of the protein blot was according to published procedures (Edery et al., 1994) with minor modifications. Anti-Gq antiserum from Santa Cruz Biotechnology (Santa Cruz, CA) was used at a dilution of 1:1000.
Immunohistochemical methods. Immunohistochemical staining of whole-mount embryos was according to published protocols (Gould et al., 1990). Developmental stages were identified following the description by Wieschaus and Nusslein-Volhard (1986). The anti-Gq antibody used from Santa Cruz Biotechnology has been raised against the C-terminal peptide (FAAVKDTILQLNLKEYNLV) of mammalian Gαq. This differs from the corresponding Drosophila Dgqα3 sequence by a single residue (FAAVKDTILQSNLKEYNLV). For immunohistochemistry the antibody was used at a dilution of 1:200. Anti-βgal monoclonal supernatant, monoclonal antibody (mAb) 40–1a (Developmental Studies Hybridoma Bank, University of Iowa, Iowa City, IA) and mAb 1D4 (anti-Fasciclin II; courtesy C. Goodman laboratory, University of California, Berkeley, CA) were used at a dilution of 1:25 each. Anti-Robo (courtesy C. Goodman) and anti-Connectin antiserum (courtesy of Rob White, Department of Anatomy, University of Cambridge, Cambridge, UK) were used at a dilution of 1:10. Vectastain A+B kit (Vector Laboratories, Burlingame, CA) was used for nonfluorescent immunohistochemical visualizations. The stained embryos were filleted and mounted in 90% glycerol. Fluoro-isothiocyanate (FITC) and rhodamine or Alexa Red-conjugated secondary antibodies (Jackson ImmunoResearch, West Grove, PA; Molecular Probes, Eugene, OR) were used at a dilution of 1:200. Specimens stained with fluorescent secondaries were mounted in 70% glycerol containing 1 mg/ml of p-phenylenediamine (Sigma, St. Louis, MO) to prevent quenching.
Confocal imaging. Confocal images of antibody staining done with fluorescent secondaries were viewed on Bio-Rad (Poole, UK) MRC 1024. For double-labeled images, data from the two channels (605 DF32 for rhodamine and Alexa Red and 522 DF32 for FITC) were superimposed using Metamorph software version 4.0. Confocal sections of 2 μm thickness were obtained, and composite images were created by merging relevant numbers of sections. Confocal sections of 0.3 μm thickness were obtained for the images shown in Figure 2, E and F.
Site-directed mutagenesis and germline transformation. The Q203L mutation requiring an A→T change was introduced in thedgqα3 cDNA by site-directed mutagenesis using the Quik-change kit by Stratagene. The primer used to introduce the mutation was 5′CGGTGGTCTGCGATCCG 3′. The mutant cDNA was sequenced fully to ensure that no other mutations had been incorporated into the modified sequence. Both mutant and wild-type cDNAs were independently subcloned into the transformation vector pUAST (Brand and Perrimon, 1993) to obtain germline transformants. Two independent transformant lines for each construct were obtained. These areUAS-Gq3FF17–2 on chromosome 3,UAS-Gq3MM17–2 on chromosome 2,UAS-AcGq3F58a on chromosome 1, andUAS-AcGq3F58c on chromosome 2. Equivalent phenotypes were observed with both sets of transformant lines.
Flystocks. All stocks were grown at 25°C. The followingGAL4 stocks were used: C155-GAL4 (Lin and Goodman, 1994),ftzng-GAL4 andeveng-GAL4 (courtesy of Jim Jaynes, Thomas Jefferson University, Philadelphia, PA) (Baines et al., 1999). The ApC-tauβgal stock was obtained from the laboratory of Dr. John Thomas (Salk Institute, San Diego, CA) (Lundgren et al., 1995), whereas the Ap-GAL4 stock was obtained from theDrosophila stock center (Bloomington, IN).UAS-roboY-F (Bashaw et al., 2000) was obtained from C. Goodman's laboratory. The Df(2R)vg-C stock, which carries the deficiency for dgq, was obtained from theDrosophila stock center and placed against aCyoActβgal balancer to identify homozygous deficiency embryos. For expression of AcGq3, males of the genotypeUAS-AcGq3/FM7-GFP were crossed to homozygous females of one of the following genotypes: (1) C155-GAL4, (2)C155-GAL4; +; Ap-tauβgal, (3) +; +;ftzng-GAL4, UAS-tauβgal, or (4)UAS-tauβgal;eveng-GAL4. To study the behavior of Apterous neurons, an Apterous-GAL4/CyoWgβgal; Apterous-tauβgal strain was generated and subsequently crossed to UAS-AcGq3F58c/CyoActβgal. To examine the genetic interactions between AcGq3 androbo1 and frazzledmutants, the following strains were generated:C155-GAL4;fra4/CyoActβgal;+/+., UAS-AcGq3/FM7ftzβgal;fra3/CyoActβgal;+/+., and UAS-AcGq3/FM7ftzβgal;robo1/CyoActβgal.Homozygous and heterozygous mutant embryos were distinguished based on the presence or absence of marked balancers in each case. For studying the interaction between roboY-F and AcGq3, UAS-AcGq3F58c/Cyo-GFP, UAS-roboY-Fstrain was generated and crossed to C155-GAL4 females. Expression of AcGq3 was confirmed by immunohistochemical staining with anti-Gq antibody. With both C155-GAL4 andftzng-GAL4 drivers, the pattern of Gq expression observed is different from the wild-type pattern.
