Abstract
Recent studies indicate that the descending serotonin (5-HT) system from the rostral ventromedial medulla (RVM) in the brainstem and the 5-HT3 receptor subtype in the spinal dorsal horn are involved in enhanced descending pain facilitation after tissue and nerve injury. However, the mechanisms underlying the activation of the 5-HT3 receptor and its contribution to facilitation of pain remain unclear. In the present study, activation of spinal 5-HT3 receptor by intrathecal injection of a selective 5-HT3 receptor agonist, SR57227, induced spinal glial hyperactivity, neuronal hyperexcitability, and pain hypersensitivity in rats. We found that there was neuron-to-microglia signaling via chemokine fractalkine, microglia to astrocyte signaling via the cytokine IL-18, astrocyte to neuronal signaling by IL-1β, and enhanced activation of GluN (NMDA) receptors in the spinal dorsal horn. In addition, exogenous brain-derived neurotrophic factor-induced descending pain facilitation was accompanied by upregulation of CD11b and GFAP expression in the spinal dorsal horn after microinjection in the RVM, and these events were significantly prevented by functional blockade of spinal 5-HT3 receptors. Enhanced expression of spinal CD11b and GFAP after hindpaw inflammation was also attenuated by molecular depletion of the descending 5-HT system by intra-RVM Tph-2 shRNA interference. Thus, these findings offer new insights into the cellular and molecular mechanisms at the spinal level responsible for descending 5-HT-mediated pain facilitation during the development of persistent pain after tissue and nerve injury. New pain therapies should focus on prime targets of descending facilitation-induced glial involvement, and in particular the blocking of intercellular signaling transduction between neuron and glia.
Introduction
Recent studies indicate that behavioral hypersensitivity and neuronal hyperexcitability in the CNS in animal models of persistent pain are closely linked to long-lasting activation of descending modulatory circuits involving descending facilitation (Pertovaara et al., 1996; Urban et al., 1999; Wei et al., 1999; Burgess et al., 2002; Suzuki et al., 2002; for review, see Pertovaara, 2000; Porreca et al., 2002; Gebhart, 2004; Ren and Dubner, 2007). It has been well established that the descending serotonin (5-HT) system from the rostral ventromedial medulla (RVM) of the brainstem is involved in the modulation of spinal nociceptive transmission (Roberts, 1984; Fields et al., 1991; Zhuo and Gebhart, 1991; Sawynok and Reid, 1996). Selective lesions of spinal 5-HT fibers (Géranton et al., 2008) or molecular depletion of 5-HT in RVM neurons (Wei et al., 2010) have been reported to attenuate behavioral hypersensitivity by injury. These effects of the descending 5-HT system resulted from the activation of diverse 5-HT receptor subtypes found in the spinal dorsal horn (Hamon and Bourgoin, 1999; Millan, 2002; Lopez-Garcia, 2006). 5-HT3 receptors, the only ligand-gated cation channel with excitatory functions in the 5-HT receptor family, are expressed in spinal dorsal horn neurons and the central terminals of primary afferent neurons (Kia et al., 1995; Conte et al., 2005). Spinal 5-HT3 receptor-dependent descending pain facilitation has recently been implicated in the development of inflammatory and neuropathic pain (Suzuki et al., 2002; Lopez-Garcia, 2006; Rahman et al., 2006; Aira et al., 2010; Lagraize et al. 2010). However, the signaling cascade underlying the contribution of spinal 5-HT3 receptors to descending pain facilitation remains unclear.
Ample evidence suggests that glial cells in the spinal cord contribute to pain hypersensitivity after injury (Scholz and Woolf, 2007; Ren and Dubner, 2008, 2010; Milligan and Watkins, 2009; Gao and Ji, 2010). In addition to glutamate, spinal neurons and the central terminals of primary afferents release chemokines, such as fractalkine (CX3CL1), activating nearby glial cells (Milligan et al., 2004, 2008). Furthermore, hyperactivated glia amplify neuronal excitability and facilitate nociceptive transmission in spinal cord via release of proinflammatory cytokines (e.g., IL-1β and TNF-α) (DeLeo and Yezierski, 2001; Hansson and Ronnback, 2004; Guo et al., 2007). Increasing attention has been given to neuron-glia-neuron signaling as a driving force in the development and maintenance of persistent pain (Scholz and Woolf, 2007; Ren and Dubner, 2008, 2010; Milligan and Watkins, 2009; Gao and Ji, 2010).
Utilizing a model of 5-HT3 receptor agonist-induced hyperalgesia, we tested the hypothesis that neuron–glial interactions involving chemokine/cytokine signaling molecules underlies mechanisms of pain hypersensitivity after spinal 5-HT3 receptor activation. Our findings provide evidence that a spinal neuron-glia-neuron signaling cascade including endogenous fractalkine, the cytokines IL-18 and IL-1β, and neuronal GluN (NMDA) receptor activation, contribute to 5-HT3 receptor-mediated hyperalgesia. Thus, spinal neuronal-glial interactions underlying the development of hyperalgesia and allodynia not only depend on nociceptive drive from primary afferents after tissue and nerve injury (Guo et al., 2007; Wang et al., 2010), but also require a maintenance of descending facilitation from RVM 5-HT-spinal 5-HT3 receptor systems.
Materials and Methods
Animals.
Adult male Sprague Dawley rats weighing 200–300 g (Harlan) were used in all experiments. Rats were on a 12 h light/dark cycle and received food and water ad libitum. The experiments were approved by the Institutional Animal Care and Use Committee of the University of Maryland Dental School (Baltimore, MD).
Intrathecal injection.
A lumber puncture procedure was adapted according to Hylden and Wilcox (1980). Briefly, rats were anesthetized with 2–3% isoflurane in a gas mixture of 30% O2 balanced with nitrogen and placed in a prone position on a Styrofoam board with the forelimbs extended rostrally and the hind limbs hanging off the board. A portion of the caudal half of the rat's back was shaved and scrubbed with providone-iodine solution. A disposable 25 gauge, 1 inch needle connected to a 25 μl luer tip Hamilton syringe was inserted slowly at the intervertebral space between the L4 and L5 vertebrae, and the needle was allowed to penetrate the dura. A quick flick of the tail or a limb indicated entrance into the intrathecal space. Rats awoke within minutes upon the completion of intrathecal injection and termination of anesthesia.
Intra-RVM microinjection and gene transfer.
