Abstract
The heparan sulfate proteoglycan Glypican 4 (Gpc4) is strongly expressed in mouse embryonic stem (ES) cells where it controls the maintenance of self-renewal by modulating Wnt/β-catenin signaling activities. Here we show that mouse ES cells carrying a hypomorphic Gpc4 allele, in a single-step neuronal differentiation protocol, show increased differentiation into dopaminergic neurons expressing tyrosine hydroxylase (TH) and nuclear receptor related-1 protein (Nurr1) 1. In contrast to wild-type cells, these differentiating Gpc4-mutant cells expressed high levels of DOPA decarboxylase and the dopamine transporter, two markers expressed by fully mature dopaminergic neurons. Intrastriatal transplantation of Gpc4 hypomorphic cells into a 6-OHDA rat model for Parkinson's disease improved motor behavior in the cylinder test and amphetamine-induced rotations at a higher level than transplanted wild-type cells. Importantly, Gpc4 hypomorphic cell grafts, in contrast to wild-type cells, did not generate teratomas in the host brains, leading to strongly enhanced animal survival. Therefore, control of Gpc4 activity level represents a new potential strategy to reduce ES cell tumorigenic features while at the same time increasing neuronal differentiation and integration.
Introduction
Parkinson's disease (PD) is one of the most common neurodegenerative diseases. It is characterized by a progressive loss of midbrain dopamine (DA) neurons with a subsequent reduction in striatal DA (Olanow, 1999). Pharmacological treatment with l-DOPA temporarily ameliorates clinical symptoms but induces severe complications, such as dyskinesias (Pearce et al., 2001). Deep brain stimulation, although representing an efficient alternative treatment, can also have side effects (Olanow et al., 2000). Cell-therapeutic approaches in diseased humans have so far been based on the transplantation of fetal DA neurons, and clinical studies indicate that transplantation of these cells can induce symptomatic relief (Freed et al., 2001; Mendez et al., 2005). However, immunological, logistical, technical, and ethical difficulties have limited the development and application of this approach (Lindvall, 2012).
Embryonic stem (ES) cells or induced pluripotent stem (iPS) cells, differentiated toward the midbrain dopaminergic fate in vitro, represent an alternative source for cell replacement therapy in PD (Björklund and Isacson, 2002; Kim et al., 2002; Perrier et al., 2004; Arenas, 2010). However, in vitro dopaminergic differentiation has to be finely controlled, and current protocols involving morphogens and drugs are complex and costly (Kriks et al., 2011). Moreover, the risk associated with uncontrolled tissue growth in the brain needs to be abolished (Björklund and Isacson, 2002; Isacson, 2003). Indeed, rodent studies have shown tumor formation after ES cell transplantation (Björklund and Isacson, 2002; Barberi et al., 2003) that was insufficiently reduced by the available differentiation protocols (Barberi et al., 2003) or cell sorting (Hedlund et al., 2008). Therefore, the use of ES cells and iPS cells for therapy in PD remains currently elusive.
The cell surface protein Glypican 4 (Gpc4), one of the most abundant heparan sulfate proteoglycans expressed by mouse ES cells, controls the maintenance of stem cell self-renewal (Fico et al., 2012). Remarkably, downregulation of Gpc4 in ES cells suppressed teratoma formation after grafting into the flank of nude mice. Moreover, ES cells with reduced expression levels for Gpc4 (Gpc4gt−1) showed increased neuronal differentiation in vitro (Fico et al., 2012).
Here we explore the ability of Gpc4 mutant cells to decrease teratoma formation and improve neuronal differentiation in a PD cell-based therapeutic context. We show that Gpc4gt−1 ES cells generate increased amounts of mature DA neurons in vitro. After transplantation of these cells in a rat PD model, dopaminergic differentiation in vivo was increased and accompanied by improved motor behavior. Moreover, Gpc4gt−1 ES cells showed decreased teratoma formation, which correlated with enhanced animal survival.
Materials and Methods
In vitro experiments
ES cell cultures and differentiation.
ES cell lines PST132 and E14Tg2a were previously described (Niwa et al., 2000; Fico et al., 2012). GFP was inserted in both ES cell lines at the Rosa26 locus by transfecting them with the R26P-SA-EGFP-puro plasmid (Addgene). Puromycin-selected ES cell clones were verified for correct self-renewal and differentiation properties and used as pools in all grafting experiments.