RESULTS
Identification and expression of dgqα3 inDrosophila embryos
cDNA clones corresponding to the dgq gene were isolated in library screens using a fragment from the eye-specific splice variant dgqα1 (Lee et al., 1990). We screened libraries derived from either embryo or appendage RNAs and analyzeddgq-positive cDNA clones by restriction digests and PCR. The three classes of cDNA clones obtained are shown in Figure1A. Of these, one class corresponds, in the region of the open-reading frame, to the previously identified splice variant transcript of the dgq gene, calleddgqα3, known to be expressed in several adult tissues (Talluri et al., 1995; Alvarez et al., 1996). This class was isolated repeatedly from the embryo cDNA library, as judged by extensive PCR analysis. Specifically, primers to exons 4 and 9, 6 and 9, 6 and 11, and 11 and 14 (Fig. 1A), amplified the expected fragments of 673, 321, 445, 210 bp. No amplification was observed using primers to exons 6 and 12 and exons 12 and 13, indicating that none of the embryonic cDNAs belong to the next class of cDNA isolated from the appendage library (dgqα4) (Fig.1A). Because this was the first characterization of adgq transcript in Drosophila embryos, we performed RT-PCRs using dgqα3-specific primers from exons 11 and 14 (Fig. 1A). As shown in Figure1B, dgqα3-specific transcripts are present in poly(A+) RNA extracted from heads, appendages, male and female bodies, and embryos. These results were corroborated by a Northern blot analysis using the unique 3′ region of dgqα3 as a probe (data not shown). A third class of cDNA clones was found only in the appendage library and appeared identical to the adult visual Gαq splice form (dgqα1) (Fig. 1A), as determined by the presence ofdgqα1-specific exon 7 (by PCR), and exons 10 and 13 (by sequencing) (Fig. 1A). We have not analyzed this cDNA any further.
A, Structure of thedgq gene and its splice variants dgqα3and dgqα4. All known exons are numberedand shown as boxes in the row markeddgq. The hatched exons indicate regions unique to dgqα3 and dgqα4 splice variants. In the row marked dgqα3, thestippled exons indicate regions that are not found in the dgqα3 cDNAs identified by us. The open box for exon 12 indicates a dgqα4-specific exon. The arrows on dgqα3 indicate positions of the primers used for RT-PCR analysis shown below. Theasterisk marks the C-terminal region recognized by the Gq3 antiserum. Arrowheads on dgqα4indicate primer positions used to differentiate it fromdgqα3. B, Expression ofdgqα3 mRNA by RT-PCR. Adgqα3-specific band of 210 bp is seen in poly(A+) RNA extracted from adult male and female bodies, heads, and appendages, as well as embryos. Lanesmarked as (−) were loaded with PCR reactions from minus reverse transcriptase control tubes. The control lane contains a PCR-amplified product from the dgqα3 cDNA clone. The quality and quantity of poly(A+) RNA isolated from each tissue was estimated by an RT-PCR done with primers specific to therp49 gene. The rp49 control plasmid is a genomic clone, leading to small difference in its size from the RT-PCR product. C, Expression of Dgqα3 protein. A Western blot of protein lysates made from staged embryos and adult heads was stained with antiserum to Gq. A 39 kDa band corresponding to the size of Dgqα3 can be seen in all the lanes.