For intra-RVM microinjection, rats under anesthesia with 3% isoflurane were placed in a Kopf stereotaxic instrument (Kopf Instruments). A midline incision was made after infiltration of lidocaine (2%) into the skin. A midline opening was made in the skull with a dental drill to insert a microinjection needle into the target site. The RVM is termed for collective structures that consist of the midline nucleus raphé magnus (NRM) and the adjacent gigantocellular reticular nucleus α part (NGCα). The coordinates for the NRM were as follows: 10.5 mm caudal to bregma, midline, and 9.0 mm ventral to the surface of the cerebellum (Paxinos and Watson, 2005). To avoid penetration of the transverse sinus, the incisor bar was set at 4.7 mm below the horizontal plane passing through the interaural line. Animals were subsequently maintained at 1% halothane. Microinjections were performed by delivering drug solutions slowly over a 10 min period using a 0.5 μl Hamilton syringe with a 32 gauge needle. Human recombinant brain-derived neurotrophic factor (BDNF, 100 fmol; Amgen) (Guo et al., 2006) was dissolved in ACSF. The sham group underwent identical procedures with injection of the same volume of the vehicle. All wound margins were covered with a local anesthetic ointment (Nupercainal; Rugby Laboratories), the wound was closed, and animals were returned to their cages after they recovered from anesthesia. For gene transfer as described previously (Wei et al., 2010), SureSilencing shRNA plasmids (TCAACATGCTCCATATTGAAT) for rat neuronal tryptophan hydroxylase-2 (Tph-2), the rate-limiting enzyme in the synthesis of 5-HT in the CNS, or scrambled control (GGAATCTCATTCGATGCATAC) (0.5 μg/0.5 μl; SuperArray) was injected into the RVM. Focal electroporation around the RVM area was delivered by seven square wave electric pulses (50 ms, 40 V, 1 Hz; model 2100, A-M Systems). The wound was closed and animals returned to their cages after they recovered from anesthesia.
Pain models and behavioral testing.
To establish a persistent pain model with L5 spinal nerve ligation (L5 SNL), rats were anesthetized with 2–3% isoflurane in a gas mixture of 30% O2 balanced with nitrogen, and the left L5 spinal nerve was exposed and tightly ligated with 4–0 soft silk thread. Sham surgery was used as a control. To examine whether there were effects of descending 5-HT depletion on spinal glial hyperactivity induced by peripheral inflammation, complete Freund's adjuvant (CFA) (50 μl, 25 μg Mycobacterium tuberculosis) was injected subcutaneously into the plantar surface of the left hindpaw 3 d following gene transfer.
Animals were placed in clear plastic chambers on an elevated table and allowed to acclimate for ∼30 min. Nociceptive responses to thermal and mechanical stimuli were measured. Thermal hyperalgesia was assessed by measuring the latency of paw withdrawal in response to a radiant heat source. A radiant heat stimulus was applied from underneath the glass floor with a high-intensity projector lamp bulb (8 V, 50 W; Osram). The heat stimulus was focused on the plantar surface of each hindpaw, and the paw withdrawal latency (PWL) was determined by an electronic clock circuit. The bulb voltage was adjusted to derive a baseline withdrawal latency (10–12 s) in naive animals. A 20 s cutoff was used to prevent tissue damage. The PWL was tested for three trials with 5 min intervals between each trial. The average of the three trials was then determined. The mechanical sensitivity was measured with a series of calibrated von Frey filaments before and after gene transfer and tissue or nerve injury. An EF50 value was defined as the von Frey filament force (g) that produced a 50% frequency of the paw withdrawal responses and was used as a measure of mechanical sensitivity. Body weight and hindpaw diameters were determined before and after gene transfer as well as at 1 and 3 d after inflammation. All behavioral tests were conducted under blind conditions.
Intra-RVM electrical stimulation.
Rats were anesthetized with 1.5% isoflurane and mounted in a stereotaxic apparatus. The stimulation site in the RVM was located stereotaxically as described above (see Intra-RVM microinjection and gene transfer). A concentric bipolar stimulating electrode was introduced into the RVM. Trains (2 min on and 30 s off) of stimuli of 0.5 ms square wave pulse were applied with low (10 μA) or high (100 μA) intensity at 10 Hz for 15 min. The sham group was received an electrode placement without stimulation. At 30 min after stimulation, sham and treated rats were anesthetized with 2% halothane and decapitated. The spinal dorsal horn tissues at L4-L5 were removed for Western blot to examine the expression of CD11b and glial fibrillary acidic protein (GFAP).
Immunohistochemistry.
One, two, and four hours after intrathecal injection of drugs, rats were deeply anesthetized with pentobarbital sodium (100 mg/kg, i.p.) and transcardially perfused with 200 ml of normal saline followed by 500 ml of 0.1 m phosphate buffer containing 4% paraformaldehyde, pH 7.4. The lumber spinal cord was removed, postfixed, and transferred to 20% sucrose overnight. Transverse sections (free-floating, 20–40 μm) were cut with a cryostat. The free-floating sections were incubated with relevant antibodies with 1% normal goat sera and 0.3% Triton X-100 overnight at 4°C. After washes in PBS, the sections were incubated with relevant IgGs conjugated to Cy3 or Cy2 (1:500; Jackson ImmunoResearch) for 4 h at room temperature or overnight at 4°C. For the double immunofluorescent staining for IL-18 and NeuN, GFAP, or Iba-1, the tyramide signal amplification (PerkinElmer Life Sciences) fluorescence procedures (Michael et al., 1997) were used to detect staining for goat anti-IL-18 polyclonal antibody (1:10000; R & D Systems). Following washes, the stained sections were mounted on gelatin-coated slides and coverslipped with Vectashield (Vector Laboratories). Slides were examined with a Nikon fluorescence microscope and images were captured with a CCD Spot camera. A Bio-Rad laser scanning confocal microscope was also used for higher magnification and colocalization.
Western blot.
Rats were killed1 h, 2 and 4 h after intrathecal injection of drugs. The L5-L6 spinal cord was rapidly removed and the dorsal half was separated and frozen on dry ice. The tissues were homogenized in solubilization buffer (50 mm Tris HCl, pH 8.0, 150 mm NaCl, 1 mm EDTA, 1% NP-40, 0.5% deoxycholic acid, 0.1% SDS, 1 mm Na3VO4, 1 U/ml aprotinin, 20 μg/ml leupeptin, 20 μg/ml pepstatin A). The homogenate was centrifuged at 14,000 rpm for 10 min at 4°C. The supernatant was removed. The protein concentration was determined using a detergent-compatible protein assay with a bovine serum albumin standard. Each sample contains proteins from one animal. Protein samples (35 μg) were separated using 7.5% SDS-PAGE and blotted on a nitrocellulose membrane (GE Healthcare). The blots were blocked with 5% milk in Tris-buffered saline (TBS) for 30 min and then incubated with respective antibodies overnight at 4°C. The membrane was washed with TBS and incubated with anti-goat/mouse/rabbit IgG (1:1000; Santa Cruz Biotechnology) for 1.5 h at room temperature. The immunoreactivity was detected using enhanced chemiluminescence (ECL; GE Healthcare). Some blots were further stripped in a stripping buffer (Thermo Scientific) for 30 min at 50°C. The loading and blotting of equal amounts of protein were verified by reprobing the membrane with anti-β-actin antiserum (Sigma).
