Article Figures & Data
Figures
- Figure 1.
Ndr2 is required for neurite growth in mouse hippocampal neurons. Cells were transfected with tdTomato and shLuc as control shRNA (control; A), with tdTomato and shRNA directed against Ndr2 (shNdr2; B), or with tdTomato, shRNA directed against Ndr2 (shNdr2; C) together with an shNdr2-insensitive form of EGFP-Ndr2. Neurons (DIV 7) with Ndr2 knock-down show a drastic reduction of both the dendritic tree and the axon. This reduction was detained by a coexpression of EGFP-labeled Ndr2. Scale bars, 100 μm. Quantitative analysis of dendrites (D,G) and axons (E,H) using the Sholl analysis (n = 12 cells each; N = 3) confirms their profoundly reduced density upon Ndr2 knock-down and the recovery by the shNdr2-insensitive EGFP-Ndr2. Data are presented as mean ± SEM. *p < 0.05; ***p < 0.001 (Fischer's PLSD). F, Efficiency of the shNdr2 is revealed by the suppression of cotransfected GFP-Ndr2 in HEK-293T. Further transfection with the shNdr2/EGFP-Ndr2* reconstitution construct prove the shNdr2 insensitivity of EGFP-Ndr2*. Double transfection with the control shRNA shLuc (control) does not alter GFP-Ndr2 levels. I, Ndr2, but not Ndr1, is prominently expressed in mouse frontal cortex (FC) and hippocampus (Hip) during development. In contrast, both kinases are found in rat tissue at P0, P10, and P20.
- Figure 2.
Ndr2-mediated dendritic and axonal growth effects are integrin dependent. A–D, Primary hippocampal neurons were transfected with EGFP (control; A,C) or with both EGFP and mCherry-tagged Ndr2 (Ndr2; B,D). A, B, Overexpression of Ndr2 leads to an increased growth of both dendrites and axons compared with control cells (DIV 7). C, D, Under treatment with echistatin, no difference can be observed between Ndr2-transfected primary neurons and controls. Scale bars, 100 μm. E, F, Quantitative analysis (n = 20 cells each; N = 3) of dendritic and axonal arbors confirms the significant increase upon Ndr2 overexpression. G, H, Under echistatin treatment, no enhancement of growth and branching is evident in the Ndr2-overexpressing cells. In fact, axons show a slight reduction of arborization. I, J, Cross-comparison of the total number of intersections with untreated neurons demonstrates that echistatin normalizes the number of dendritic and axonal branches in Ndr2-overexpressing cells to control level, whereas EGFP-transfected control cells are not affected by the disintegrin. Data are presented as mean ± SEM. ***p < 0.001 (Fischer's PLSD).
- Figure 3.
Reduced β1-integrin expression leads to a reduced dendritic and axonal growth in mouse hippocampal neurons. Cells were transfected with tdTomato and shLuc as control shRNA (control; A), or with tdTomato and shRNA directed against β1-integrin (shITGB1; B). Knock-down of β1-integrin at DIV 7 exhibits a drastically reduced growth and branching of either dendrites (C,E) or axons (D,F) using the Sholl analysis (n = 12 cells each; N = 3). Data are presented as mean ± SEM. ***p < 0.001 (Fischer's PLSD). Scale bars, 100 μm. (G) Efficiency of shITGB1 was proven in the murine cell line NIH3T3.
- Figure 4.
Ndr2 stimulates phosphorylation of β1-integrin. A, β1-integrin phosphorylation at Thr788/789 is increased in HEK-293T cells upon overexpression of LAT-Ndr2. The increase is prevented through application of the CaMKII inhibitor Ant-AIP-II or the PKC inhibitor Ro-317549. B, Quantification of Western blot signals confirms a significant increase of β1-integrin Thr788/789 phosphorylation upon LAT-Ndr2 expression and its blockage by Ant-AIP-II and Ro-317549, respectively (N = 3). Data are presented as mean ± SEM. **p < 0.01 compared with control transfection (pEFBOS). C, In an in vitro kinase assay, however, constitutively active LAT-Ndr2 fails to phosphorylate the intracellular domain of β1-integrin. Autophosphorylation of LAT-Ndr2 and transphosphorylation of MBP confirm the activity of the kinase. D, Scheme of membrane-anchored, constitutively active LAT-Ndr2 and activity of precipitated Flag-Ndr2 (FNdr2) or LAT-Ndr2 in an in vitro kinase assay. Autophosphorylation of FNdr2 can be induced with ocadaic acid (OA) treatment of transfected cells, whereas LAT-Ndr2 is constitutively autophosphorylated. Myelin basic protein (MBP) serves as a positive control. E, Western blot analysis of lipid rafts (3–5) and nonrafts (8–10) membrane fractions reveals a localization of both ocadaic-acid-stimulated FNdr2 and LAT-Ndr2 in lipid rafts of transfected HEK-293T cells. Caveolin1 serves as a marker for the lipid rafts fractions. F, LAT-Mst1 overexpression in HEK293 cells results in increased phosphorylation of Mst1 at Thr183 compared with control conditions (pEFBOS transfected). However, constitutively active LAT-Mst1, in contrast to LAT-Ndr2, fails to increase β1-integrin phosphorylation at Thr788/789 of β1-integrin.