Next we ascertained the presence of the Dgqα3 protein inDrosophila embryos by Western blot analysis of embryo extracts (Fig. 1C). The antiserum used recognizes the C-terminal end of the mammalian Gq protein. In Drosophila Gq this C-terminal sequence is conserved only in the Dgqα3 form (Fig.1A, asterisk) (see Materials and Methods). The results obtained indicate that a 39 kDa band, corresponding to the predicted size of the Dgqα3 protein, is present in embryos throughout development from as early as 0–8 hr.
dgqα3 RNA and protein are expressed predominantly in axonal tracts of the embryonic CNS
Presence of dgqα3 RNA and protein in embryos suggests an involvement of the dgq gene in Drosophiladevelopment. We therefore studied the expression pattern ofdgqα3 during embryonic development by in situhybridization with a dgqα3 splice variant-specific probe. Although dgqα3 RNA is present in earlier stages, tissue-specific expression of dgqα3 is first seen in the brain and ventral nerve cord at stage 13 (Fig.2A). This expression persists till late in development, where in addition, strong expression is seen in an anterior sense organ (Fig. 2B). This organ corresponds in position to the Bolwig's organ or the larval eye (Schmucker et al., 1992). In similar experiments with adgqα4-specific probe, no hybridization was observed to any region of the developing embryo (data not shown).
In situ localization ofdgqα3 RNA and protein in Drosophilaembryos. A,B, In situ hybridization of adgqα3-specific probe showing RNA expression at late stage 13 (A) and stage 16 (B). The arrows indicate localization of dgqα3 RNA in the ventral nerve cord (A) and the Bolwig's organ (B). C, D, Dgqα3 expression in the embryonic CNS observed by immunofluorescent staining using anti-Gq antibodies at stage 12 (C, arrows) and stage 17 (D). E,F, Confocal images of the developing CNS in an early stage 12 embryo after double-staining with anti-Gq (E) and the axonal marker mAb BP102 (F). G,H, Confocal images of the CNS from stage 15 embryos stained with Anti-Gq. Embryos were either heterozygous (G) or homozygous (H) for the Df(2R)vg-C.I,J, Embryos shown in Gand H were double-stained with mAb BP102. Heterozygous and homozygous deficiency embryos were distinguished by the presence of actin-lacZ on the balancer chromosome, which shows up as green spots (I, arrow). The commissures are poorly formed and appear thin in J. Anti-Gq was visualized using rhodamine-labeled secondary antibodies, whereas an FITC-linked secondary was used for BP102. Magnification: A–D, 200×; E–J, 600×. A–C are lateral views with dorsal side up. D–J are ventral views. In all cases anterior is to the left.
Expression of Dgqα3 during development of the embryonic nervous system was further confirmed by immunohistochemical staining of wild-type embryos with the Gq antiserum. The CNS inDrosophila embryos develops from a delaminated set of neuroblasts that derive from the ventral neuroepithelium after gastrulation (Goodman and Doe, 1993). These neuroblasts undergo a series of highly stereotyped cell divisions during embryonic stages 8–11, which lead to a well defined spatial pattern (Goodman and Doe, 1993). The expression of Dgqα3 at these and earlier stages appeared diffuse and non-neuronal (data not shown). The first indication of Dgqα3 expression in the CNS is at early stage 12 (Fig.2C). This is also the stage at which the pioneer neurons begin formation of axon pathways that give rise to the typical ladder-like appearance of the embryonic CNS, consisting of longitudinal tracts and anterior and posterior commissures that can be visualized with the axonal marker mAb BP102 (Fig. 2I). A similar pattern of expression of anti-Gq and the axonal marker mAb BP102 at early stage 12 suggests that Dgqα3 is expressed in the pioneer growth cones that give rise to the commissures (Fig.2E,F) (Klambt et al., 1991). At later stages of development Dgqα3 protein expression increases in the axonal tracts of the CNS (Fig. 2D,G). In addition, Dgqα3 expression was visible in the midgut epithelium at stages 12 (Fig.2C) and 13 (data not shown). Specificity of the anti-Gq antibody was determined by immunohistochemical staining of embryos that were either deficient for dgq in one copy (Fig.2G,I) or both copies (Fig.2H,J). The likely presence of the Dgqα3 protein in growth cones of early commissural axons lead us to examine the role for this gene in axonal growth and guidance.