Data analysis.
Data were presented as means ± SEM and analyzed using one-way or two-way ANOVA. The significant differences between the groups were determined by a post hoc test. p < 0.05 is considered significant for all cases. For Western blot analysis, the ECL-exposed films were digitized and immunoreactive bands were quantified by U-SCAN-IT gel (version 4.3; Silk Scientific). The relative protein levels were obtained by comparing the respective specific band to the β-actin control from the same membrane. The deduced ratios were further normalized to that of the naive rats on the same membrane and illustrated as the percentage of the naive controls. Raw data (ratios of the respective band over β-actin) were used for statistical comparisons.
Drugs and antibodies.
The following drugs were used for intrathecal injection: 5-HT3 receptor agonist SR-57227 hydrochloride (Tocris Bioscience); 5-HT3 receptor antagonist Y-25130 (Tocris Bioscience), fractalkine (aa 22–100, R & D Systems), neutralizing antibody against rat CX3CR1 (CX3CR1 Ab, Torrey Pines Biolabs); IL-1β receptor (IL-1ra, Amgen); anti-IL-18 receptor (IL-18R Ab, R & D Systems); recombinant rat IL-18 (R & D Systems); and IL-1β (PeproTech).
The following antibodies were used for Western blot and immunohistochemistry, The polyclonal primary antibodies were used in the following dilutions: anti-5-HT3 receptor (1:500, Calbiochem); anti-GFAP (1:10,000 from Millipore or 1:1000 from Millipore Bioscience Research Reagents); anti-S100β (1:1000, Millipore); anti-Iba-1 (1:1000, Wako); anti-fractalkine (1:1000, Novus Biological); anti-CX3CR1 (1:1000, Torrey Pines Biolabs); anti-IL-18 (1:400, R & D Systems); anti-IL-18R (1:500, R & D Systems); anti-IL-1β (1:500, Endogen); anti-IL-1R (1:500, Santa Cruz Biotechnology); and anti-p-GluN1 (or NR1) Ser896 (1:1000, Millipore). The monoclonal primary antibodies were used in the following dilutions: anti-CD11b (clone OX-42, 1:1000, Serotec); anti-NeuN (1:1000 from Millipore or 1:2000 from Millipore Bioscience Research Reagents); anti-GluN1 (1:1000, Millipore); and anti-β-actin (Sigma-Aldrich).
Results
Activation of spinal 5-HT3 receptors induces hyperalgesia and allodynia
Our previous study demonstrated that descending 5-HT-dependent pain facilitation contributes to behavioral hyperalgesia and allodynia after peripheral inflammation and nerve injury (Wei et al., 2010). Recently, we also found that the spinal 5-HT3 receptor mediated the development of pain hypersensitivity after inflammation induced by hindpaw injection of CFA (Lagraize et al., 2010). To identify an involvement of the spinal 5-HT3 receptor in neuropathic pain, we further examined the effect of the blockade of spinal 5-HT3 receptor function on the maintenance of neuropathic pain. Intrathecal injection (i.t.) of the selective 5-HT3 receptor antagonist Y25130 (30 fmol) alone did not produce an effect on the baseline of thermal and mechanical sensitivity in sham animals (Fig. 1A,B) as shown by withdrawal latencies (PWLs) to noxious heat (Fig. 1A) and withdrawal threshold (EF50) to mechanical stimulation (Fig. 1B), suggesting the absence of tonic activation of spinal 5-HT3 receptors in the rats without injury. However, this dose of Y25130 significantly and reversibly attenuated nerve injury-induced thermal hyperalgesia and mechanical allodynia for at least 24 h when compared with the response in vehicle-treated rats (Fig. 1A,B). To investigate whether the spinal 5-HT3 receptor directly mediated descending pain facilitation, we also examined the effect of Y25130 on intra-RVM exogenous BDNF-induced hyperalgesia and allodynia. As reported previously (Guo et al., 2006; Wei et al., 2010), microinjection of BDNF (100 fmol) into the RVM produced long-lasting, shorter PWLs (Fig. 1C) and bottom EF50 (Fig. 1D), which were completely blocked by pretreatment with Y25130 (30 fmol, i.t.) (Fig. 1C,D). These data suggest that the spinal 5-HT3 receptor mediates descending pain facilitation during the development of persistent pain. In addition, to identify the direct effect of activating the spinal 5-HT3 receptor on the behavioral pain response, we also intrathecally injected the selective 5-HT3 receptor agonist SR57227 and measured its influence on thermal and mechanical sensitivity of the hindpaw of the rat (Fig. 1E,F). After injection, SR57227 induced significant thermal hyperalgesia as compared to vehicle (p < 0.05, n = 6 rats per group) in a range of doses from 10 pmol to 1 nmol (Fig. 1E). This hypersensitive effect was maximal at a dose of 10 pmol, peaking at 1–2 h and lasting at least for 4 h. A lower dose (1 pmol) was without effect on PWLs. Conversely, a higher dose (10 nmol) of SR57227 produced a transient increase of thermal thresholds to noxious heat. Meanwhile, intrathecal SR57227 significantly resulted in mechanical hypersensitivity at 1–4 h after injection in a similar range of doses. To verify whether SR57227-induced behavioral hypersensitivity was mediated by 5-HT3 receptors, Y25130 (30 fmol) was injected intrathecally at 30 min before SR57227 (10 pmol). The pretreatment of Y25130 completely blocked the thermal hypersensitive effect of SR57227 at 1–4 h (Fig. 1G; p < 0.05, n = 6) and mechanical allodynia at 2 h compared to pretreatment with vehicle (Fig 1H; p < 0.001, n = 4). This dose exploration study in rats indicates that activation of the spinal 5-HT3 receptor induces long-lasting hyperalgesia and allodynia, supporting recent findings that spinal 5-HT3 receptor activation is involved in the development of descending pain facilitation.
