Abstract
Spiral ganglion neurons (SGNs) of the eighth nerve serve as the bridge between hair cells and the cochlear nucleus. Hair cells use Cav1.3 as the primary channel for Ca2+ inflow to mediate transmitter release. In contrast, SGNs are equipped with multiple Ca2+ channels to mediate Ca2+-dependent functions. We examined directly the role of Cav1.3 channels in SGNs using Cav1.3-deficient mice (Cav1.3−/−). We revealed a surprising finding that SGNs functionally express the cardiac-specific Cav1.2, as well as neuronal Cav1.3 channels. We show that evoked action potentials recorded from SGNs show a significant decrease in the frequency of firing in Cav1.3−/− mice compared with wild-type (Cav1.3+/+) littermates. Although Cav1.3 is the designated L-type channel in neurons, whole-cell currents recorded in isolated SGNs from Cav1.3−/− mice showed a surprising remnant current with sensitivity toward the dihydropyridine (DHP) agonist and antagonist, and a depolarization shift in the voltage-dependent activation compared with that in the Cav1.3+/+ mice. Indeed, direct measurement of the elementary properties of Ca2+ channels, in Cav1.3+/+ neurons, confirmed the existence of two DHP-sensitive single-channel currents, with distinct open probabilities and conductances. We demonstrate that the DHP-sensitive current in Cav1.3−/− mice is derived from Cav1.2 channel activity, providing for the first time, to our knowledge, functional data for the expression of Cav1.2 currents in neurons. Finally, using shRNA gene knockdown methodology, and histological analyses of SGNs from Cav1.2+/− and Cav1.3+/− mice, we were able to establish the differential roles of Cav1.2 and Cav1.3 in SGNs.
Introduction
One of the captivating aspects of Ca2+ regulation and function in neurons is the ability to partition Ca2+-mediated proceedings for distinct Ca2+ channels and domains. Ca2+ inflow through diverse subtypes of Ca2+ channels (Cav), e.g., Cav2.1 (P/Q-type) at neuromuscular junctions and most synapses in the CNS (Wheeler et al., 1994; Dunlap et al., 1995) and Cav2.2 (N-type) in the autonomic nervous system and some neurons in the CNS (Olivera et al., 1994; Poncer et al., 1997), trigger neurotransmitter release to induce short-term synaptic plasticity (Borst and Sakmann, 1998; Xu and Wu, 2005; Mochida et al., 2008). Upon exit from the intracellular orifice of Cav2.1 and 1.2 (cardiac isoform of L-type) channels, Ca2+ ions bind to calmodulin, which is constitutively bound to the channel, and are partitioned into local domains, thus allowing swift Ca2+ signaling, and global domains to promote the integration of Ca2+ signaling at the whole-cell level (Imredy and Yue, 1992, 1994; Chaudhuri et al., 2005; Tadross et al., 2008). Even more fascinating is the revelation that a fragment of the C termini of Cav1.2 serves as a transcription factor (Gomez-Ospina et al., 2006), promoting neuronal survival and dendritic arborization to mediate long-term plasticity (West et al., 2001). It is unclear whether the presumed Cav1.2 in neurons is conductive. Since Cav1.2 and 1.3 (neuronal L-type channel) have similar pharmacology (Bean, 1984; Bell et al., 2001), it is difficult to distinguish the functionality of the two isoforms, although differences in their voltage-dependent activation and functions have been noted (Xu and Lipscombe, 2001; Zhang et al., 2002).
Similarly, inflowing Ca2+ ions through multiple Cav channels in auditory neurons represent the prevailing trigger of neurotransmitter release at the cochlear nucleus and spiral ganglion neuron (SGN) firing phenotypes (Chen et al., 2011; Lv et al., 2012), thereby orchestrating peripheral auditory information coding (Trussell, 1997; Cao and Oertel, 2010; Howard and Rubel, 2010; Rutherford et al., 2012). For long-term structural changes and growth, Ca2+ influx through L-type channels promotes SGN survival in vitro (Hegarty et al., 1997). Of significant application and pragmatic ramifications, in vivo, is the finding that direct electrical stimulation of SGNs increases SGN survival (Mitchell et al., 1997; Leake et al., 1999). Conversely, excessive Ca2+ inhibits neural outgrowth (Roehm et al., 2008), raising the possibility that a window of intracellular Ca2+ activity is required for long-term plasticity in auditory neurons. The Cav mediating SGN growth and survival and the mechanisms remain unspecified.
Here, we construed that a direct strategy to disentangle the roles of L-type channels in SGNs is to examine their functional properties from Cav1.3-null mutant (Cav1.3−/−) mice (Platzer et al., 2000; Dou et al., 2004). We show that Cav1.3−/− SGNs remain sensitive to dihydropyridine (DHP) compounds. Moreover, the residual DHP-sensitive current had ∼10 mV depolarized shift in voltage-dependent activation properties. Direct measurement of channel activity showed two independent DHP-sensitive unitary conductances and distinct open probabilities. We have proceeded further in determining the differential roles of the DHP-sensitive currents in SGNs.
Materials and Methods
The animal protocol for this study was approved by the Institutional Animal Care and Use Committee of the University of California, Davis. We used 1- to 4-month-old Cav1.2+/−, Cav1.3−/−, Cav1.3+/−, and their wild-type (WT) C57BL/6J littermate control mice. We used only Cav1.2+/− and their WT littermates because the Cav1.2−/− mice are not viable.
Isolation of SGNs.