Neuronal expression of the activated form of Dgqα3 causes abnormal midline crossing
Axonal guidance in the Drosophila CNS requires the interpretation of both attractive and repulsive cues, generated by cells that lie in the midline (Harris et al., 1996; Kolodziej et al., 1996; Mitchell et al., 1996; Culotti and Merz, 1998; Kidd et al., 1999). The expression pattern of Dgqα3 protein suggested that it might be required in early growth cones for the interpretation of these cues. To address this possibility, it was essential to alter Gαq signaling in a tissue and cell-specific manner. We therefore created transgenic strains with a dominant active form of Dgqα3, in which a glutamine residue at position 203 was mutated to a leucine. The mutation was made based on previous studies on dominant active forms of Gαq from mammalian cells and Drosophila (DeVivo et al., 1992; Lee et al., 1994). As controls we also generated transgenic lines carrying the wild-type form of Dgqα3. Both activateddgqα3 (UAS-AcGq3) and dgqα3(UAS-Gq3) cDNAs were placed under the control of theGAL4-inducible UAS promoter that would allow tissue and cell-specific expression. To study the effect ofUAS-AcGq3 expression on axonal development, we used the C155-GAL4 line initially, which expresses in all postmitotic neurons (Lin and Goodman, 1994). When stained with mAb BP102, the CNS of C155-GAL4; UAS-Gq3 embryos looked normal (Fig. 3A). In embryos expressing AcGq3, the pattern of the CNS appeared mildly deranged in that the commissures were thicker, and the neuropil region was broader than usual (Fig. 3B). More significant differences between the two genotypes were obvious when a monoclonal antibody against Fasciclin II (mAb 1D4) was used (Fig. 3C–H). At stage 13, anti-Fasciclin II (anti-Fas II) marks the pioneer axons that go to form the first longitudinal axon pathway (Fig. 3C), which by stage 16, defasciculates to form three distinct fascicles (Fig. 3G). These axons project ipsilaterally and do not cross the midline. In embryos of the genotype C155-GAL4; UAS-Gq3 this projection pattern was identical to wild-type embryos, indicating that overexpression of Dgqα3 has no effect on Fas II-expressing axons (Fig. 3C,E,G). However, in embryos expressing AcGq3, Fas II-positive axons appeared abnormal in all the embryos examined (Fig. 3D,F,H) with variations in the extent of abnormality. One obvious phenotype observed was that of “stalling” of Fas II-positive axons, which could be seen clearly at late stage 13 (Fig. 3D, arrowheads). At this stage, minute outgrowths from the cell bodies and axonal tracts were also visible (Fig. 3F, arrowheads). Stage 15 onward, Fasciclin II-expressing axons could be seen crossing the midline (Fig. 3H, arrow). Occasionally a whirling phenotype similar to that observed in robo mutant alleles was seen (Fig. 3H, asterisk) (Kidd et al., 1998a). A quantification of these phenotypes is given in Table 1.
Expression of activated Dgqα3 (AcGq3) in the CNS leads to defects in axonal growth and guidance. Embryos of the genotypeC155-GAL4; UAS-Gq3/+ orC155-GAL4/UAS-AcGq3 were stained with mAb BP102 (A, B, stage 15) or mAb 1D4, which is specific for Fas II (C–H). C–F, Late stage 13. Fas II-expressing axons are abnormal in embryos expressing AcGq3 (D, F) as compared with the control embryos inC and E. The arrowheads inD indicate stalled axons, and thearrowheads in F point toward minute outgrowths from neuronal cell bodies and axonal tracts.E and F are enlarged images fromC and D, respectively. At stage 15, Fas II-positive axons appear normal in G, whereas inH they are seen crossing the midline (arrow) through the posterior commissure and recrossing through the anterior commissure (*). I, Anti-βgal staining of a stage 16 embryo of the genotype C155-GAL4/+; UAS-Gq3/Ap-tauβgal. Normal ipsilateral projection of Apterous-expressing axons is observed (arrow); vc, ventral cell;dc, dorsal cell. J, Stage 16. Embryo of the genotype C155-GAL4/UAS-AcGq3; Ap- tauβgal/+. Axons derived from apterous-expressing lateral cell (lc) and dorsal cell (dc) cross the midline and stall (arrows). T2, Second thoracic segment;T3, third thoracic segment; A1, first abdominal segment. All photographs were taken at a magnification of 200×.
Quantitation of the CNS phenotypes induced by AcGq3
From these experiments the fate of the axons that cross the midline was unclear. For this purpose we generated a strain with the Apterous tau-βgalactosidase (Ap-tauβgal) construct in which single axons could be observed.Ap-tauβgal marks specific Apterous-expressing neurons in each hemisegment of the embryo. Normally these axons project anteriorly on the ipsilateral side to form a distinct Apterous fascicle (Fig. 3I, arrow) (Lundgren et al. 1995). In embryos of the genotype C155; UAS-AcGq3, axons from Apterous-expressing neurons no longer remain on the ipsilateral side but are now able to cross the midline (Fig. 3J, arrows). However, unlike axons that crossover in robomutant embryos (Wolf and Chiba, 2000), these appear to stall after reaching and crossing the midline.