Selective activation of spinal 5-HT3 receptor increases expression of microglial CD11b and astrocytic GFAP
What are the possible mechanisms underlying spinal 5-HT3 receptor activation-induced hyperalgesia and allodynia? In the spinal cord, glial activity is critical for the induction and maintenance of hyperalgesia after tissue and nerve injury. Thus, we hypothesized that 5-HT3 receptor-induced hyperalgesia and allodynia involved changes in the activity of spinal glial cells. Biochemical markers for microglia (CD11b) and astrocytic cells (GFAP) were used to determine the location of glial expression with immunohistochemistry (Fig. 2A) and to assess the changes in expression using Western blotting (Fig. 2B) after spinal 5-HT3 receptor activation. The microglia and astrocytes exhibited hypertrophy with thicker processes and larger and densely stained cell bodies in spinal dorsal horn at L5 2 h after intrathecal injection of SR57227 (10 pmol) in comparison with vehicle treatment (Fig. 2A). Consistently, a significantly enhanced expression pattern of both GFAP and CD11b was identified in the lumbar spinal dorsal horn at 1 and 2 h after application of SR57227 (Fig. 2B). Furthermore, blockade of spinal 5-HT3 receptor activation by pretreatment with Y25130 (30 fmol, i.t.) prevented SR57227-induced increase of GFAP and CD11b expression in the spinal dorsal horn 2 h after injections (Fig. 2C). These results indicate enhanced expression of microglial CD11b and astrocytic GFAP after direct activation of 5-HT3 receptors in the spinal dorsal horn.
Selective expression of 5-HT3 receptors in neurons but not in glia
Since SR57227 induced astrocytic and microglial hyperactivity, we wondered whether this compound directly acted on glial cells to produce its effects. Although the existence of the 5-HT3 receptor has been reported in neuronal soma and terminals in the dorsal horn (Kia et al., 1995; Conte et al., 2005), it is not known whether the 5-HT3 receptor is also expressed in spinal glial cells. Therefore, we examined the distribution of the 5-HT3A receptor in the spinal cord and its possible expression in glial cells. As shown in Figure 3Ba, intense immunoreactivity of the 5-HT3A receptor was observed in the superficial layers of the spinal dorsal horn. In addition, weak to moderate expression of 5-HT3 receptors was scattered throughout the spinal cord. Western blot analysis showed no significant differences in the level of 5-HT3 receptor among groups of naive rats and rats in which SR57227 or saline was intrathecally injected (n = 3 per group, data not shown). Double immunolabeling with 5-HT3A receptor and GFAP or CD11b showed no expression of the 5-HT3 receptor in astrocytes and microglia, including glial soma and processes (Fig. 3A). Similarly, labeling for the 5-HT3 receptor was not seen in both hyperactive astrocytic and microglial elements in the spinal dorsal horn following administration of SR57227 (data not shown). In contrast, 5-HT3A receptors were distributed throughout neuronal soma and many neurites in the spinal dorsal horn, typically as small clusters associated with the cell membrane of the neurons labeled with NeuN (Fig. 3Bb). Consistent with previous reports (Kia et al., 1995; Conte et al., 2005), these data confirm that 5-HT3 receptors are primarily expressed in some neuronal soma and terminals but not in glial cells in the spinal dorsal horn.
5-HT3 receptor-labeled neurons express fractalkine in the dorsal horn
In view of the absence of 5-HT3A receptors in glial cells of the spinal dorsal horn, we reasoned that 5-HT3 receptor-expressing neurons or terminals may mediate SR57227-induced glial hyperactivity by releasing neuroactive substances. The chemokine fractalkine (CX3CL1) has been found in sensory afferents and intrinsic spinal cord neurons (Bazan et al., 1997), whereas its receptor, CX3CR1, is expressed predominantly in microglia (Imai et al., 1997; Verge et al., 2004; Clark et al., 2009) and may act as a specific neuron-to-glia signal in the spinal cord (Milligan et al., 2008). Therefore, to identify the possible participation of fractalkine as a signaling molecule between neuron and glia in SR57227-induced behavioral hypersensitivity and glial hyperactivity, we investigated the expression of fractalkine in 5-HT3A receptor-labeled neurons in the spinal dorsal horn. Immunoreactivity of fractalkine was observed in numerous dorsal horn neurons (Fig. 3C) and terminals (data not shown). Double staining indicated that all 5-HT3A receptor-labeled neuronal soma in the dorsal horn strongly expressed fractalkine (Fig. 3C). Consistent with previous observations (Imai et al., 1997; Verge et al. 2004), we identified the colocalization of CX3CR1 in microglia in the spinal dorsal horn by double labeling for CX3CR1 and CD11b (Fig. 4A). These data suggest that fractalkine may directly mediate signaling from 5-HT3 receptor-expressing neurons to microglia.
Upregulated CX3CR1 and activated microglia contribute to SR57227-induced hyperalgesia/allodynia and glial hyperactivity
To assess the role of CX3CR1 in downstream events subsequent to 5-HT3 receptor activation, we measured the change of tissue CX3CR1 expression in the spinal dorsal horn after intrathecal injection of SR57227. Western blot analysis showed an upregulation of CX3CR1 level at 1–2 h after application of SR57227 (10 pmol, i.t.) compared with saline (p < 0.05, n = 3 for each group) (Fig. 4B). Furthermore, to identify whether CX3CR1 activation mediates SR57227-induced increase of expression of CD11b protein, we examined the effect of a neutralizing antibody for CX3CR1 on SR57227-induced microglial hyperactivity. This neutralizing antibody (CX3CR1 Ab), intrathecally (20 μg) injected at 1 d before and concurrently with SR57227 (10 pmol), significantly attenuated an enhancement of spinal CD11 expression at 2 h induced by application of SR57227 (Fig. 4C) (p < 0.05, n = 3). Next, we also examined the effect of CX3CR1 Ab on SR57227-induced behavioral hypersensitivity. Consistent with a recent finding that CX3CR1 knock-out (KO) mice showed an attenuation of mechanical and thermal hypersensitivity after nerve injury when compared with CX3CR1 wild-type (WT) mice (Staniland et al., 2010), the pretreatment with CX3CR1 Ab (20 μg, i.t.) significantly attenuated the thermal hypersensitivity at 1, 2, and 4 h (Fig. 4D, left) (p < 0.05, n = 5 for each group) and the mechanical allodynia at 2 h (Fig. 4D, right) (p < 0.001, n = 5 for each groups) after application of SR57227. Injection of the antibody alone did not affect PWLs and EF50 (Fig. 4D). However, this is in contrast to the finding reported by Staniland et al. (2010) that CX3CR1 KO mice displayed only a loss of thermal hypersensitivity in a model of inflammation induced by intraplantar injection of zymosan (Staniland et al., 2010), suggesting that the fractalkine-CX3CR1 signaling cascade can be differentially affected depending on the pathological pain model and the stimulus modality. All of the above findings implicate the fractalkine-CX3CR1 signaling cascade in neuron-microglial interaction during glial hyperactivity and behavioral hypersensitivity after neuronal 5-HT3 receptor activation at the spinal level.