SGNs were isolated from male and female mouse inner ears as described previously (Lv et al., 2010, 2012). Briefly, mice were killed and the temporal bones were removed in a solution containing Minimum Essential Medium with Hank's salt (Invitrogen), 0.2 g/L kynurenic acid, 10 mm MgCl2, 2% FBS (v/v), and 6 g/L glucose. The SGN tissue was dissected and split into three equal segments: apical, middle, and basal across the modiolar axis. We used the apical and basal thirds to ensure an adequate, viable neuronal yield for the experiments (Lv et al., 2010). Additionally, we pooled tissue from three mice into each SGN culture. The apical and basal tissues were digested separately in an enzyme mixture containing collagenase type I (1 mg/ml) and DNase (1 mg/ml) at 37°C for 20 min. After a series of gentle triturations and centrifugation in 0.45 m sucrose, the cell pellets were reconstituted in 900 ml of culture media [Neurobasal-A, supplemented with 2% B27 (v/v), 0.5 mm l-glutamine, 100 U/ml penicillin; Invitrogen] and filtered through a 40 μm cell strainer for cell culture. We cultured SGNs for ∼24–48 h to allow detachment of Schwann cells from neuronal membrane surfaces. We used strict electrophysiological criteria, described previously (Lv et al., 2010), to govern the quality of acceptable data. All electrophysiological experiments were performed at room temperature (21−22°C). Reagents were obtained from Sigma-Aldrich, unless otherwise specified.
Current- and voltage-clamp experiments.
Current-clamp configuration was used to record action potentials (APs). Extracellular solution for most experiments contained the following (in mm): 145 NaCl, 6 KCl, 1 MgCl2, 0–2 CaCl2, 10 d-glucose, and 10 HEPES, at pH 7.3. For perforated patch experiments, the tips of the pipettes were filled with the internal solution containing the following (in mm): 150 KCl, 10 HEPES, and 10 d-glucose, at pH 7.3. The pipettes were front filled with the internal solution and back filled with similar solution containing 250 μg/ml amphotericin and 2 mm Ca2+. Thus, a switch from perforated patch to whole-cell mode results in rapid cell death.
Whole-cell and cell-attached, single-channel voltage-clamp recordings of Ca2+/Ba2+ currents were performed using an Axopatch 200B amplifier (Molecular Devices). Current traces were amplified, filtered (bandpass 2–10 kHz), and digitized at 5–500 kHz using an analog-to-digital convertor, Digidata 1200 (Molecular Devices) as described earlier (Levic et al., 2007; Rodriguez-Contreras et al., 2008). Electrodes (2–3 MΩ) were pulled from borosilicate glass and the tips were fire polished. The electrodes contained the following (in mm): 70 CsCl, 70 N-methyl-d-glucamine (NMDG), 1 MgCl2, 10 HEPES, 2–5 EGTA, 1 CaCl2, and 4 Cs2ATP, at pH 7.2 with CsOH. The bath solution was constantly perfused (∼2–3 ml/min) and contained the following (in mm): 120 Choline chloride, 20 TEACl, 5 4-AP, 0.02 linopirdine, 2 CsCl, 1.8–5 CaCl2, 0.5 MgCl2, 10 HEPES, and 5 d-glucose, at pH 7.4 with NaOH. In all cases, the Ca2+ concentration was adjusted with Mg2+. Inward Ca2+ current traces were generated with depolarizing voltage steps from a holding potential of −100 to −40 mV and stepped to varying positive potentials (ΔV = 5–10 mV). The capacitative transients were used to estimate the capacitance of the cell, as an indirect measure of cell size. The seal resistance was typically 10–15 GΩ. Currents were measured with capacitance and series resistance compensation (>90%), filtered at 2 kHz using an 8-pole Bessel filter, and sampled at 5 kHz. Given that the maximum current recorded was < 1 nA, the expected voltage error was < 1.5 mV. The series resistance was monitored during the course of the experiments. The liquid junction potentials were measured (<3 mV) and corrected.
Whole-cell Ca2+ current amplitudes at varying test potentials were measured at the peak and steady-state levels using a peak and steady-state detection routine; the current magnitude was divided by the cell capacitance (pF) to generate the current density–voltage relationship. The stock solutions of all channel blockers and agonists were made either in ddH2O or DMSO and stored at −20°C. The final concentration of DMSO in the recording bath solution was ∼0.0001%. This concentration of DMSO had no effect on APs and did not alter Ca2+ current recordings (data not shown).
The standard configurations for cell-attached, single-channel recordings of the patch-clamp techniques (Hamill et al., 1981) were used to record single Ca2+ channel currents. Patch electrodes were pulled from borosilicate glass capillaries with a Flaming/Brown micropipette puller (P-97; Sutter Instruments), and coated with Sylgard 184 (Dow Corning) to within 100 μm from the tip and fire polished before use. Single-channel recordings of membrane patches were held at −70/−50 mV, and stepped to different depolarizing test pulses at frequencies between 0.2 and 0.5 Hz. Current traces were amplified and filtered using an 8-pole Bessel filter at 2 kHz, and digitized at 10 kHz using custom-written software. Patch electrodes were filled with a Ba2+ solution (50 mm) containing the following (in mm): 20 NMDG, 20 TEACl, 5 4-AP, and 5 HEPES, at pH 7.4 (adjusted with TEAOH). The osmolarity of the patch-electrode solution was ∼290 mOsmol. Stock solutions of Bay K 8644 and nimodipine (100 mm) were made in DMSO, and a final concentration of 5 μm was used. The bath solution contained the following (in mm): 80 KCl, 3 d-glucose, 20 TEACl, 0.5 CaCl2, 5 4-AP, and 5 HEPES, at pH 7.4 with TEAOH, to shift the resting potential to ∼0 mV (Rodriguez-Contreras et al., 2002; Rodríguez-Contreras and Yamoah, 2003). The Ca2+ channel blockers nimodipine (L-type), ω-conotoxin GVIA (CTX; N-type), ω-agatoxin IVA (ATX; P/Q-type), ω-theraphotoxin-Hg1a, ω-TRTX-Hg1a (rSNX-482; R-type; Alomone Labs), and mibefradil (T-type) were bath applied for whole-cell and single-channel recordings. In all cases, liquid junction potentials were measured and corrected as described previously (Rodriguez-Contreras and Yamoah, 2001).