Expression of AcGq3 in specific neurons leads to aberrant midline crossing
The phenotypes observed in embryos expressing AcGq3 suggest that Gq signaling can drive formation of the commissures and longitudinal tracts. This idea is supported by the phenotype observed in embryos homozygous for Df(2R)vg-C (which uncovers dgq) (Fig. 2J). In these embryos the commissures appear thinner, and there are extensive breaks in the longitudinal tracts. These phenotypes are considerably stronger than those observed forfrazzled mutants, which is also uncovered by the same deficiency, indicating that the effect of removing both Dgqand Frazzled is additive. However, these defects could be either caused by erroneous signaling within neurons so that they misinterpret existing cues, or by a non-autonomous mechanism that affects midline guidance cues. The latter would result in misplaced neurons or glia or neurons with changed identity. In Df(2R) vg-C embryos, the pattern of neurons expressing the Even-skipped (Eve) protein appear normal (data not shown), indicating that the defects seen occur after neuronal patterning is complete.
To confirm that the phenotype seen by expression of AcGq3 in the CNS is caused by altered signaling within neurons expressing AcGq3, we used more restrictive GAL4 drivers to express UAS-AcGq3 in specific subsets of neurons of the embryonic CNS.ftzng-GAL4 expresses in a small subset of neurons that include mostly motor neurons and some interneurons like vMP2, pCC, dMP2, and MP1 (Doe et al., 1988; Landgraf et al., 1999). These interneurons pioneer the longitudinal axon tracts, which stain positive for Fasciclin II. In addition, these axons never cross the midline. On expressing UAS-AcGq3 withftzng-GAL4, midline crossing by Fasciclin II-positive axons could be observed. At stage 13, the pCC axon which, normally projects anteriorly on the ipsilateral side, could be seen turning toward the midline (Fig.4B). At stage 16, aberrant midline crossing by the medial fascicle could be observed (data not shown). The number of midline crossovers at this stage is less as compared with C155-GAL4, presumably because of the restricted and comparatively weak expression of theftzng-GAL4 line (Table 1). Similar results were obtained witheveng-GAL4, which expresses in aCC, pCC, and RP2 neurons (Fig. 4C,D) (Baines et al., 1999;Featherstone et al., 2000). The pCC axon can be seen crossing the midline, whereas the aCC and RP2 projections look normal on expression of AcGq3 (Fig. 4D). Axons from Apterous-expressing dorsal cells (dc) can also change their trajectory on expression of AcGq3 (Fig. 4E,F). Instead of projecting toward the anterior and in an ipsilateral direction as is normal (Fig.4E,F, asterisks), a fraction of the axons can be seen drifting across the midline (Fig. 4F, arrowhead). The autonomy of AcGq3 function is further supported by the observation that neurons and glia are patterned normally inC155-GAL4/UAS-AcGq3 embryos, as judged by staining with anti-Eve and anti-Repo antibodies (data not shown). Taken together these data demonstrate that specific activation of Dgqα3 in ipsilaterally projecting neurons causes changes in their axonal trajectories so that they are now able to project across the midline.
Midline crossing by ectopic expression of AcGq3 appears cell autonomous. A, B, Embryos stained with anti-fasciclin II. C–F, Embryos stained with anti-βgal antibody. A,ftzng-GAL4/+ control embryo.B, Embryo of the genotype UAS-AcGq3/+;ftzng-GAL4/+. A,Late stage 13 embryo shows ipsilateral projection of the pCC axon (arrow). B, Early stage 13 embryo.Arrow indicates projection of the pCC axon toward the midline. C, UAS-tauβgal;eve-GAL4 embryo at stage 16 embryo. The pCC axon is not visible in this photomicrograph because it runs at a different focal plane from the cell bodies. D, UAS-AcGq3; UAS-tauβgal;eve-GAL4 embryo at stage 16. The pCC axon is seen projecting across the midline (arrowheads). Becauseeve-GAL4 expression was not consistent in each segment, quantification of this phenotype (Table 1) was done on the basis ofUAS-tauβgal expression. E, F, Abdominal segments of stage 15 embryos of the genotypeAp-GAL4/AcGq3F58c;apC-tauβgal/+. Normal longitudinal fascicles, projecting from the dorsal cell (dc), are marked with an asterisk,whereas the arrowhead in F shows an axon crossing the midline.
Midline crossing by ectopic expression of AcGq3 is independent of Robo downregulation
To understand how Dgqα3 acts to change axonal paths, we looked for possible interactions with genes known to affect midline guidance. Axons that cross the midline and project along the contralateral longitudinal tract normally need to downregulate expression of Robo, which acts as a receptor for the midline repellant Slit (Kidd et al., 1999). It is known that Robo downregulation requires Commissureless, but the precise mechanism is not understood (Tear et al., 1996; Kidd et al., 1998b). A possible mechanism by which AcGq3 could promote midline crossing was by downregulating Robo. To test this hypothesis we looked at Robo expression inftzng-GAL4;UAS-AcGq3 embryos. Interestingly, we find that Robo is not downregulated visibly in axons that ectopically cross the midline under the influence of AcGq3 (Fig.5B). The extent of Robo staining seen on these axons that aberrantly cross the midline is comparable with that seen on the longitudinal tracts. Thus, constitutive activation of Dgqα3 results in aberrant midline crossing of axons by a mechanism that is independent of Robo downregulation.