We then tested whether the effect induced by endogenous fractalkine release from 5-HT3 receptor-activated neurons was mimicked by application of exogenous fractalkine. Intrathecal delivery of fractalkine (40 ng/10 μl), but not vehicle, produced a significant mechanical allodynia that developed within 20 min and lasted for up to 3 h (p < 0.05 or 0.01 vs saline + saline, n = 4 per group) (Fig. 5A), and a similar pattern of thermal hyperalgesia that peaked at 40–60 min after injection (data not shown). In addition, both immunostaining and Western blotting analysis showed an enhanced hyperactivity of microglia at 1 h after the delivery of fractalkine, along with increased expression of CD11b (Fig. 5B,C) and another functional marker of microglia, Iba1 (Fig. 5B) in the spinal dorsal horn. Moreover, the hyperalgesic effect of fractalkine or the induced enhancement of CD11b expression in the spinal dorsal horn was significantly attenuated by pretreatment with CX3CR1 Ab at 20–140 min (p < 0.05 vs saline + fractalkine) (Fig. 5A) or 1 h (Fig. 5C) after injection, respectively. Thus, the functional effects of blockade of CX3CR1 activation on fractalkine-induced increase of CD11b and behavioral hypersensitivity further support our hypothesis that endogenous fractalkine released from 5-HT3 receptor-containing neurons or terminals results in microglial activation by acting on its receptor CX3CR1, mainly expressed on microglia in the dorsal horn.
Upregulated IL-18 in microglia and IL-18 receptor in astrocytes mediate microglia-astrocytic interaction during SR57227-induced hyperalgesia and allodynia
Hyperactive microglia are known to synthesize and secrete many glioactive substances such as proinflammatory cytokines involved in microglia-astrocytic interaction, the modulation of neuronal activity, and the enhancement of hypersensitivity to noxious input. Thus, we further identified possible downstream effects of spinal microglial activation after intrathecal administration of SR57227 or fractalkine. Although many chemical mediators, including proinflammatory cytokines, have been found to be involved in microglia-dependent signaling cascades, we speculated that IL-18 may contribute to the downstream effects because of its unique expression in microglia and its receptor that is primarily found in astrocytes in the spinal dorsal horn, as well as its crucial role in glial mechanisms underlying the development and maintenance of mechanical allodynia (Miyoshi et al., 2008). Thus, we determined whether the IL-18/IL-18 receptor signaling pathway in spinal microglia-astrocyte interaction contributed to SR57227- or fractalkine-induced pain hypersensitivity. Western blot analysis demonstrated that selective activation of CX3CR1 by intrathecal fractalkine resulted in a significant increase of IL-18 expression in the spinal dorsal horn (Fig. 5C) when compared with vehicle treatment (p < 0.05, n = 3 for each group), which was also suppressed by pretreatment with CX3CR1 Ab (p < 0.05, vs saline + fractalkine) (Fig. 5C). Consistently, higher intensity of IL-18 immunoreactivity was visualized in the dorsal horn cells at 2 h after intrathecal fractalkine, but not vehicle, compared to that in the naive condition (Fig. 5D). Double immunostaining further confirmed that IL-18 was predominantly expressed in microglia labeled by Iba1 immunoreactivity in the dorsal horn (Fig. 5E), consistent with previous observations (Miyoshi et al., 2008). There was little or no colocalization of IL-18 with GFAP or NeuN (Fig. 5E). Moreover, we evaluated the changes of IL-18 during microglial hyperactivity after intrathecal injection of SR57227. Similar to the effect of fractalkine, activation of spinal 5-HT3 receptors induced a significant increase of IL-18 immunoreactive intensities as shown by immunostaining (Fig. 5D) or IL-18 protein levels measured by Western blots (Fig. 5F) in the dorsal horn. Compared to that in vehicle group, SR57227-enhanced IL-18 expression was significantly prevented by pretreatment with intrathecal CX3CR1 Ab (Fig. 5F) or blocked by Y25130 (p < 0.05, 136.7 ± 3.5% in Y25130 + SR57227 vs 187.2 ± 6.7% in saline + SR57227). Treatment of Y25130 alone did not change baseline expression of IL-18 in spinal dorsal horn (96.7 ± 4.5%, p > 0.05, vs vehicle group) (n = 3 for each group).
In contrast to IL-18 expression in microglia, the IL-18 receptor, IL-18R, was present in GFAP-labeled astrocytes but not in microglia and neurons (Fig. 6A). Thus, spinal IL-18R expression during glial hyperactivity after intrathecal injection of SR57227 or fractalkine was examined. Immunostaining showed an increase of GFAP expression accompanied by enhanced intensity of IL-18R immunoreactivity in the dorsal horn cells after intrathecal injection of fractalkine (40 ng) when compared to that treated by vehicle (Fig. 6C). Pretreatment with CX3CR1 Ab reduced fractalkine-induced increases of spinal GFAP and IL-18R expression (Fig. 6C). Quantification of this effect was obtained with Western blotting for fractalkine-induced upregulation of astrocytic IL-18R in the dorsal horn, which was significantly blocked by pretreatment with CX3CR1 Ab (Fig. 6D). To verify whether a hyperactivity of spinal astrocytes was downstream of spinal microglial activation, we also analyzed the effects of functional blockade of these cytokine receptors primarily expressed on microglia or astrocytes on the enhanced expression of GFAP induced by SR57227 and fractalkine. We found that SR57227-induced elevation of GFAP expression was significantly attenuated after blocking the fractalkine-mediated signal transduction cascade with anti-CX3CR1 antibody (p < 0.05, Fig. 6B). Also, fractalkine-induced GFAP increase was significantly attenuated after functional blockades of either CX3CR1 expression in microglia (Fig. 6D) or IL-18 receptors expressing in astrocytes (Fig. 6E). These data suggest an increase in the functional interaction between microglial and astrocytic hyperactivity via a key signaling pathway, IL-18/IL-18R, during the development of hyperalgesia induced by 5-HT3 receptor activation and exogenous fractalkine.