For single-channel recordings, leakage and capacitative transient currents were subtracted by fitting a smooth template to null traces. Leak-subtracted current recordings were idealized using a half-height criterion. Transitions between closed and open levels were determined by using a threshold detection algorithm, which required that two data points exist above the half-mean amplitude of the single-unit opening. The computer-detected openings were confirmed by visual inspection, and sweeps with excessive noise were discarded. Amplitude histograms at a given test potential were generated, and then fitted to a single Gaussian distribution using a Levenberg–Marquardt algorithm to obtain the mean and SD. At least four voltage steps and their corresponding single-channel currents were used to determine the unitary conductance. Single-channel current–voltage relations were fitted by linear least-square regression lines and single-channel conductances obtained from the slope of the regression lines. Curve fits and data analyses were performed using Origin software (MicroCal). Where appropriate, we present data in the form of mean ± SD. Significant differences between groups were tested using paired/unpaired Student's t test with a significance of p < 0.05.
Immunocytochemistry.
SGNs were isolated from the mouse inner ear and cultured for 48 h as described previously (Wei et al., 2007; Lv et al., 2010). Neurons were fixed for 30 min with 2% paraformaldehyde in PBS, washed, and then permeabilized in 0.5% Triton X-100 in PBS for 5 min. The samples were incubated for 1 h in a blocking solution containing PBS, 1% horse serum in PBS, followed by 3–5 h incubation with Ca2+ channel antibodies against Cav1.2, residues 865–881, and Cav1.3, residues 859–875 (Alomone Labs; Abcam), at 1:100 to 1:500 dilutions. To identify neurons, samples were counterstained with an antibody against the neuronal marker TUJ1 as described previously (Wei et al., 2008). Cells were then incubated with appropriate secondary antibodies for 2 h, washed, mounted using antifade mounting medium, and viewed with a Zeiss LSM 510 confocal microscope.
For immunohistochemistry of cochlear tissues, sedated (Avertin; 2,2,2-tribromoethanol); 300 μg/gm body weight, i.p.) mice were transcardially perfused with 10 ml of PBS, followed by 10 ml of 4% paraformaldehyde in PBS. The temporal bones were removed, and the cochlea was perfused via the oval and round windows. The temporal bones were then immersed in fixative for 60 min. After fixation, the cochleae were decalcified (120 mm EDTA, pH 7.0; 24 h; ∼21°C). Cochleae were processed sequentially with 10 and 30% sucrose at 4°C overnight, then embedded in OTC for cryosection in the modiolar plane. Sections were washed in PBS, permeabilized in 0.1% Triton X-100 for 25 min, and then incubated for 30 min in a blocking solution containing 1% bovine serum albumin and 1% goat serum. The 10 μm sections were incubated with primary antibody overnight at 4°C. The rinsed sections were then incubated (2 h; 4°C) in a fluorescent dye-conjugated secondary antibody. Images were captured with a Zeiss LSM 510 confocal microscope.
Construction of siRNAs, expression vector for Cav1.2 and Cav1.3 knock down.
Four of 19 base-long siRNAs were designed, using siRNA at WHITEHEAD software for each gene, and cloned under U6 promoter in pSilencer5.1-U6 vector to produce hairpin siRNAs (shRNAs). Each shRNA expression clone was cotransfected into HEK 293 cells with Cav1.2 or Cav1.3 expression clones, incubated for ∼72 h, and Cav1.2 or Cav1.3 expression was determined by immunostaining and patch-clamp recordings of Ca2+ currents. The most efficient shRNA (>90% reduced protein expression level compared with control) among the four was chosen and used. shRNA sequence for Cav1.2 is 5′-TGGAAACCATTTGAAATCATTCAAGAGATGATTTCAAATGGTTTCCATTTTT, and for Cav1.3 is 5′-GTAGAATATGCCTTCCTGATTCAAGAGATCAGGAAGGCATATTCTACTTTTT (sense and antisense strands are bold and loops are underlined).
Terminal dUTP nick end labeling (TUNEL) assay.
After 7 d in culture, SGNs that were transfected with scrambled shRNA, C3-shRNA to knockdown Cav1.2, and D2-shRNA to knockdown Cav1.3 were fixed in 4% paraformaldehyde for 20 min, washed 3× in PBS, and postfixed in ethanol/acetic acid (2:1) for 5 min. Following two washes in PBS, a 50 μl TUNEL reaction mixture (in situ cell death detection fluorescein; Roche Applied Science) was added and incubated in the dark and humidified chamber for ∼2 h at 37°C. The specimens were washed 3× in PBS, counterstained with 4′,6-diamidino-2-phenylindole·2HCl (DAPI), mounted, and viewed under a Zeiss LSM 510 confocal microscope.
Cochlear histology.
Animals were anesthetized (Avertin), 300 μg/gm BW, i.p.) and transcardially perfused with PBS (5 ml, 23°C), followed by a solution of 4% paraformaldehyde and 2% glutaraldehyde in 0.1 m PBS (10 ml, pH 7.4, 23°C). The temporal bones were removed and opened to expose the otic capsule. The stapes was removed and a perforation was made in the round window, following which fixative was perfused through the oval window. The bulla was then immersed in fixative (12 h, 4°C), rinsed with PBS, postfixed (1% OsO4 in 0.1 m PBS, 30 min), and decalcified (80 ml, 120 mm, 2SS EDTA, 23°C). The cochleae were dehydrated through a graded series of ethanol and propylene oxide before infiltration and embedding in plastic resin (EmBed 812; EMS). After polymerization (12 h, 58°C), the cochlea was bisected. The half-cochleae were re-embedded and completely polymerized (18 h, 58°C). Semithick sections (1 μm) with a modiolar orientation were cut and stained with toluidine blue for examination using a compound microscope (Zeiss or Nikon eclipse 80i) interfaced with a digital camera and an image analysis system (AxioVision from Zeiss or NIS Elements from Nikon). Images were adjusted using Adobe Photoshop according to the guidelines of the Microscopy Society of America.
Results
Cav1.3−/− SGNs have an altered firing pattern
We were able to demonstrate that null deletion of Cav1.3 had a severe impact on the resting membrane potential (rmp), spike frequency, AP duration, and latency in slowly adapting basal SGNs. In stark contrast, the AP properties were unscathed in rapidly adapting apical SGNs in Cav1.3−/− mice compared with their WT controls (Cav1.3+/+; Fig. 1). The summary data (n = 9) from each group are shown in Table 1. Significant membrane hyperpolarization, prolongation of AP duration, latency, and spike numbers (p < 0.01) were observed in slowly adapting basal Cav1.3−/− neurons. These differences may represent intrinsic alterations in the membrane properties of SGNs.