AcGq3 inhibits repulsive signaling by Robo through a mechanism independent of Robo downregulation. A–D are confocal images of stage 16 embryos stained with antibodies against Robo (A, B) and Fasciclin II (C, D).E and F are immunohistochemical and fluorescent images, respectively, of stage 16 embryos stained with antibodies against Fasciclin II. A, In a control embryo of the genotype ftzng -GAL4/+, Robo expression is confined to axons in the longitudinal tracts.B, An embryo of the genotypeUAS-AcGq3/+;ftzng -GAL4/+. Robo expression is observed in ectopic commissural axons (arrowhead). C, An embryo of the genotypeUAS-AcGq3/+;ftzng -GAL4/+. Arrowhead points to a single midline crossover. D,UAS-AcGq3/+;robo1/+;ftzng GAL4/+ embryo with enhanced midline crossovers (arrowheads).E, A stage 16 embryo of the genotypeC155-GAL4/+; UAS-roboY-F. F, A stage 16 embryo of the genotype C155-GAL4/+, AcGq3/+; UAS-roboY-F/+.
Reducing robo function enhances midline crossing by AcGq3
Another mechanism by which AcGq3 could induce midline crossing is through inhibition of the repulsive signal mediated by Robo. If this were so, then reducing levels of Robo by genetic means should enhance the phenotype of AcGq3. To test this, AcGq3 was expressed usingftzng-GAL4 in embryos carrying a single copy of the robo1 mutant allele.robo1 is a recessive mutation. However, embryos with one copy of this mutation show midline crossing at a frequency of ∼10% (Fritz and VanBerkum, 2000) (Fig. 5C, Table 1). WhenUAS-AcGq3;robo1/+;ftzng-GAL4embryos were stained with mAb 1D4, a significant increase in the number of midline crossovers was observed as compared with embryos of the genotypeUAS-AcGq3;+/+;ftzng-GAL4 (Fig.5D, Table 1) This suggests that activation of Dgqα3 antagonizes the repulsive output through Robo resulting in excessive midline crossing. The antagonism could be mediated either through phosphorylation of Robo or signaling components that function downstream and/or in parallel with Robo.
Phosphorylation of a single tyrosine residue on Robo by Abelson (Abl) tyrosine kinase inhibits Robo repulsive signaling and is needed for normal midline crossing to take place. Expression of a mutant form of Robo in which this tyrosine residue (Y1040) has been replaced with a phenylalanine (in a transgenic strain referred to asUAS-roboY-F), lead to constitutive Robo signaling such that no axons cross the midline, resulting in a complete absence of commissure formation (Bashaw et al., 2000). If AcGq3 acts upstream of Robo, we predicted that ectopic midline-crossovers, induced by expression of AcGq3, would be reduced in presence of Robo Y-F. In fact, in embryos expressing both AcGq3 and Robo Y-F, no ectopic crossovers are seen (Fig. 5F, Table 1), indicating that AcGq3 could inhibit Robo signaling by promoting Robo phosphorylation. This finding is also supportive of the fact that AcGq3 exerts its effect independent of Commissureless-mediated Robo downregulation. It is possible however, that AcGq3 acts through a parallel pathway that is no longer effective in the presence of Robo Y-F (see Discussion).
Ectopic midline crossing requires Frazzled function
Both the spatiotemporal pattern of expression and functional analysis of dgq indicate that Gq activation in vivo promotes midline crossing. Axons that cross the midline need to turn down their repulsive signaling pathway(s) as well as respond positively to attractive cues. We therefore looked to see if changes in the levels of “attractive” signaling such as the Netrin-Frazzled pathway affect the phenotype of AcGq3. Interestingly, AcGq3 phenotype shows a dosage-dependent interaction with Fra. Removal of a single copy of the Fra gene led to a threefold reduction in the number of midline crossovers induced by AcGq3 (Table 1). A further reduction was observed on removal of both copies of the Fragene as seen in embryos of the genotypeC155-GAL4/UAS-AcGq3;fra3/fra4 (Table 1, Fig. 6C). Signaling through AcGq3 is thus sensitive to levels of Frazzled in the CNS.
