Article Figures & Data
Figures
- Figure 1.
Characterization of the Adora2a-Cre × Z/EG mouse. A, Single EGFP immunostaining of coronal brain section shows the exclusive labeling of the striatum (Str), whereas no labeling is found in the cortex (Ctx). B, Stereotaxic injection in substantia nigra pars reticulata allows the specific retrograde labeling of the full striatum. C–E, MOR immunostaining on Adora2a-Cre × Z/EG retrolabeled striatum shows the labeling of STP (C) and STN (E) neurons in the matrix (MOR−; D) as well as in the striosome (MOR+; D) compartments. F, EGFP immunostaining on Adora2a-Cre × Z/EG retrolabeled striatum shows no colocalization between the EGFP and the retrograde labeling. Arrowheads mark examples of EGFP neurons. Arrows mark examples of retrolabeled neurons. Images were acquired by confocal microscopy. Scale bars: A, 2 mm; B, 100 μm; C–E, 40 μm; F, 20 μm.
- Figure 2.
FACS purification and qRT-PCR validation of new striatopallidal and striatonigral neuron specific genes. A, B, Examples of FACS purification of the EGFP and R+ striatal neurons. To obtain a reliable purification of the EGFP+ and R+ neurons, only the PI− cell population is selected (A). Among those cells, the R+/PI− and the EGFP +/PI− neurons are purified (B). One thousand purified neurons were resorted to demonstrate the enrichment of R+ STN (Ba) and EGFP + STP neurons (Bb). C, qRT-PCR analysis using RNA extracted from GFP+ and retrolabeled + sorted neurons shows the correct segregation of the well characterized markers of the striatopallidal (Adora2a, Drd2, and Penk) and striatonigral neurons (Drd1a and Tac1) (n = 4–5). D, qRT-PCR validation of the microarray data from independent biological replicates (n = 3–4). Values are presented as mean ± SEM (n = 4–5). *p < 0.05; **p < 0.01; ***p < 0.001 by two-tailed Student's t test. FSC, Forward scatter detector; PE, phycoerythrin.
- Figure 3.
NT5e is a striatopallidal neuron-specific marker. A, B, Histochemistry in a mouse model of a striatopallidal neuron-specific ablation (Adora2a-Cre+/− iDTR+/−) (Durieux et al., 2009) shows the absence of NT5e enzymatic activity (B) compared with the control (Adora2a-Cre−/− iDTR+/−) (A). C shows the nonspecific activity in absence of the enzymatic substrate in the control mice (5′AMP). D, The optical density quantification demonstrates an almost complete loss of the NT5e enzymatic activity in the absence of striatopallidal neurons in the striatum, whereas no modification is observed in the cortex. Data are expressed as optical density values (Adora2a-Cre−/− iDTR+/−, n = 8; Adora2a-Cre+/− iDTR+/−, n = 9). E–G, NT5e immunostaining in Drd2-EGFP mice shows a specific labeling of NT5e in the striatum (F) with the same expression pattern as the EGFP (E) as shown in merge image (G). H–J, High magnification in the dorsal striatum shows the expression of the EGFP-expressing striatopallidal neurons (H) and the NT5e (I); the merge image (J) shows the colocalization of the two markers. Arrowheads mark examples of neurons expressing the NT5e and EGFP. K, L, The fluorescent profile analysis of the NT5e and EGFP labelings demonstrates the presence of NT5e labeling at the membrane whereas that of EGFP is cytoplasmic. Intensity plots for the green and the red fluorophores were measured along the white line drawn on the respective merged image. Scale bars: E–G, 100 μm; H–J, 10 μm. Values are presented as mean ± SEM. ***p < 0.001 by two-tailed Student's t test.
- Figure 4.
Motor skill and response learning in NT5e KO mice. A, Large decrease in enzymatic activity revealed by histochemistry in striatum of NT5e KO mice compared with WT mice. B, Superimposed adenosine biosensor traces illustrating the impaired production of adenosine from 10 μm ATP in striatal slices from NT5e KO compared with WT mice. C, Motor skill learning on an accelerating rotarod is impaired in NT5e KO mice. Mice were tested for 5 consecutive days, four trials per day. D, NT5e KO mice did not show any modification in the total horizontal distance traveled in 1 h open field when tested for 3 consecutive days. E, Cataleptic response to haloperidol (1 mg/kg, i.p) is reduced in the NT5e KO mice compared with the WT mice when tested at the different time points (WT, n = 6; NT5e KO, n = 5). Values are presented as the mean ± SEM. *p < 0.05, **p < 0.01, ***p < 0.001.
- Figure 5.