Evoked APs recorded from Cav1.3-null mutant mice show a decreased firing frequency and increased AP duration in slowly, but not rapidly, adapting SGNs. A, Representative recordings from WT (Cav1.3+/+) and (B) homozygous (Cav1.3−/−) mutant mice. We used the perforated-patch configuration to evoke electrical activity from isolated 3- to 4-month-old SGNs. Evoked APs were elicited with a 0.1 nA current (see stimulation protocol below each voltage trace) for a duration of ∼700 ms from rapidly (A, B) and slowly (C, D) adapting SGNs in a bath solution containing 2 mM Ca2+. The dashed lines show 0 mV levels. Analyses of AP properties showed significant changes (p < 0.05) in rmp, spike latency, frequency, and duration in slowly adapting SGNs in Cav1.3−/− compared with Cav1.3+/+ mice (see Table 1 for summary data). In contrast, alterations in AP properties of rapidly adapting SGNs were not statistically significant.
Changes in membrane properties after null deletion of Cav1.3
Changes in whole-cell Ca2+ current properties in Cav1.3+/+ and Cav1.3−/− SGNs
We compared whole-cell Ca2+ currents from SGNs derived from Cav1.3+/+ and Cav1.3−/− mice at two distinct locations of the cochlear axis. Isolated SGNs were held at a holding potential of −100/−40 mV and stepped to depolarizing voltages (ΔV = 5–10 mV) ranging between −50 and 40 mV. Figure 2, A and B, represents a family of Ca2+ current traces recorded from Cav1.3+/+ and Cav1.3−/− SGNs, respectively. As depicted in the whole-cell Ca2+ current–density voltage relationships, the current densities between the Cav1.3+/+ and Cav1.3−/−, as well as apical (Fig. 2C) and basal (Fig. 2D) neurons, were comparable. The only exception between apical and basal SGNs occurred in the Cav1.3−/− neurons when held at a holding potential of −100 mV (e.g., the peak current density in pA/pF). Under this condition, apical neurons demonstrated a peak current density = −70.5 ± 8.0; (n = 9), while in basal neurons, the peak current density = −54.7 ± 3.9 (n = 9, p < 0.01). Ca2+ currents were activated from a holding potential of −50 mV and the steady-state activation with respect to voltage derived from the tail currents at −20 mV were fitted with a Boltzmann function. The half-activation voltage (V1/2) was −18.5 ± 1.1 mV (n = 7) for Cav1.3+/+ and −11.4 ± 0.3 (n = 7) for Cav1.3−/− SGNs. The ∼7 mV rightward shift in the V1/2 for Ca2+ currents is consistent with the low-voltage activation properties of the Cav1.3 current (Rodriguez-Contreras and Yamoah, 2001; Xu and Lipscombe, 2001; Zhang et al., 2002; Michna et al., 2003; Schnee and Ricci, 2003; Zampini et al., 2010). We determined the relative densities of high voltage-activated Ca2+ currents derived from multiple channel subtypes in isolated SGNs from Cav1.3−/− mice using pharmacologic strategies (Lv et al., 2012). To suppress low voltage-activated Ca2+ currents, these subsequent experiments were performed at a holding voltage of −50 mV. Using ATX for P/Q-type, CTX for N-type, and rSNX-482 for R-type Ca2+ currents, and in combination, we demonstrated that the Cav1.3−/− SGNs expressed multiple current subtypes in apical and basal neurons in relatively similar proportions as in Cav1.3+/+ neurons (Lv et al., 2012; Fig. 3, Table 2).
Whole-cell Ca2+ currents in Cav1.3+/+ and Cav1.3−/− SGNs demonstrate substantial differences in the activation properties. A, A family of membrane Ca2+ current traces recorded from SGNs isolated from Cav1.3+/+ mice, using 2 mm external Ca2+ as the charge carrier. Inward Ca2+ currents were generated using depolarizing test voltages from −50 to 40 mV, in 5 mV increments from a holding voltage of −40 mV. For clarity, some of the traces were omitted in the illustration. Outward K+ currents were suppressed with a bath solution containing TEA, 4-AP, and internal solution containing Cs+ and NMG+ (see Materials and Methods). B, The current traces were recorded as in A, from a holding voltage of −40 mV using Cav1.3−/− SGNs (blue). C, D, Summary of the corresponding current–density–voltage (I–V) relations for recording at −100 and −40 mV holding voltages, using apical (C) and basal (D) Cav1.3+/+ and Cav1.3−/− SGNs. Data were summarized from n = 9. The current densities for Cav1.3+/+ and Cav1.3−/− apical and basal neurons were similar, except when cells were held at −100 mV. At this holding voltage, the current density for apical neurons was significantly greater than basal neurons. The peak current density (pA/pF) for apical neurons at a holding potential of −100 mV = −70.5 ± 8.0; and basal neurons = −54.7 ± 3.9 (n = 9), p < 0.01. E, Neurons were held at a holding potential of −50 mV and tail currents were generated at −20 mV, and the steady-state voltage dependence of activation was plotted and fitted with a first order Boltzmann function for Ca2+ currents derived from Cav1.3+/+ and Cav1.3−/− (blue) basal neurons. The half-activation voltages (V1/2, in mV) were −18.5 ± 1.1 and −11.4 ± 0.3, and the maximum slope factors (k, in mV) were 7.0 ± 1.5 and 9.1 ± 2.6. (n = 7).
