Figure 3.
Molecular map of the S6KII gene (partitions, 0.5 kb). The following are shown: EcoRV restriction sites; insertion site of P[lacW] of the ignP1 mutant; the exon/intron structure of S6KII and predicted neighboring genes; structure of sequenced cDNAs (SD0522, GH21818, and GH08264); extension of deletions; the rescue construct; and the regions amplified by RT-PCR (a, with primers GCGGCAAAATCGTGTCCCTTTC and CTGGATTTTCTTCGTGGCGGTG; b, with primers ACCTCGGGAGCCACAAAATTGG and AGCATCCACATCCACTTCTGCC; c, with primers ATATAGATGCCCCGCACAG and GCAGCAGAATCACATCTCC). N-K, N-terminal kinase domain; C-K, C-terminal kinase domain.