Frazzled function is essential for ectopic midline crossing induced by UAS-AcGq3. A–C, Stage 16 embryos stained with mAb 1D4. D–F, Stage 14 embryos stained with antibodies against Connectin. A, In wild-type embryos, three distinct fascicles can be observed on either side of the midline. B, An embryo of the genotypeC155-GAL4/+;fra3/fra4. C, An embryo of the genotypeC155-GAL4/UAS-AcGq3;fra3/fra4;+/+. Aberrant midline crossing by ipsilateral axons is absent.D, C155-GAL4/+;fra/CyoActβgal embryo at stage 14 showing the wild-type staining pattern of anti-Connectin antibody (Meadows et al., 1994). A Connectin-positive axon is seen projecting through the posterior commissure (arrowhead).E, Embryo of the genotypeC155-GAL4/+;fra3/fra4 ;F,C155-GAL4/UAS-AcGq3;fra3/fra4;+/+embryo, show breaks in connectin positive commissural axon (arrowheads).
To examine the effect, if any, of AcGq3 on the frazzledmutant phenotype, embryos of the genotypeC155-GAL4/UAS-AcGq3;fra3/fra4 were examined with anti-connectin antibody (Fig. 6) and BP102 (data not shown). Anti-connectin labels a distinct axon fascicle in the longitudinal connectives, axon projections of SP1 and RP1 neurons that project through the anterior commissure, and a subset of axons that project through the posterior commissure to their contralateral targets (Fig. 6D, arrowhead) (Meadows et al., 1994). In embryos of the genotype C155-GAL4/+; fra3/fra4 , breaks were observed in connectin-positive commissural axons and longitudinal tracts (Fig. 6E, arrowhead). Embryos of the genotypeC155-GAL4/UAS-AcGq3;fra3/fra4 also show similar breaks (Fig. 6F, arrowhead), indicating that AcGq3 does not have an effect on thefrazzled mutant phenotype. Similar results were obtained by staining with BP102.
DISCUSSION
Embryonic expression of Dgqα3
Dgq was originally identified from a head cDNA library as a homolog of mammalian Gαq (Strathmann and Simon, 1990). Initial functional characterization suggested that it was a visual-specific G-protein essential for Drosophila visual transduction (Lee et al., 1990, 1994; Scott et al., 1995). However, from subsequent studies it was apparent that splice variants of dgq existed in other adult tissues (Talluri et al., 1995; Alvarez et al., 1996). In this study we have analyzed dgq expression and function during development of the Drosophila embryonic CNS. From analysis of dgq transcripts and protein we have shown that the dgqα3 splice variant is the primary embryonic form, suggesting multifunctional roles for this protein. Considering the broad expression pattern of dgq, a traditional mutagenesis approach might be unable to address late developmental phenotypes caused by dgqα3 loss-of-function. The UAS-GAL4system offered an alternate strategy that allowed us to dissectdgqα3 function during axon guidance. UAS-AcGq3essentially functions as a dominant gain-of-function allele in a tissue- and cell-specific manner.
Function of Dgqα3 in the embryonic CNS
The induction of ectopic midline crossing by AcGq3 suggests that Dgqα3 function might be required during commissural growth. What activates Dgqα3 in vivo? In Drosophila, the only pathway so far known to mediate attraction toward the midline, is the Netrin-Frazzled signaling pathway. However, null mutants fornetrins and frazzled continue to show formation of commissures, albeit thin and poorly organized. The failure to show a complete absence of commissures suggests that an alternate signaling pathway or pathways exists at the midline that promotes commissural growth. The presence of a second attractive signaling pathway operating at the midline has also been suggested based on analysis of mutants involved in formation of commissures (Hummel et al., 1999a,b). Dgqα3 might act as a component of this alternate pathway to promote commissural growth.
Signaling mechanisms involved in DCC/Frazzled-mediated attraction are poorly understood in vertebrates as well as invertebrates. In vitro studies using pharmacology in vertebrate systems have shown that guidance mediated by Netrin-1 is dependent on cAMP levels in the growth cone. Increase in cAMP levels results in attraction, whereas low levels of the cyclic nucleotide causes repulsion (Song et al., 1997). In Xenopus cultured neurons, Netrin-1-induced turning response has also been shown to depend on Ca2+ influx through the plasma membrane and Ca2+-induced Ca2+ release through intracellular stores (Hong et al., 2000). The involvement of second messengers such as Ca2+ and cAMP suggests that G-protein-coupled signaling pathways might be involved. Heterotrimeric G-proteins are also thought to play a role in neuronal migration (Horgan et al., 1994) and growth cone collapse (Nakayama et al., 1999). A study implicating the Adenosine A2b receptor in Netrin-1 signaling supports this idea (Corset et al., 2000). More recently however, it has been shown that DCC can bind Netrin-1 and signal attraction independent of the Adenosine A2b receptor (Stein et al., 2001). This study shows that DCC undergoes a ligand-dependent dimerization essential for its signaling that remains unaffected even in the presence of antagonists to adenosine receptors, thus providing evidence that DCC alone is central to Netrin-1 signaling. As compared with vertebrates, the mechanism of Netrin signaling in Drosophila is still obscure. Recent studies involving this signaling pathway have, however, suggested that a second receptor for Netrins could exist in the nervous system (Gong et al., 1999; Hiramoto et al., 2000). Given the evolutionarily conserved nature of both, the ligand and the receptor, similar downstream signaling elements are very likely involved in mediating attraction. It is possible that a seven transmembrane domain receptor activates Dgqα3 signaling in response to novel attractive cues or Netrins leading to increase in Ca2+ levels and thus promoting attraction.