Cell lines were maintained on a monolayer of mitomycin-C-inactivated mouse fibroblasts in the presence of DMEM supplemented with 15% FBS, 100 μm 2-mercaptoethanol, 1 × MEM nonessential amino acids, 2 mm l-glutamine, 1 mm sodium pyruvate, and 100 units/ml LIF ESGRO (Millipore Bioscience Research Reagents).
Neuronal differentiation used a serum-free neural induction protocol (Fico et al., 2008).
Immunofluorescence stainings and cell counts
Immunofluorescence stainings were done as described previously (Fico et al., 2012). Primary antibodies used were mouse anti-NeuN (Millipore, 1:100), rabbit anti-GABA (Sigma, 1:300), and rabbit anti-tyrosine hydroxylase (TH, Millipore, 1:300). Quantitative immunocytochemical analysis was performed on randomly selected visual fields from two independent differentiation experiments. On average, 10 visual fields, at 20× magnification were acquired and a total of 3000 NeuN+ cells were counted per experiment.
RNA preparation and RT-PCR
Total RNAs were isolated using RNeasy mini kit (QIAGEN) and reverse transcribed using QuantiTect Reverse Transcription kit (QIAGEN) following the manufacturer's instructions. qRT-PCR was performed using SYBR Green PCR master mix (EuroClone). Primers: TH, sense (s) tgtcacgtccccaaggttcat, antisense (as) gggcaggccgggtctctaagt; nuclear receptor related-1 protein (Nurr1), (s) gcccgatgtgggacgat, (as) tctgctcgatcatatgcgtagtg; DOPA decarboxylase (DDC), (s) gaacagacttaacgggagccttt, (as) aatgccggtagtcagtgataagc; dopamine transporter (DAT), (s) gtgggcttcactgtcatcctca, (as) cccaggtcatcaatgccacga; GAPDH, (s) atggggaaggtgaaggtcg, (as) gggtcattgatggcaacaatatc; no. of cycles was in all cases 30.
In vivo experiments
6-Hydroxydopamine (6-OHDA) lesions.
Male Wistar rats were lesioned by intranigral 6-OHDA injection as described previously (Oueslati et al., 2007). Lesioned animals were selected for transplantation based on their response to amphetamine-induced rotational behavior and asymmetry score in the cylinder test to get homogeneous groups of animals.
Immunosuppression
Cyclosporine A (10 mg/kg Sandimmun, Novartis) in sunflower seed oil (Sigma, S5007) was injected daily starting 1 d before surgery.
Transplantation procedures
For transplantations, ES cells were prepared as described by Björklund et al. (2002). Briefly, the cells were seeded at 5 × 106 cells in the absence of LIF. ES cells did not adhere to the dish but instead formed embryoid bodies. Four days later, embryoid bodies were dissociated with trypsin. 6-OHDA-lesioned animals received injections of 1 μl of suspension (10,000 cells/μl) into two sites of the right striatum (bregma: anterior 1.0 mm, lateral 3.0 mm, ventral 5.0 and 4.5 mm). Two independent cell transplantation experiments were performed.
Behavioral tests
Cylinder test was performed as reported previously to assess akinesia-like deficit of the forepaw contralateral to the lesion (Oueslati et al., 2007; Jouve et al., 2010). Lesioned rats were tested for rotational behavior in response to amphetamine (4 mg/kg i.p., Sigma). Behavior was monitored by a computerized activity monitor system and analyzed as described previously (Björklund and Isacson, 2002).
Histological procedures, immunohistochemistry, and cell counting
Fifty-micrometer sections were prepared and labeled as described previously (de Chevigny et al., 2012). Antibodies included the following: anti-TH (Aves, 1:1000; or Immunostar 1:1600), anti-GFP (Aves; 1:500), anti-nestin (Aves; 1:1000), anti-DAT (Santa Cruz Biotechnology; 1:100), anti-Pitx3 (gift from Austin Smith, 1:1000), anti-FoxA2 (Santa Cruz Biotechnology; 1:100), anti-calbindin (Millipore; 1:1000), anti-GABA (Sigma; 1:300), anti-serotonin (5-HT) (Immunostar; 1:500), and anti- dopamine D2 receptor (DRD2) (Millipore/Abcam; 1:150; specificity of the antibodies was validated on sections at the level of the substantia nigra). Images were acquired with Nikon macroconfocal or with Zeiss 510 Meta/780 confocal microscopes.
Measures of the three largest graft areas for each animal were performed from Nikon macroconfocal images (5× lens, optical zoom ×3) using ImageJ. TH cell density was counted semiautomatically using ImageJ on every sixth section for each rat.