Pharmacological characterization of Ca2+ currents in Cav1.3−/− basal SGNs. Ca2+ currents from basal SGNs were generated using a holding voltage of −50 mV and stepped to depolarizing voltage steps from −50 to 30 mV, using a ΔV of 10 mV. The I–V relations were generated before (●) and after (○) application of Ca2+ current blockers, ω-agatoxin IVA for P/Q-type (A), ω-conotoxin MVIIA for N-type (B) currents. A, I–V relations for control and the remaining current density after application of 1 μm ω-agatoxin IVA (n = 7). Insets to the right of the plots are representative current traces used to generate the I–V curves. B, Similar experiments and I–V curves as described in A, to determine the component of the whole-cell Ca2+ current that was derived from N-type channels (n = 7). We applied 1 μm conotoxin MVIIA in these sets of experiments. C, Despite null deletion of the reported neuronal L-type Ca2+ channel, Cav1.3, whole-cell Ca2+ currents in Cav1.3−/− neurons remained sensitive to the DHP agonist, Bay K 8644 (5 μm). The Ca2+ current was increased by ∼1.25-fold (n = 7). D, Consistent with the expression of an additional L-type current in the whole-cell Ca2+ current from Cav1.3−/− SGNs, the current was suppressed by nimodipine (5 μm). E, Summary I–V of the effect of a mixture (cocktail) of Ca2+ channel blockers consisting of 5 μm nimodipine, 1 μm ω-agatoxin IVA, 1 μm conotoxin MVIIA, and 200 nm rSNX-482 (R-type Ca2+ channel blocker). Table 2 provides a summary of the proportion of currents that were sensitive to a specific Ca2+ channel blocker.
Percentage of Ca2+ current blocked by different blockers at 0 mV step voltage after null deletion of Cav1.3
Although it has been demonstrated in the Cav1.3−/− mouse model that the channel is nonfunctional in multiple tissues, such as pancreatic β-cells and heart and hair cells, resulting in diseased phenotypes including diabetes, bradycardia, and deafness (Namkung et al., 2001; Zhang et al., 2002; Dou et al., 2004), we cross-checked the possibility for expression of an additional L-type current in the SGNs. Application of two different DHP antagonists, nifedipine (10 μm) or nimodipine (5 μm), resulted in a significant reduction of whole-cell Ca2+ currents from the isolated Cav1.3−/− SGNs (Fig. 3, Table 2). We confirmed the DHP-specificity by examining the effects of Bay K 8644, the DHP agonist. Consistent with the actions of DHPs on L-type currents, Bay K 8644 induced a leftward shift in the activation voltage of the Ca2+ current by ∼10 mV, suggesting that a remnant L-type current persisted after null deletion of Cav1.3. The findings may represent an upsurge of an otherwise latent Cav1.2 channel in WT SGNs. Thus, the presence of an apparent DHP-sensitive current in a genetically modified mouse model may not suffice to conclude that Cav1.2 is expressed in WT SGNs. The only known tangible difference in currents derived from Cav1.2 and Cav1.3 channels is that the latter activates at relatively negative voltages and is less sensitive to the DHPs (Xu and Lipscombe, 2001; Zhang et al., 2002).
Elementary properties of Cav1.2 and Cav1.3 currents in SGNs
A more direct strategy to examine the channels that contribute to whole-cell currents is to record from single-channel patches in the cell-attached configuration. Figure 4A shows a family of single-channel Ba2+ current traces recorded from a patch, obtained from a WT basal neuron, that was held at −50 mV holding potential and stepped to voltages indicated after application of external solution containing 5 μm Bay K 8644 (Fig. 4A,C). The charge carrier was 50 mm Ba2+. Membrane depolarization resulted in typical brief and long openings. Moreover, long openings were favored at more depolarized potentials. Visually, two-distinct DHP-sensitive, single-channel Ba2+ currents were recorded from WT SGNs: (1) low voltage-activated current (activation voltage approximately −40 mV) with unitary current amplitude of approximately −1.6 pA and (2) high voltage-activated current (activation voltage approximately −20 mV) with amplitude of ∼1.1 pA, at −10 mV step potential. The amplitude histograms obtained at a test potential of −10 mV are shown (Fig. 4B,D). Illustrated in Figure 4E are the summary data of the unitary current amplitudes plotted against the test potentials for the two distinct DHP-sensitive Ca2+ channels. The slope conductances for the linear plots were 21.8 ± 1.6 pS (n = 7) and 27.6 ± 0.9 pS (n = 7). At specific voltages (−10, 0 mV), the large-conductance channel had open probabilities that were significantly greater than the small-conductance channel (Fig. 4F). For the patches we examined, we did not observe simultaneous recordings of the two L-type channels. However, it is conceivable that colocalization of the two L-type channels may occur in SGNs.
Two distinct Bay K 8644-sensitive unitary Ba2+ currents in WT SGNs. A, Ten consecutive single-channel traces of Ba2+ currents at test potentials from −40 to 0 mV were obtained from L-type channels using the agonist, Bay K 8644 (5 μm), in the bath solution. The experiments were performed first in the absence of Bay K 8644. After tight seal cell-attached configuration was established, we examined characteristic L-type channel brief openings, before bath application of 5 μm Bay K 8644 containing solution. Patches with single channels that were not sensitive to the Bay K 8644 were discarded. Single-channel Ba2+ current traces were recorded using 50 mm Ba2+ as the charge carrier. The traces were generated by holding the membrane patch at −50 mV and stepping to potentials indicated above each set of traces. The open (O) and closed (C) levels are indicated. Brief openings were predominant in the unmodified channel (data not shown). B, An example of amplitude histogram used to determine the mean magnitude of unitary currents at −10 mV step potential (∼1.3 pA) is shown. We denote this channel as Cav1.2. C, A family of 10 consecutive traces, as illustrated in A, obtained from another distinct Bay K 8644-sensitive channel. Openings of this distinct channel could be seen at more negative voltages than the channel in A. The channel is ascribed as Cav1.3. D, Amplitude histogram of the putative Cav1.3 at −10 mV step voltage. E, Single-channel conductance (γ) of two distinct L-type channels in SGNs were determined using linear least-square fits to the mean single-channel amplitude (Cav1.2, ○; Cav1.3, ●) at different step potentials. The conductance of the L-type channels: Cav1.2 = 21.8 ± 1.6 pS (n = 7) and Cav1.3 = 27.6 ± 0.9 pS (n = 7). F, Summary histogram of the open probability (NPo) of Cav1.2 and Cav1.3 at the test potentials (−10 mV, solid line) and (0 mV, dashed line); **p < 0.01.