- Figure 5.
Ndr2 stimulates β1-integrin exocytosis. Flow cytometric analysis of β1-integrin (CD29) surface expression was performed in HEK-293T cells. A, B, Expression of constitutively active LAT-Ndr2 (A) and Ndr2 knock-down with shNdr2 (B) do not affect total β1-integrin expression or surface expression in unstimulated cells (top). Moreover, no effect is observed on the stimulated endocytosis of β1-integrin (“internalized CD29,” middle). However, LAT-Ndr2 increases and shNdr2 reduces recycling of β1-integrin 15 to 45 min after induction of exocytosis “surface expression of recycled CD29,” bottom). A and B each show one representative experiment of three.
- Figure 6.
Ndr2 associates with β1-integrin-positive early and recycling endosomes. Colocalization of endogenous Ndr2 (green) and β1-integrin (red) can be observed with the early endosome marker Rab5 (A–H) and with Rab11 (I–P) (both blue), a marker for recycling endosomes in somata, dendrites, and axons. Arrowheads depict sites of costaining in proximal dendrites. Scale bars: A–D, I–L, 25 μm; E–H and M–P, 5 μm. Q, Western blot analysis of a subcellular fractionation of neural differentiated PC12 cells indicates that Ndr2 is selectively detected only in Rab5- and Rab11-positive endosome fractions.
- Figure 7.
Ndr2 deficiency in hippocampal neurons leads to a reduced surface expression of activated β1-integrin. Map2 and activated β1-integrin were immune labeled in wild-type (A,B) and Ndr2−/− (C,D) hippocampal neurons at DIV 3. Scale bars, 100 μm. E, The number of dendrites was not significantly affected by Ndr2 deficiency, but tend to be reduced. F, Ndr2 knock-down impairs integrin activation in dendrites, as indicated by lower level of 9EG7 labeled β1-integrin. n = 19–22, N = 3, ***p < 0.001. G, Ndr2 gene ablation was achieved with a gene trap insertion of vector pGT0lxf between exons 9 and 10 of the Ndr2 gene (KOMP). Almost the entire cassette (bp 212- 8379), including a slice acceptor (SA), full β-galactosidase (β-geo) coding sequence, and polyadenylation site, has been inserted. Arrows indicate the location of primers geof/r for confirmation of the ES cells, seqf/r for sequencing of critical sites, and wt/kof, wtr,kor for genotyping. H, Multiplex PCR detects specific signals for homozygous and heterozygous mutant mice, with the ko allele at 638 bp and the wt allele at 1098 bp fragment size. I, Western blot analysis with our c-terminal binding antibody for Ndr2 (abNdr2) confirms the loss of full-length Ndr2 protein from the hippocampus of Ndr2−/− mice and a reduced expression in Ndr2±mice. Beta-actin is used as a loading control. J, Ndr21-282:: β-geo fusion protein was detected in Ndr2−/− and Ndr2±mice with a 33 kDa molecular weight increase to β-galactosidase alone (control). K, Staining of tissue sections with X-Gal substrate detects prominent expression of the inserted cassette in the hippocampus, particularly in area CA3, reflecting the high expression levels of Ndr2 mRNA in this region (Stork et al., 2004). Scale bar, 1 mm. L, Scheme of Ndr21-282:: β-geo fusion protein indicating the lack of most parts of the activating sequence, the kinase subdomains VIII-XII including the substrate recognition site, the c-terminal hydrophobic motif of the Ndr2 gene, as well as the Ndr2 antibody (abNdr2)-binding site (Stegert et al., 2004).
- Figure 8.