Upregulated IL-1β in astrocytes mediates SR57227-induced pain behavior through phosphorylation of neuronal GluNRs (NMDARs)
Hyperactivated microglia and astrocytes in the spinal dorsal horn and the brainstem trigeminal transition zone are known to secrete prototypic inflammatory cytokines such as IL-1β and are involved in central sensitization and behavioral pain hypersensitivity (Reeve et al., 2000; Raghavendra et al., 2003; Sung et al., 2005; Guo et al. 2007). To test whether SR57227-induced hyperalgesia and allodynia involve IL-1β, we examined the effect of 5-HT3 receptor activation on spinal IL-1β expression and found that spinal delivery of SR57227 (10 pmol) but not vehicle induced a significant increase in IL-1β expression in dorsal horn cells (Fig. 7A) or in the dorsal horn tissues (Fig. 7B; p < 0.05 at 1 and 4 h, p < 0.01 at 2 h, vs saline groups, n = 3 per group). A similar effect of exogenous fractalkine (40 ng) on spinal IL-1β expression was observed (Fig. 7A). Next, we showed with double labeling that the IL-1β was mainly expressed in hyperactivated astrocytes immunoreactive for GFAP but rarely in microglia immunoreactive for CD11b in the spinal dorsal horn after injection of SR57227 (Fig. 7C). We then examined whether IL-1β contributes to behavioral hypersensitivity induced by SR57227. IL-1ra (100 μg/10 μl), an IL-1 receptor antagonist, was injected intrathecally 1 d before and concurrently with SR57227. The SR57227-induced mechanical allodynia was significantly attenuated by pretreatment with IL-1ra measured at 2 h (Fig. 7D). Thermal hyperalgesia induced by spinal 5-HT3 receptor activation was also reversed by intrathecal IL-1ra for 4 h (data not shown; p < 0.01 at 1 h or p < 0.05 at 2–4 h, n = 5 for each group). To demonstrate a one-way intercellular communication involving upregulation of IL-1β evoked by spinal microglial and astrocytic activation, we blocked the microglial receptor CX3CR1 or astrocytic IL-18 receptors and evaluated their effects on the increased expression of spinal IL-1β after intrathecal SR57227 or fractalkine. Western blotting showed that SR57227-induced enhancement of IL-1β expression in the dorsal horn tissue 2 h after injection, when compared with vehicle treatment, was significantly reduced with pretreatment using the CX3CR1 neutralizing antibody (p < 0.05, n = 3 for each group; Fig. 7E). Meanwhile, fractalkine-induced increase of IL-1β level in the spinal dorsal horn was partially blocked by pretreatment with IL-18R Ab (p < 0.05, n = 3 for each group; Fig. 7F). Thus, these data confirm that the enhanced expression of IL-1β in spinal astrocytes was induced by hyperactivated microglia and activated IL-18 receptors in astrocytes in the dorsal horn.
It has been shown that the glutamate receptor subunit GluN (NMDA) receptors (GluNRs) are widely expressed in rat dorsal horn neurons and are upregulated and phosphorylated in the dorsal horn by locally released proinflammatory cytokines after injury, contributing to pain hypersensitivity (Guo et al., 2002, 2007; Kawasaki et al., 2008; Zhang et al., 2008). As a possible mechanism of glial-neuronal interactions, we examined whether IL-1RI, the receptor for IL-1β, was distributed in dorsal horn neurons containing GluNRs. Double labeling showed that IL1RI colocalized with the GluN1R subunit, a principal component of GluNRs in rat dorsal horn neurons (Fig. 8A). To test whether spinal 5-HT3 receptor activation also induced GluNR activation, the phosphorylation levels of GluN1R (pGluN1R), a functional marker of neuronal excitability in the CNS, were measured in spinal dorsal horn tissues. As shown in Figure 8B, the expression of pGluN1R ser896 in the spinal dorsal horn was robustly increased by threefold at 2 h after intrathecal injection of SR57227 (10 pmol) when compared with the sham group (p < 0.001, n = 3 each group). Moreover, SR57227-induced increase of the pGluN1R expression was significantly attenuated by pretreatment with the neutralizing antibodies for CX3CR1, IL-18R, or IL1RI (p < 0.001; Fig. 8B), Meanwhile, these pretreatments alone had no effect on baseline expression of pGluN1 in the spinal dorsal horn (Fig. 8B). These findings confirm that the increase of pGluN1 observed above was mediated mainly by fractalkine to CX3CR1, IL-18 to IL-18R, and IL-1β to IL1RI signaling pathways, suggesting that spinal 5-HT3 receptor-mediated hyperalgesia and allodynia in rat primarily depend on a neuron-microglia-astrocyte-neuronal signal cascade.
Descending 5-HT and spinal 5-HT3 receptors involved in dorsal horn glial hyperactivity underlying descending pain facilitation and inflammatory pain
Earlier studies indicated that low or high intensity of electrical stimulation (ES) in the RVM produced temporary descending facilitation or inhibition in behavioral nociceptive tests, respectively, and increased spinal 5-HT release in some cases (Yaksh and Wilson, 1979; Hammond and Yaksh, 1984; Hammond et al., 1985; Zhuo and Gebhart, 1991). We questioned whether this focal ES evoked spinal glial hyperactivity by activation of RVM-spinal projection neurons in naive animals. To test this possibility, we performed Western blot to examine CD11b and GFAP expressions in the spinal dorsal horn at 30 min after intra-RVM ES, a time point that has previously been shown to increase trigeminal GFAP following ES of the masseteric nerve (Wang et al., 2010). A low (10 μA for 15 min) intensity of ES in the RVM induced a significant increase in GFAP expression [185.0 ± 9.7%, p < 0.05 vs sham group (103.3 ± 10%)] but not CD11b expression [110.7 ± 12.0%, p > 0.05 vs sham group (89.5 ± 14.4%)] in the spinal dorsal horn (n = 3 for each group). In contrast, a higher (100 μA) intensity of ES in the RVM produced enhancement of spinal CD11b (207.7 ± 19.1%, p < 0.05 vs sham group) but not GFAP expression (110.7 ± 11.6%, p > 0.05 vs sham group) (n = 3 for each group). These data suggest that transient activation of global RVM neurons by ES produces rapid spinal glial hyperactivity, which may reflect the functional impact of glial changes on mechanisms of descending pain modulation during the ES, including pain facilitation in naive animals.