Our results from the genetic analysis of AcGq3 andfrazzled suggest that Frazzled function is essential for AcGq3-mediated ectopic midline crossing. In addition, they also indicate that Dgqα3 does not function downstream offrazzled signaling. A simple explanation for these observations could be that activity of Dgqα3 and Frazzled are both essential to promote midline crossing. The effects of the two signaling pathways are additive; activation of Frazzled and Dgqα3 are both necessary to elicit attraction. Removal of one or both copies offrazzled in the presence of AcGq3 simply reduces the sum total of attraction sensed by the growth cone, thus inhibiting aberrant midline crossing of ipsilateral axons.
Interaction of AcGq3 with robo
The antagonism between AcGq3 and Robo suggests that AcGq3 operates by modulating repulsion from the midline during commissural growth. It has been demonstrated that Robo signaling is negatively modulated by tyrosine phosphorylation by Abelson kinase (Bashaw et al., 2000). Our results in Figure 5 suggest that AcGq3 could inhibit Robo signaling by a similar mechanism of phosphorylating Robo. It could perhaps do this by activating a kinase cascade involving a nonreceptor tyrosine kinase such as Bruton's tyrosine kinase (BTK or Tec kinase) which, in mammalian cells, has been shown to be a direct effector of Gq signaling (Bence et al., 1997; Ma and Huang, 1998). Our results are equally consistent with the possibility that AcGq3 and Robo act through parallel pathways, such that AcGq3 induced midline crossing requires downregulation of Robo signaling.
Based on the results obtained from genetic analysis of AcGq3with frazzled and robo, the following models can be proposed to explain the function of Dgqα3. In the first, Dgqα3 can be thought of as being a component of the attractive signaling pathway alone. Expression of the activated form of the protein functions to override the repulsive cues at the midline and promote ectopic midline crossing. In such a scenario, one would argue that the synergism observed between AcGq3 androbo1 is a consequence of the combined effect of reduced Robo signaling and excess attractive signaling induced by AcGq3 leading to an increase in the number of midline crossovers. In the presence of UAS-RoboY-F, repulsive signaling increases to a level that cannot be overriden by AcGq3-attractive signaling. A second possibility is that Dgqα3 is a component of an attractive signaling pathway, which functions to potentiate Frazzled signaling by negatively modulating the repulsion mediated by Robo signaling. This could be through phosphorylation of Robo. A recent study using spinal axons from stage 22Xenopus embryos has shown that the repulsive ligand Slit can “silence” the Netrin-mediated attraction through a direct physical interaction between the cytoplasmic domains of Robo and Frazzled (Stein and Tessier-Lavigne, 2001). This ligand-dependent silencing effect serves to promote repulsion of growth cones from the midline during the development of commissures. Dgqα3 might function conversely at the level of downstream effector molecules to inhibit repulsion in response to attractive cues to promote midline crossing.
In summary, our results predict the involvement of a Gq-mediated signaling pathway in regulating midline crossing inDrosophila. In addition, they also support the notion that balance between attraction and repulsion is a crucial factor that determines the final response of a growth cone to different cues. Inhibition of dgq function specifically in the growth cones should prove useful in dissecting out other components of this pathway that regulates midline crossing.
Footnotes
This work was supported by a grant from the Department of Biotechnology, Government of India, and core funding from National Center for Biological Sciences. We thank Mattias Landgraf for useful discussions and Veronica Rodrigues, Satyajit Mayor, and K. VijayRaghavan for critical comments on this manuscript.
Correspondence should be addressed to Gaiti Hasan, National Center for Biological Sciences, Tata Institute of Fundamental Research, Gandhi Krishi Vigyan Kendra Campus, Bellary Road, Bangalore 560065. E-mail:gaiti{at}ncbs.res.in.