Adult Ndr2−/− mice show premature dendritic branching. Morphology of CA3 pyramidal cells was investigated in Golgi-stained tissue of Ndr2−/− mice and their wild-type littermates. A, B, No major change in hippocampus structure and lamination is observed in Ndr2-deficient mice (A) compared with their wild-type littermates (B). Scale bar, 500 μm. C, D, However, Golgi staining of control animals (C) and Ndr2−/− mice (D) demonstrates a shortening in the initial segment and a premature branching (arrow) in hippocampal CA3 pyramidal neurons lacking the expression of full-length Ndr2. E, Sholl analysis of traced CA3 pyramidal neurons reveals that proximal apical dendrites in adult Ndr2−/− mice (n = 14 cells each, N = 4–5 mice per group) branch earlier and thus have more dendritic branches. Due to this early branching, there is a shift in the length of more distal dendrites and reduction of arborization in Ndr2−/− pyramidal neurons. Whether further distal parts of the dendritic arbor are equally affected (Warren et al., 2012) remains to be determined. There is no difference in the basal dendrite complexity. F, The length of the initial segment of CA3 pyramidal neurons is shorter in the Ndr2−/− mice compared with their wild-type littermates (n = 22–27 cells each, N = 6–7 mice per group). *p < 0.05. G, Sholl analysis of traced CA3 pyramidal neurons at P21 indicates no difference in the apical dendrite complexity but does show overbranching in basal dendrites in the Ndr2−/− mice (n = 7–8 cells each, N = 4–7 mice per group). H, At P21, the length of the primary segment of apical dendrites does not differ between Ndr2+/+ and Ndr2−/− mice (n = 12–18 cells each, N = 5–6 mice per group). I, Mean total dendrite length of basal dendrites shows difference at P21 as the length of dendrites is increased in Ndr2−/− mice. J, K, Mean total length of the proximal apical dendrites is increased in adult Ndr2−/− mice (J) and in more distal parts of apical dendrites (K) there is a reduction compared with their wild-type littermates. Scale bars, 11 μm. Data are presented as mean ± SEM. *p < 0.05.
- Figure 9.
Sema3A partially recovers dendritic growth after Ndr2 knock-down. A, B, Ndr2 knock-down-induced reduction of dendritic growth is evident in the absence of Sema3A treatment. C, D, Dendritic growth is stimulated in both controls and in shNdr2-treated neurons by Sema3A. However, a reduced level of differentiation is still evident in shNdr2 cells compared with the Sema3A-treated controls. E, F, Comparison of the number of dendritic intersections with the Sholl analysis confirms that application of Sema3A partially rescues dendritic growth in Ndr2 knock-down neurons (n = 20 cells each, N = 3). G, The total number of dendritic intersections is increased in shNdr2 cells, but does not reach levels of Sema3A-stimulated growth in control cells. Data are presented as mean ± SEM. *p < 0.05, **p < 0.01 compared with untreated controls (Fischer's PLSD).
Tables
Name Position Sequence wt/kof intron9596–615 5′-GGGCTCXXGGCCXGATCTCCCCG-3′ wtr intron91694–1670 5′-TTAAAACGGGGTCTCAAAACTCG-3′ kor pGT0lxF451–431 5′-ATCCCGGCGCTCTTACCAA-3′ seqf pGT0lxF4839–4857 5′-GGGCGCCCGGTTCTTTTTG-3′ seqr pGT0lxF1883–1860 5′-GGGCTCXXGGCCXGATCTCCCCGG-3′ geof pGT0lxF2446–2470 5′-TTATCGATGAGCGTGGTGGTTATGC-3′ geor pGT0lxF3126–3100 5′-GCGCGTACATCGGGCAAATAATATC-3′ geo1f pGT0lxF3685–3703 5′-CCGGGCAACTCTGGCTCAC-3′ geo1r pGT0lxF4342–4320 5′-AGGCGGTCGGGATAGTTTTCTTG-3′ geo2f pGT0lxF4746–4764 5′-CCGGCCGCTTGGGTGGAGA-3′ geo2r pGT0lxF5104–5081 5′-CAGGTAGCCGGATCAAGCGTATGC-3′ geo3f pGT0lxF4839–4859 5′-GGGCGCCCGGTTCTTTTTGTC-3′ geo3r pGT0lxF5547–5526 5′-GGCGTCGCTTGGTCGGTCATTT-3′ geo4f pGT0lxF5311–5331 5′-ATGGCCGCTTTTCTGGATTCA-3′ geo4r pGT0lxF6232–6213 5′-GCGCGTTGGCCGATTCATTA-3′ geo5f pGT0lxF6500–6521 5′-GTGGCGAAACCCGACAGGACTA-3′ geo5r pGT0lxF6911–6888 5′-CAGCAGAGCGCAGATACCAAATAC-3′ geo6f pGT0lxF7316–7338 5′-TGGCCCCAGTGCTGCAATGATAC-3′ geo6r pGT0lxF7675–7653 5′-AACACTGCGGCCAACTTACTTCT-3′ geo7f pGT0lxF7829–7852 5′-TACCGCGCCACATAGCAGAACTTT-3′ geo7r pGT0lxF8397–8379 5′-CCCGACACCCGCCAACACC-3′ 5′RACE tag GATAGATGCAATTCACCAGCTGGGCTTCATCCACCGGGACGTCAAACCAGACAACCTTTTACTGGATGCCAAGGGACATGTAAAATTATCTGATTTTGGTTTGT1GCACGGGGTTAAAGAAAGCTCACAGGACTGAATTCTACAGAAACCTCACAC1ATAACCCGCCAAGCGACTTCTCATTTCAGAACATGAATTCAAAGCGGAAAGC1AGATACATGGAAGATGAACAGGAGACAGCT