In previous studies, we demonstrated that the BDNF receptor TrkB predominately existed in RVM 5-HT-containing neurons projecting to the spinal dorsal horn (Guo et al., 2006) and that intra-RVM injection of BDNF (100 fmol) produced mild hyperalgesia and allodynia for 1 d, which was dependent on descending 5-HT systems from the RVM (Guo et al., 2006; Wei et al., 2010). In the present study, intrathecal Y25130 significantly attenuated BDNF-induced behavioral hypersensitivity, further suggesting that BDNF may induce descending pain facilitation by evoking descending 5-HT release and the consequent activation of spinal 5-HT3 receptors. To examine the effects of long-lasting active descending pain facilitation on spinal glial changes and mimic glial hyperactivity mediated by the activation of spinal 5-HT3 receptors after intrathecal application of the 5-HT3 receptor agonist, we examined whether endogenous 5-HT released from RVM-spinal projection neurons after BDNF injection produces spinal 5-HT3 receptor-mediated glial hyperactivity. As shown in Figure 9A, intra-RVM BDNF (100 fmol) induced increases of spinal CD11b expression at 6 and 24 h and GFAP expression only at 24 h after microinjection when compared to vehicle treatment (p < 0.05, n = 3 for each group) that were completely eliminated by pretreatment with intrathecal application of Y25130 (30 fmol, n = 3 for each group). Coinciding with the behavioral observation in Figure 1, C and D, these data suggest that spinal 5-HT3 receptor-dependent glial hyperactivity is involved in molecular and cellular mechanisms responsible for intra-RVM BDNF-induced long-lasting descending pain facilitation.
Recently, It has been well recognized that microglial hyperactivity and astrocytic hyperactivity in the dorsal horn play a critical role in the development of inflammatory pain after tissue injury (for review, see Milligan and Watkins, 2009; Gao and Ji, 2010; Ren and Dubner, 2008, 2010). We previously found that the RVM-spinal 5-HT system is also implicated in descending pain facilitation involved in central mechanisms of persistent pain after peripheral inflammation (Wei et al., 2010). To confirm the effect of the descending 5-HT system on glial hyperactivity to peripheral inflammation in rats with persistent pain, we examined changes of spinal glial markers in a model of inflammatory pain induced by intraplantar injection of CFA from 3 d after molecular depletion of the intra-RVM 5-HT system manipulated by local gene transfer of Tph-2 shRNA as shown previously (Wei et al., 2010). In the control shRNA-treated rats, Western blot showed that there were robust increases of CD11b and GFAP expression in the spinal dorsal horn at 1 d after unilateral intraplantar CFA injection, compared with that in the saline group (p < 0.01, n = 3 for each group, Fig. 9B). However, Tph-2 shRNA-treated animals exhibited significant attenuation of CD11b and GFAP expression after CFA injection as compared to rats treated with control shRNA (p < 0.05, n = 3 for each group; Fig. 9B), suggesting that active 5-HT-dependent descending pain facilitation contributes to the maintenance of spinal glial hyperactivity underlying the development of inflammatory pain after injury. Thus, the spinal glial changes appear to be involved in the descending facilitation underlying the maintenance of persistent pain via descending 5-HT release and spinal 5-HT3 receptor activation after injury.
Discussion
Our findings demonstrate that a neuronal-glial-cytokine-neuronal signaling cascade is involved in the mechanisms underlying spinal 5-HT3 receptor-mediated hyperalgesia. The development of persistent pain after inflammation and nerve injury appears to be dependent, in part, upon 5-HT pathways originating from the rostral ventromedial medulla leading to activation of 5-HT3 receptors at the spinal level (Suzuki et al., 2002; Lopez-Garcia, 2006; Rahman et al., 2006; Lagraize et al., 2010; Wei et al., 2010). Consistent with these views and a recent study (Dogrul et al., 2009), our data showed that blockade of spinal 5-HT3 receptor function by intrathecal Y25130, a selective 5-HT3 receptor antagonist, attenuated mechanical and thermal hypersensitivity following L5 SNL in rats. Interestingly, recent studies reported that intrathecal injection of 5-HT3 receptor antagonists such as CGP35348 (Okazaki et al., 2008) or ondansetron (Peters et al., 2010) had no preventive effects on mechanical allodynia and/or thermal hyperalgesia in a rat with L5-L6 SNL, which conflicts with the study with the same drug, ondansetron, in the same SNL model (Dogrul et al., 2009) and with our results. However, we noticed that there were no expected plastic changes of both 5-HT immunoreactive intensity and 5-HT3 receptor innervation in the lumbar spinal dorsal horn at 14 d after L5/L6 SNL in the study reported by Peters et al. (2010). In contrast, we found a robust increase of tissue Tph-2 level in the RVM (Wei et al., 2010) at 14 d and a progressive enhancement of tissue 5-HT3 receptor expression in the spinal dorsal horn from 1 to 28 d following L5 SNL when compared with that in the sham group (our unpublished observations). We suspect that the discrepancies between our positive findings and those reported by Peters et al. (2010) are due to the utilization of different neuropathic pain models and different 5-HT3 receptor antagonists, as well as the absence of the more quantitative measures used for the 5-HT3 receptor expression and of more time points measured after injury in their study. In the present study, our data indicate that the effective dose of intrathecal Y25130 for attenuation of behavioral hypersensitivity following SNL did not alter thermal and mechanical thresholds in the sham animals at 14 d after surgery. Thus, we propose that increased descending 5-HT drive and spinal 5-HT3 receptor expression after tissue and nerve injury contribute to maintenance of central sensitization, including glial hyperactivity and neuronal hyperexcitability at the spinal level underlying the development of persistent pain.
We have determined that a number of chemical mediators contribute to the spinal 5-HT3 receptor-induced novel spinal signaling cascade, including the chemokine fractalkine released from 5-HT3 receptor-containing neurons, cytokine IL-18 released from microglia, IL-1β released mainly from astrocytes, enhanced phosphorylation of spinal NMDA receptors, and ultimately behavioral hyperalgesia. Moreover, the mechanisms by which these events are sequentially activated through multiple signaling cascades to link neuron-microglia-astrocyte-neuronal interactions (Fig. 9C) is unexpected and novel and highlights how cellular circuitry and molecular signaling interact in the spinal dorsal horn response to 5-HT3 receptor activation. The findings indicate that spinal hyperexcitability or central sensitization underlying the development of hyperalgesia not only depends on the initiation of nociceptive input from primary afferents after tissue and nerve injury (Guo et al., 2007; Wang et al., 2010), but also requires the maintenance of descending facilitation from the raphé 5-HT-spinal 5-HT3 receptor systems. Our study supports the growing evidence that spinal 5-HT3 receptors play a crucial role in cellular and molecular mechanisms in the development and maintenance of persistent pain states.