Ecto-5′-nucleotidase expression silencing strategy. A, Schematic representation of pSicoR (used in Figs. 6, 8 and 9). B, Schematic representation of pSico before and after Cre-mediated recombination (used in Figs. 7, 8, 9). C, Sequences of shRNA targeting the mouse NT5e. The position is given relative to the ATG of the NT5e cDNA. D, Quantification of NT5e expression by qPCR in striatal primary cultures after infection with LV-pSicoR-shRNA (n = 3/group).Values are presented as the mean ± SEM. **p < 0.01. CMV, Cytomegalovirus promoter; U6, mouse U6 promoter.
- Figure 6.
The shNT5e reduces NT5e expression but does not modify the integrity of the striatum. A–H, Fluorescent immunostaining shows striatum 1 month after the stereotaxic injection of LV-pSicoR-shscramble (A, B, E, F) or LV-pSicoR-shNT5e (C, D, G, H). EGFP labeling shows transduced neurons after injection of either shscramble (A) or shNT5e (C). Fluorescent immunostaining against NT5e in the striatum shows loss of immunoreactivity in the EGFP-positive area injected with the shNT5e (D) but not in the area injected with the shscramble (B). NeuN immunostaining (neuronal marker) shows an intact labeling in both striata injected with the shscramble (F) or the shNT5e (H), indicating that the NT5e knockdown and the lentiviral injection did not modify the integrity of the target structure. Scale bar, 10 μm.
- Figure 7.
A–H, Injection of LV-pSico-shNT5e in Adora2aCre−/− (A–D), in Adora2aCre+/− (E–H) and AdoraCre+/− × tdTomato floxed +/− mice shows the specific recombination of pSico in striatopallidal neurons. Fluorescent immunostaining against EGFP (A, E) and enkephalin (Enk) (B, F) in the striatum shows a colocalization of Enk and EGFP staining in Adora2aCre−/− (C) but not in Adora2aCre+/− injected striatum. NT5e histochemistry on adjacent slice demonstrates a decrease in NT5e enzymatic activity in Adora2aCre+/− (H) but not in Adora2aCre−/− striatum (D). Imaging of the EGFP immunostaining (I) and the tdTomato native fluorescence (J) demonstrates the absence of colocalization in Adora2aCre+/− striatum (K). Arrowheads mark examples of EGFP+ neurons; arrows mark example of Enk+ or tdTomato+ neurons. Scale bar, 10 μm.
- Figure 8.
Bilateral injection of lentivirus-expressing shNT5e results in an efficient downregulation of NT5e in striatum. A, B, Histochemistry for NT5e shows the anterior to posterior extension of areas with decreased NT5e activity elicited by the shNT5e and the absence of any modification with shscrambles with both pSicoR (A) and pSico (B) lentiviral vectors. Sections are arranged from anterior to posterior levels with coordinates referred to the bregma. C, D, Quantification of the optical density shows a significant decrease of the NT5e activity in three of five levels in the striatum injected with either pSicoR (shscramble = 10–11; shNT5e = 11–12) or pSico (shscramble n = 5; shNT5e n = 7). Data are expressed as a percentage of optical density values in pSicoR or pSico-shscramble controls. Values are presented as the mean ± SEM. *p < 0.05, **p < 0.01, ***p < 0.001 by two-tailed Student's t test.
- Figure 9.
Motor skills in striatal and striatopallidal neuron NT5e knockdown. A–C, Analysis of the spontaneous locomotor activity in 1 h open field does not reveal any difference in the total horizontal distance run in the two groups injected with the shNT5e or shscramble lentivirus when tested for 3 consecutive days. B, D, Motor skill learning on an accelerating rotarod paradigm is impaired in mice with a striatal NT5e knockdown (LV-pSicoR-shNT5e) (B, n = 11–12 per group) as well as in mice with a striatopallidal neuron NT5e knockdown (LV-pSico-sh1557 injected in Adora2a-Cre+/− mice) (D, n = 5–6 per group). Mice were tested for 5 d, four trials per day. Values are presented as the mean ± SEM. *p < 0.05, **p < 0.01 by two-way ANOVA followed by a Bonferroni post hoc test.