Localization of Cav1.2 and Cav1.3 proteins in SGNs
To obtain biochemical evidence for the existence of Cav1.2 and Cav1.3 expression in SGNs, we used antibodies against the two channels. We observed positive labeling in the membrane and cytoplasm of SGNs in both apical and basal neurons (Fig. 5). Positive labeling of neuronal membrane was atypical in control experiments in which SGNs were pre-incubated with purified peptides supplied by the company (data not shown). To ensure that the data obtained from isolated neurons, in vitro, were consistent with in vivo conditions, we repeated the experiments using cochlear sections from age-matched WT littermates (Fig. 6), confirming the existence of Cav1.2 and Cav1.3 in adult SGNs. These findings were in keeping with previous reports demonstrating the expression of Cav1.3 in SGNs (Lv et al., 2012). Thus, biophysical and biochemical analyses divulged from these studies strongly suggest that Cav1.2 and Cav1.3 are functional components of Ca2+ currents in SGNs.
SGNs express Cav1.2 and Cav1.3 channels. Cultured (48 h) SGNs were fixed and labeled with antibodies against Cav1.2 and Cav1.3. Neurons were labeled with the neuronal marker, Tuj1 (red), the Cav channels (green), and the nuclei were stained with DAPI (blue); the merged images are shown on the right. The graphs adjacent to the merged images describe the fluorescent intensity differences in the expression of the channel against distance marked with a white arrow on the plasma membrane and cytosol. A and B show expression of the two channels in apical and basal SGNs, respectively. Scale bar, 10 μm.
Expression of Cav1.2 and Cav1.3 in C57BL/6 mouse cochlear sections. A, B, Apical (A) and basal (B) SGNs expressed Cav1.2 and Cav1.3 in vivo. We performed immunolabeling, as described in Figure 5, on sections of the cochlea from 3-month-old mice. SGNs were labeled with antibodies against Cav1.2 and Cav1.3 (red). Neurons were labeled with the neuronal marker Tuj1 (green) and the nuclei were stained with DAPI (blue). SGNs stained positively to Cav1.2 and Cav1.3. Scale bar, 20 μm.
Altering the expression levels of Cav1.2 and Cav1.3 in SGNs to determine their functions
To assess the roles of Cav1.2 and Cav1.3 in SGNs, we designed shRNA to knock down the respective genes. As many as four different shRNA were designed and tested. The most efficient ones to knock down functional expression of the channels in a heterologous expression system (HEK 293 cells) were selected for Cav1.2 and Cav1.3 knockdown in SGNs. Shown in Figure 7, A–C, are the results from the knockdown of Cav1.2 and Cav1.3 after 72 h of transfection using C3 and D2, the respective nomenclature of the shRNA. Using magnetofectamine, we transfected shRNA into SGNs to knock down Cav1.2 and Cav1.3. The control groups were transfected with scrambled shRNA; the reporter gene was GFP. One week post-transfection, as many as 90–96% of all neurons that were transfected with GFP and C3 or D2 had undergone apoptotic cell death, as evaluated using TUNEL assay (Fig. 8A,B). The experiments were performed in triplicates of different culture preparations. The total number of neurons from the three different experiments is reported. For scrambled shRNA controls, there were 78 apoptotic neurons from a total of 986 neurons (∼8%) counted. In the experimental groups using C3 to knock down Cav1.2, there were 1115 apoptotic neurons from a total of 1163 (∼96%). Moreover, D2-mediated knockdown of Cav1.3 resulted in 753 apoptotic neuronal deaths from a total of 846 neurons (∼89%; Fig. 8). Functional confirmations of knockdown of Cav1.2 and Cav1.3 were difficult to assess since 7-d-old post-transfected neurons were not amenable to rigorous electrophysiological experiments.
Assessment of efficiency of knockdown of Cav1.2 and Cav1.3 by shRNA in HEK 293 cells. A, Representative whole-cell current traces were recorded from HEK 293 cells transfected with Cav1.2 DNA and scrambled shRNA as controls (left) and C3 shRNA (right). Recordings were made 96 h after transfection. B, Similar recordings were made after transfecting scrambled shRNA with Cav1.3 DNA used as control experiments (left) and D2 shRNA (right). C, Shown is the summary data of the current–voltage relationships for the experiments described in A and B. Data were obtained from seven cells in each group.
Assessment of apoptotic cell death. A, Top, Shows cultured SGNs that were transfected with C3 shRNA to knockdown Cav1.2 channels. The leftmost column shows DAPI-stained nuclei (blue), while GFP (green) denotes the reporter gene in the second column from the left. The adjacent column shows TUNEL-positive apoptotic neurons (red), while the second column from the right depicts immunopositivity for the neuronal marker stain, Tuj1 (cyan). The column at the extreme right is the merged image. For C3 knockdown of Cav1.2, there were 1115 apoptotic neurons from a total of 1163 neurons (∼96%). For scrambled shRNA controls, there were 78 apoptotic neurons from a total of 986 neurons (∼8%). Cultures without addition of scrambled shRNA and C3 shRNA had 45 TUNEL-positive neurons out a total of 746 neurons (∼6%). B, Data obtained using D2 shRNA, to knockdown Cav1.3 channels, scrambled shRNA and without the addition of D2 and scrambled shRNA are illustrated here. In this experimental group, D2-mediated knockdown of Cav1.3 resulted in 753 apoptotic neuronal deaths from a total of 846 neurons counted (∼89%). For control scrambled shRNA culture, we counted 111 TUNEL-positive neurons among 1008 neurons (∼11%), and cultures with no scrambled or D2 shRNA had 23 TUNEL-positive neurons in 563 neurons (∼4%).