Evaluation of FoxA2, Pitx3, calbindin, and DAT expression in TH+ cells was done on 63× Zeiss confocal microscope. Evaluation of GABA, 5-HT, and DRD2 positive cells was done on 20× Zeiss confocal microscope
Statistical analysis
Data are presented as mean ± SEM. n represents number of animals. Statistical tests are specified in figure legends (Instat software, Graph Pad Software). Differences were considered statistically significant when p < 0.05.
Results
Gpc4gt−1 hypomorphic ES cell cultures showed increased morphological and immunohistochemical signs of neuronal differentiation in a well-defined 12 d single-step neuronal differentiation protocol as previously reported (Fico et al., 2008). We further characterized the properties of Gpc4 loss-of-function cells under these culture conditions. TH, the rate-limiting enzyme for the synthesis of DA, was strongly induced (Fig. 1A). qRT-PCR showed that as early as at day 6 of in vitro differentiation, when TH transcripts were not detectable in wild-type (wt) cultures, mutant cells (Gpc4gt−1) already expressed TH mRNA. Over the entire analyzed time window, TH expression remained approximately fourfold over controls (Fig. 1A).
The increased expression of TH in mutant cells could arise either from globally accelerated differentiation or from specifically enhanced DA neuron fate commitment. Quantitative analysis at 12 d in vitro (DIV) showed that in Gpc4 mutant cultures the proportion of TH+ presumptive DA neurons among the NeuN-expressing neuronal population was doubled compared with wt cells (wt: 9.6 ± 0.6%; Gpc4gt−1: 19.6 ± 1%; Fig. 1B,C). In contrast, the proportion of GABA+ cells among the NeuN+ neurons was unchanged (wt: 46.9 ± 3%; Gpc4gt−1: 42.9 ± 3.%; Fig. 1B,C). We also stained for parvalbumin and Islet-1 but found too few positive cells in both conditions to allow for meaningful quantification. Together, these results indicate that Gpc4 loss-of-function promotes the specification toward the DA lineage rather than promoting differentiation globally.
We next analyzed the expression dynamics of midbrain DA neuron markers in Gpc4gt−1cultures. Nurr1 displayed increased mRNA levels in Gpc4gt−1 cells until 10 DIV and became undetectable at 12 DIV (Fig. 1D), thus showing similar dynamics as in the control situation, but at higher absolute levels. Interestingly, DDC, the last enzyme in the DA biosynthesis pathway, was strongly expressed in Gpc4gt−1-derived cultures, whereas wt cells never expressed detectable mRNA levels (Fig. 1E). Finally, the DAT was strongly induced from 10 DIV in mutant cells but not detected in wt cultures (Fig. 1F). Thus, decreased expression of Gpc4 in differentiating ES cells leads to increased neuronal differentiation (Fico et al., 2012) and a strong shift toward the mature DA neurotransmitter phenotype, even in the absence of factors, such as SHH and FGF8, that are normally added to trigger DA differentiation (Ye et al., 1998).
As Gpc4gt−1 ES cells (1) generate mature dopaminergic neurons in vitro and (2) reduce tumor formation after flank transplantation in nude mice (Fico et al., 2012), we assessed Gpc4gt−1 cell transplants in a rodent model of PD. Hemi-parkinsonian rats were generated by unilateral injection of 6-OHDA in the substantia nigra pars compacta. Five weeks later, we transplanted GFP-labeled wt versus Gpc4gt−1 ES cells at low doses in the ipsilateral striatum using a embryonic body based protocol (Björklund et al., 2002). To challenge Gpc4gt−1 cells, we intentionally chose this minimal protocol because it results in teratoma formation and induces only weak behavioral improvements. At the time of brain transplantation, control and mutant cells still expressed pluripotent cell markers, such as nanog, but no neural differentiation markers, such as nestin (data not shown). Four of seven rats grafted with wt ES cells died within 6 weeks after transplantation, the scheduled endpoint of this experiment. Lethality peaked between 30 and 39 d post grafting (dpg; Fig. 2B). In contrast, only one Gpc4gt−1-grafted animal died before the end of the experiment (day 31; Fig. 2B).