Tables
Gene GenBank accession number Fold change (Log2) STP or STN marker References Drd2 NM_010077.2 6.2 STP Gerfen et al., 1990; Lobo et al., 2006; Heiman et al., 2008 GPR6 AI852874 4.9 STP Lobo et al., 2007; Heiman et al., 2008 Adora2a U05672 4.4 STP Schiffmann et al., 1993; Lobo et al., 2006; Heiman et al., 2008 Upb1 NM_133995 3.9 STP Lobo et al., 2006; Heiman et al., 2008 Plxdc1 NM_028199 3.4 STP Lobo et al., 2006; Heiman et al., 2008 Adk NM_134079 1.9 STP Lobo et al., 2006; Heiman et al., 2008 Penk1 NM_001002927 1.4 STP Schiffmann et al., 1993; Lobo et al., 2006; Heiman et al., 2008 Drd1a BB282271 4.7 STN Gerfen et al., 1990; Lobo et al., 2006; Heiman et al., 2008 Slc35d3 NM_029529 4.4 STN Lobo et al., 2006; Heiman et al., 2008 pDyn AF026537.1 3.9 STN Gerfen et al., 1990; Lobo et al., 2006; Heiman et al., 2008 Ebf1 NM_007897.1 2.4 STN Lobo et al., 2006; Heiman et al., 2008 Nrxn1 NM_020252 1.6 STN Lobo et al., 2006; Heiman et al., 2008 Gnb4 NM_013531 1.6 STN Lobo et al., 2006; Heiman et al., 2008 Gene Forward Reverse Adora2a 5′ TCGCCTGCTTTGTCCTGG 3′ 5′ CCATTGTACCGGAGTGGAATTC 3′ Drd2 5′ CCATCAGCATCGACAGGTACAC 3′ 5′ CAGTAACTCGGCGGCTTGGAG 3′ Drd1a 5′ GGCTGGTAACACTTCTACCATGGA 3′ 5′ GGATAGGATAAGCAGGGACAGA 3′ Penk 5′ GGCTACAGTGCAGGCGGAA 3′ 5′ AGTGTGCACGCCAGGAAATT 3′ Tac1 5′ TGACCAGATCAAGGAGGCAATG 3′ 5′ TTAATCCAAAGAACTGCTGAGGCT 3′ RER-1 5′ CCACCTAAACCTTTTCATTGCG 3′ 5′ TTTGTAGCTGCGTGCCAAAAT 3′ RPL13 5′ CCCGTGGCGATTGTGAA 3′ 5′ TCATTGTCCTTCTGTGCAGGTT 3′ NT5e 5′ TTACTAAAGCATGACTCTGGTGATCAA 3′ 5′ AACGGCTGGGTAAACTACTTTCATT 3′ GuCy1a3 5′ TCAACGCTCTCTACACTCGCTT 3′ 5′ CCTGCCACACAATATGCATCC 3′ Rgs5 5′ TTGGCCCAGAAAAGGATCTATG 3′ 5′ AGGGCAACTTTTGGAAGCCT 3′ Igfbp7 5′ TCACTGGTGCCAAGGTGTTC 3′ 5′ CCAGAGTGATCCCTTTTTACCTTGT 3′ Ntsr1 5′ CACCCACAACAGTTTAGAGCACAG 3′ 5′ GGCGATTACCACAGCACGTA 3′ GPR65 5′ GCCAGCCTCCTCAGTCAAGA 3′ 5′ GGTGCAAATGGGAATGCTCT 3′ Gene GenBank accession number Fold change (Log2) Striatopallidal neuron-enriched genes Drd2 Dopamine receptor 2 NM_010077.2 6.2 Cp Ceruloplasmin BB332449 5.9 Atp13a5 ATPase type 13A5 BB427761 5.3 Hspb1 Heat shock protein 1 U03561.1 5.0 GPR6 G-protein-coupled receptor 6 AI852874 4.9 Fzd6 Frizzled homolog 6 (Drosophila) BC026150.1 4.7 Foxd1 Forkhead box D1 NM_008242.1 4.7 Rgs5 Regulator of G-protein signaling 5 AK004165.1 4.7 Adora2a Adenosine A2a receptor U05672 4.4 Nt5e 5′ nucleotidase, ecto AV273591 3.8 Striatonigral neuron-enriched genes Slc15a3 Solute carrier family 15, member 3 NM_023044.1 5.7 Gpr65 G-protein-coupled receptor 65 BB336165 5.2 Csf1r Colony-stimulating factor 1 receptor NM_022007.1 4.8 Drd1a Dopamine receptor D1A NM_009717.1 4.7 Slc35d3 Solute carrier family 35, member D3 NM_018766.1 4.5 Pycard PYD and CARD domain containing AF026537.1 4.3 Isl1 ISL1 transcription factor, LIM/homeodomain BB322201 4.3 Arx Aristaless-related homeobox gene BQ176915 4.1 Pdyn Prodynorphin NM_023258.1 3.9 Ntsr1 Neurotensin receptor 1 AK018094.1 3.0 Results are expressed as the average of the two independent experiments.