Our results demonstrate that there are at least three active signaling cascades observed, including fractalkine and its receptor CX3CR1 for mediating spinal neuron-to-microglia signaling, IL-18 and its receptor for microglia-to astrocyte signaling, and IL-1β and its receptor for astrocyte-to-neuron signaling, as important components involved in the functional intercellular transduction in the dorsal horn after 5-HT3 receptor activation. These findings do not rule out the role of other chemical mediators released from the same neurons or of different subpopulations of neurons (excitatory or inhibitory neurons) or glial cells in the regulation of spinal nociceptive processes. It has been reported that some central terminals of primary afferents express 5-HT3 receptors (Kia et al., 1995; Conte et al., 2005). Intrathecal injection of 5-HT3 receptor agonists may excite these central terminals to release fractalkine, glutamate, and ATP, directly activate glial cells, and even directly enhance NMDA receptor function in dorsal horn neurons. Although these findings suggest other signaling cascades, the accumulating data in the present study suggest that spinal neuron-glia-neuronal interaction may be particularly important in the 5-HT3 receptor-mediated central sensitization associated with intra-RVM 5-HT-dependent descending pain facilitation. Structural and functional plasticity of 5-HT3 receptors in spinal dorsal horn interneurons could occur after tissue and nerve injury. In fact, we recently found an increase of 5-HT3 receptor protein levels in the dorsal horn from 1 to 28 d after SNL (our unpublished observations). Although we did not verify whether primary afferent terminals contributed to these receptor changes, recent evidence indicates that there are no changes of 5-HT3 receptor mRNA expression in the rat dorsal root ganglia after osteoarthritis (Rahman et al., 2009). Thus, upregulation of 5-HT3 receptor expression in dorsal horn neurons following enhanced descending 5-HT drive after nerve injury may play an important role in glial hyperactivity involved in the maintenance of persistent pain.
Although spinal glial hyperactivity has been reported in acute and persistent pain models (Colburn et al., 1997; Watkins et al., 2001; Scholz and Woolf, 2007; Ren and Dubner, 2008, 2010), few studies have investigated the involvement of spinal 5-HT3 receptors in spinal glial hyperactivity. In the present study, intrathecal injection of the selective activation of spinal 5-HT3 receptors by intrathecal injection of the receptor agonist or enhanced descending pain facilitation by intra-RVM BDNF administration induced significant upregulation of GFAP and CD11b. Molecular depletion of the descending 5-HT system significantly attenuated peripheral inflammation-produced glial hyperactivity in the spinal dorsal horn. These data provide the first evidence that either exogenous or endogenous activation of the 5-HT3 receptor results in spinal glial hyperactivity. Moreover, we were interested in the mechanisms by which quiescent spinal glia alter their function in response to 5-HT3 receptor activation. Recent studies have demonstrated special expression patterns for chemokines, cytokines, and their receptors in spinal cord cells. For example, fractalkine exists in spinal neurons (Imai et al., 1997; Verge et al., 2004), and its receptor CX3CR1 is selectively expressed in microglia (Verge et al., 2004; Lindia et al., 2005). IL-18 and its receptor are present in spinal microglia and astrocytes, respectively (Miyoshi et al., 2008). Consistent with our previous study on the RVM (Guo et al., 2007; Wei et al., 2008), we found that IL-1β is mainly expressed in astrocytes but not in microglia in the spinal dorsal horn. Its receptor IL-1RI is present in dorsal horn neurons expressing GluNRs. These proteins have been demonstrated to play a role in spinal nociceptive modulation and the development of persistent pain after injury (Scholz and Woolf, 2007; Ren and Dubner, 2008, 2010; Milligan and Watkins, 2009). However, previous studies have not shown a relationship between these proteins and 5-HT3 receptor activation in the spinal cord. In addition, extending our recent findings (Guo et al., 2007; Wei et al., 2008, 2010), we showed the colocalization of IL-1RI with the GluNR subunit GluN1R in dorsal horn neurons and with IL-1RI-mediated facilitation of GluN1R phosphorylation after 5-HT3 receptor activation. Thus, the IL-1β-mediated amplified signaling from spinal astrocytes further enhances neuronal excitability through signaling coupling with GluNRs in the spinal cord, which plays an important role in neuronal hypersensitivity. Our findings also suggest that activation of the spinal 5-HT3 receptor is sufficient to induce glial hyperactivity and cytokine release, which are necessary for neuronal and behavioral hypersensitivity after 5-HT3 receptor activation. The activated glia-mediated positive signaling amplification then sensitizes spinal nociceptive neurons, leading to further neuronal activation and behavioral hyperalgesia. These findings offer new insights into the cellular and molecular mechanisms in the spinal level responsible for descending pain facilitation during the development of persistent pain after tissue and nerve injury.
In the present study, we directly activated the spinal 5-HT3 receptor to mimic 5-HT release through descending pain facilitation pathways (Wei et al., 2010). We found that intrathecal injection of 10 pmol of the 5-HT3 receptor agonist SR57227 produced thermal hypersensitivity that lasted for 4 h. This observation provides direct evidence that the spinal 5-HT3 receptor plays a role in pain facilitation. Activation of 5-HT3 receptors in the spinal cord by 5-HT is mediated by the descending excitatory drive from the RVM to the spinal cord (Suzuki et al., 2002; Lagraize et al., 2010). Consistent with studies with another 5-HT3 receptor agonist, 2-Me-5H (Alhaider et al., 1991; Jeong et al., 2004), we found that intrathecal injection of higher doses of SR57227 (10 nmol) induced transient analgesia. The different doses used in our experiments may reflect different mechanisms that depend on specific cellular circuits or the particular proteins involved. It has been shown that 5-HT3 receptors are predominantly localized in terminals of excitatory axons in the rat superficial dorsal horn, and some of these originate from dorsal horn neurons (Kia et al., 1995; Morales et al., 1998; Zeitz et al., 2002; Conte et al., 2005), Although cell bodies expressing these receptors in the dorsal horn are further identified as excitatory neurons (Tecott et al., 1993; Morales et al., 1998), some 5-HT3 receptor-labeled neurons in rat dorsal horn express glutamate decarboxylase (GAD), a marker for GABAergic neurons (Conte et al., 2005). Recent studies have demonstrated in the mouse that some dorsal horn neurons sensitive to 5-HT3 receptor agonists were GAD positive (Fukushima et al., 2009) and that some 5-HT3 receptor mRNA-containing dorsal horn neurons were GAD positive (Huang et al., 2008). Thus, 5-HT3 receptors appear to be expressed in both excitatory and inhibitory intrinsic neurons and terminals in the spinal dorsal horn. Synaptic plasticity of 5-HT3 receptor expression and function in the spinal dorsal horn neurons and the terminals of primary afferent fibers during the development of persistent pain after injury needs to be further investigated.
Footnotes
This work was supported by National Institutes of Health Grants DE18573, NS059028, and NS060735.
- Correspondence should be addressed to Feng Wei at the above address. fwei{at}umaryland.edu