Cav1.2 and Cav1.3 function in SGN survival
We reasoned that if Cav1.2 and Cav1.3 are necessary for the survival of SGNs, then reduced expression of these two genes is more likely to produce time-dependent alterations in neuronal survival. To test this hypothesis, we examined the extent of SGN survival in young and middle-aged adult Cav1.2+/− and Cav1.3+/− mice compared with age-matched C57 mice, which serve as the background strain control for both heterozygote mice. As illustrated in Figure 9, the Cav1.2+/− mice had a substantial reduction in the number of surviving neurons, as well as satellite cells, compared with their age-matched controls, at both 8 and 16 weeks of age. The loss of neuronal cells in the Cav1.2+/− mouse appeared slightly greater in the basal versus apical turns (Fig. 9F,J vs D,H). The Cav1.3+/− mouse also showed a greater loss of SGNs versus the C57 age-matched control (Fig. 10). However, the SGN loss in the Cav1.3+/− mouse appeared to be confined to the basal turn only (Fig. 10B, rightmost, bottom). The confinement of SGN loss to the basal turn of the Cav1.3+/− mouse is in marked contrast to the loss of apical SGNs in the Cav1.2+/− mouse at both a slightly younger (Fig. 9D) and older (Fig. 9H) age. Although the sample of heterozygote mice was small, the substantial reduction of surviving neurons later in development compared with their age-matched controls solidifies the possibility that Cav1.2, and perhaps Cav1.3 as well, contribute toward survival of SGNs.
Reduced SGN density in Cav1.2 heterozygote mice. A, B, Modiolar cochlear sections depicting the lower apical (Apex) and basal (Base) turns from a 16-week-old C57BL/6 control (A) mouse and a Cav1.2+/− (B) mouse. Although at this age, a reduction in the number of eighth nerve fibers is expected in the C57 mouse, the density appears even more reduced in the Cav1.2 +/− mutant. The spiral ganglion regions, outlined in dashes, are shown at higher magnification in C–J. C–F, The spiral ganglion region, shown at higher magnification for the C57BL/6 (C, E) and Cav1.3 +/− (D, F) cochlea, is shown for apical (Apex) and basal (Base) turns at 8 weeks of age. In both turns, the packing density of the SGN region appears lower in the Cav1.2+/− mouse (D, F). G–J, The spiral ganglion region, shown at higher magnification for the C57BL/6 (G, I) and Cav1.3+/− (H, J), is shown for apical (Apex) and basal (Base) turns at 16 weeks of age. The SGN density in the apical turn of the C57BL/6 mouse (G) appears higher than that of the age-matched littermate Cav1.2+/− mouse (H). A higher density in the basal SGN region is also evident between the C57 (I) and Cav1.2+/− (J) mouse. Interestingly, the density of the basal turn SGN region in the 8-week-old C57 and Cav1.2 +/− mice (E, F) appears lower than that of the equivalent SGN area in each strain of mouse at 16 weeks of age (I, J). Consistent data were obtained from three different preparations at different ages, using multiple mid-modiolar sections. SG, spiral ganglion; SL, spiral limbus; IHC, inner hair cell; OHC, outer hair cell; tm, tectorial membrane; RM, Reissner's membrane; StV, stria vascularis; SpLig, spiral ligament. Scale bars: A, B, 200 μm; C–J, 50 μm.
Reduced SGN density in Cav1.3 heterozygote mice. A, Modiolar cochlear sections depicting the lower apical and basal turns from a 5-week-old C57BL/6 control mouse. At this age, no reduction in the number of eighth nerve fibers is expected in the C57BL/6 mouse. The spiral ganglion regions for this mouse are shown at higher magnifications (B, bottom). B, The spiral ganglion region, shown at higher magnifications for the C57BL/6 (left) and Cav1.3+/− (right), is shown for apical (Apex) and basal (Base) turns at 5 weeks of age (top) and at 11 weeks of age (bottom). No difference is evident in the four images from the 5-week-old mice (top). However, a reduction in density in the spiral ganglion area is evident in the base of the Cav1.3+/− mouse at 11 weeks of age (bottom right) when compared with an equivalent region in the C57BL/6 basal SGN region (bottom, second image from right). In contrast, equivalent areas of the SGN region in the apical turn of the Cav1.3+/− mouse and C57BL/6 mouse do not show any differences in the packing density. Consistent data were obtained from three different preparations at different ages, using multiple mid-modiolar sections. SG, spiral ganglion; SL, spiral limbus; IHC, inner hair cell; OHC, outer hair cell; TM, tectorial membrane; RM, Reissner's membrane; StV, stria vascularis. Scale bars: A, 200 μm B, 50 μm.
Discussion
We have previously demonstrated that SGNs are among the category of neurons that express a variety of Cav channels to confer Ca2+-dependent functions. The DHP-sensitive current was attributed to Cav1.3, implicit of its neuronal origin and by immunocytological findings (Xu and Lipscombe, 2001; Lv et al., 2012). In this report, we have shown that the DHP-sensitive currents in SGNs do indeed consist of Cav1.2 and Cav1.3 channels. Evaluation of the conductances of the two L-type channels suggest that our previous report was focused on Cav1.2 channels and not Cav1.3, as was implied in that study (Lv et al., 2012). We further assert that both channels may have distinct developmental roles such that knockdown of either channel can result in apoptotic cell death. Moreover, maintenance of the integrity of neurites is more likely to be controlled by Cav1.2 than Cav1.3. Recordings from isolated SGNs from Cav1.3−/− mice showed a significant decrease in the firing frequency of slowly adapting neurons from the basal aspects of the cochlear contour. Features of APs from fast-adapting neurons were unchanged in Cav1.3−/− neurons. Careful assessment of the APs from slowly adapting neurons from the Cav1.3−/− mice identified prolonged latency and paradoxical increase in AP duration, despite comparable whole-cell Ca2+ current densities in the WT and null mutant neurons (Fig. 2). Whole-cell, Ca2+ current recordings revealed ∼7 mV depolarization shift in the steady-state voltage-dependent activation in Cav1.3−/− SGNs compared with the Cav1.3+/+ neurons. The enduring presence of a DHP-sensitive current in Cav1.3−/− SGNs further solidified our prediction that these neurons express two distinct DHP-sensitive Cav channels. Although it can be argued that null deletion of the Cav1.3 gene can result in compensatory expression of an otherwise latent Cav1.2 gene, direct recordings of single-channel fluctuations from WT SGNs, showing Bay K 8644-sensitive conductances (pS) of ∼22 and ∼28, substantiated the evidence that two distinct DHP-sensitive channels are present in SGNs. Expression of Cav1.2 and 1.3 was confirmed and knockdown of the channels produced apoptotic neuronal death. Finally, we demonstrate that expression of a single copy of Cav1.2 and Cav1.3 resulted in differential and time-dependent tonotopic degeneration of SGNs, implicating a development and maintenance role for Cav1.2, and perhaps for the Cav1.3 channel as well.
Functional roles of Cav1.2 channels in SGNs
The findings from this study are in line with the previous concept that SGNs express L-type Ca2+ channels (Hisashi et al., 1995) and indirect pharmacological evidence that also implicated L-, N-, and P/Q-type Ca2+ channels (Roehm et al., 2008). More recently, direct functional assessment of mature neurons have clearly demonstrated that SGNs harbor L-, N-, P/Q-, R-, and T-type Ca2+ channels (Lv et al., 2012). Cav1.2 channels were identified in SGNs (Waka et al., 2003; Chen et al., 2011), and null deletion of Cav1.2 in SGNs appears to reduce susceptibility to noise-induced hearing loss (Zuccotti et al., 2013). Moreover, until now, it had not been demonstrated whether Cav1.2 channels are indeed functional in SGNs. Using a Cav1.3-null deletion mouse model, and direct single-channel recordings from WT neurons, we have demonstrated that SGNs express functional Cav1.2 channels. The prevalence of Cav1.2 channels in SGNs is further substantiated by re-evaluation of the conductance of the L-type channels reported previously, such that it is more likely to be Cav1.2 than Cav1.3 channels (Lv et al., 2012).
Long-term activation of Ca2+ signaling pathways may control gene expression in a distinctive fashion. Gomez-Ospina et al. (2006) have revealed that in addition to Ca2+ ions, a fragment of the C termini of Cav1.2 channel-associated transcription regulator, serves as a transcription factor. Specifically, Cav1.2 is important for activation of transcription factors that have important roles in promoting neuronal survival and dendritic arborization, such as CREB. Indeed, it has been demonstrated that Ca2+ inflow through Cav1.2 is responsible for activation of Ca2+ responsive binding protein, which serves as a cis-acting element that encodes brain-derived neurotrophic factor (BDNF) exon IV promoter to regulate the neurotrophin (NT) in an activity-dependent manner (West et al., 2001). BDNF and NT3 are required for cochlear development (Fariñas et al., 1994; Lefebvre et al., 1994; Ernfors et al., 1995), and since their receptors remain robustly expressed after the maturation of hearing, it raises the possibility that both NTs are required to maintain and prevent neuronal degeneration (Miller et al., 1997; Fritzsch et al., 1999; Rubel and Fritzsch, 2002). Thus, for SGNs, the importance of these findings may stem from the prospects that Ca2+ inflow through Cav1.2 may be the underlying mechanism for the maintenance and potential rescue from neuronal degeneration. It remains to be addressed whether direct electrical stimulation of SGNs via an implanted electrode, which increases SGN survival after hair cell loss (Mitchell et al., 1997; Leake et al., 1999), is mediated through activity-dependent activation of Cav1.2.
Functional roles of Cav1.3 channels in SGNs
Our data remain consistent with the previous notion that Cav1.3 channels are among one of the multiple Ca2+ channels in SGNs (Lv et al., 2012), and it is also in agreement with studies that demonstrated Cav1.3 channels are low voltage-activated (Xu and Lipscombe, 2001). After null deletion of Cav1.3, the voltage-dependent activation properties of the whole-cell Ca2+ currents were shifted rightward by ∼7 mV. Since the recordings in Figure 2E were performed at a holding potential of −50 mV, we anticipate that other low voltage-activated Ca2+ channel (T-type, Cav3.x) currents in SGNs were suppressed by increased inactivation (Lv et al., 2012). Significant prolongation of the AP latency in the Cav1.3−/− basal SGNs supports the prediction that the current likely contributes toward the upstroke phase of APs. Although the Ca2+ current densities in the Cav1.3+/+ and Cav1.3−/− SGNs remained unchanged, predictably because of compensatory changes in the mutant mice (Zhang et al., 2002), AP duration was unexpectedly prolonged in basal neurons. These findings raise the possibility that activation of the Cav1.3 channel may be functionally coupled with a Ca2+-dependent outward current. Indeed, a similar conclusion was made in a study of cardiac myocytes in which the AP prolongation in Cav1.3−/− mice was attributed to abnormal function of the small conductance Ca2+-activated K+ (SK) channels (Lu et al., 2007). The unique specificity of functional coupling between Ca2+ channels and Ca2+-activated K+ channels has also been demonstrated in hippocampal neurons (Marrion and Tavalin, 1998). For SGNs, additional experiments are required to identify the potential outward current associated with Cav1.3 and the ensuing mechanisms, and their functional relevance. Moreover, the nuances of the significance of expression of two distinct DHP-sensitive Ca2+ channels in SGNs remain to be disentangled fully.
Footnotes
This work was supported by grants to E.N.Y. from the National Institutes of Health (DC003,826). P.L. was funded by the National Organization for Hearing Research and National Natural Science Foundation of China (81200746). X.-D.Z was partially supported by AHA Western States Affiliate Beginning Grant-in-Aid (14BGIAA18870087). N.C. was funded by Grants HL085727, HL085844 and VA Merit Review Grant I01 BX000576. We thank members of our laboratory for comments on this manuscript. We thank Dr. Geoffrey S. Pitt for providing the Cav1.2+/− and their littermate control mice.
The authors declare no competing financial interests.
- Correspondence should be addressed to Ebenezer N. Yamoah, Program in Communication Science, Center for Neuroscience, 1544 Newton Court, Davis, CA 95618. enyamoah{at}ucdavis.edu