We measured the motor improvements in grafted rats using the cylinder test and amphetamine induced rotation behavior (Björklund and Isacson, 2002). Tests were performed on three groups: nongrafted, wt-grafted, and Gpc4gt−1-grafted rats (Fig. 2C). The cylinder test was performed before lesion, after the lesion, and at two different time points after grafting in wt- and Gpc4gt−1-grafted rats. In the cylinder test, nongrafted hemi-parkinsonian rats lost the ability to use their contralateral forepaw, inducing a dramatic decrease in double contacts on the cylinder walls (prelesioned: 78 ± 2% double contacts; postlesioned/nongrafted: 13 ± 3%). At 18 dpg, lesioned animals transplanted with wt cells were indistinguishable from nongrafted controls. However, at 6 weeks after grafting, use of the left paw improved in this group (nongrafted: 11 ± 3%; wt-grafted: 34 ± 1%). Importantly, rats grafted with Gpc4gt−1 cells showed significant improvement already at 18 dpg (37 ± 4%) and the effect further increased, reaching 58 ± 3% of double contacts 6 weeks after transplantation (Fig. 2C).
Animals of two independent transplantation experiments were scored for amphetamine-induced rotations at the endpoint of the experiment (Fig. 2D). Analysis of the lesioned/nongrafted and of the lesioned/wt-grafted animals showed no significant change in net ipsilateral rotations, although there was a tendency toward improvement (sham: 12.4 ± 0.8 rotations/min, wt-grafted: 4.8 ± 1.4 rotations/min; Fig. 2D). Importantly, Gpc4gt−1-grafted animals displayed a highly significant reduction in ipsilateral rotations compared with lesioned/nongrafted (Gpc4gt−1-grafted: 1.3 ± 0.9 rotations/min; Fig. 2D). In conclusion, transplantation of Gpc4gt−1 ES cells in a PD context was associated with strongly decreased lethality and was beneficial for motor functions.
We investigated size and cellular composition of the transplanted tissue. Generally, graft area was smaller in animals that received Gpc4gt−1 ES-derived cells, although there was considerable heterogeneity (Fig. 3A). In wt cell-grafted animals, graft area was positively correlated with premature death before sacrifice (Fig. 3A). In contrast, only one of the Gpc4gt−1 ES cell-grafted animals died within 6 weeks of transplantation (Fig. 2B). Hematoxylin/eosin staining demonstrated that all wt grafts showed the typical morphological array and dense structures indicative of teratomas (Lensch et al., 2007), whereas the Gpc4gt−1 grafts showed rather homogeneous morphology and displayed no obvious signs of teratoma-like structures (Fig. 3B). Moreover, expression of nestin, a marker of immature neural cell types (Tohyama et al., 1992), was observed in all grafts, but staining was considerably stronger in wt cells (Fig. 3C). Thus, transplantation of Gpc4 hypomorphic cells strongly limited the occurrence of teratoma-like structures, which were likely the reason for augmented premature death in controls.
We then focused on the TH+ cells in the grafts. Importantly, Gpc4gt−1 grafts displayed a sevenfold increase in TH+ cells compared with wt (wt grafts: 16.5 ± 5.1 cells/mm2; mutant grafts: 117.2 ± 27.6 cells/mm2; Fig. 4A,B). We immunohistochemically characterized the phenotypes of TH+ neurons in grafts. FoxA2 and Pitx3, involved in ventral midbrain dopaminergic neuron production (Nunes et al., 2003), were both expressed in most TH+ neurons in grafts of wt and Gpc4gt−1 origins (Fig. 4C,D). In contrast, calbindin, a protein enriched in ventral tegmental area (Thompson et al., 2005), was decreased in dopaminergic neurons derived from Gpc4gt−1 grafts (Fig. 4C,D), suggesting that dopaminergic neurons in Gpc4gt−1 grafts were preferentially of the substantia nigra subtype. Importantly, DAT was exclusively expressed in TH+ neurons in Gpc4gt−1 grafts (Fig. 4B,C), reminiscent of the in vitro situation (Fig. 1). In addition, most TH+ neurons in the Gpc4gt−1 cell grafts coexpressed the DRD2 (Fig. 4E; DRD2/(TH + DRD2): 89 ± 2%), suggesting that they are capable of autoregulation. Indeed, activation of D2 autoreceptors is known to tune DA synthesis, release, and uptake as well as dopamine neuron firing. Finally, contribution of GABA and 5-HT-positive neurons to the Gpc4gt−1 grafts was minor with respect to TH (GABA/(TH + GABA): 8.8 ± 0.4%; 5-HT/(TH + 5-HT): 11.4 ± 1.7%; Figure 4F,G).
In conclusion, decreased levels of Gpc4 increased the level of mature midbrain dopaminergic neurons after transplantation into the dopamine-depleted striatum.
Discussion
Our data suggest that interfering with Gpc4 expression or function could represent a powerful strategy to increase the efficiency and safety of cell transplantation in PD. Cultured Gpc4 hypomorphic ES cells show a strong tendency to differentiate into cells with properties of mature DA neurons. Moreover, in vivo grafted Gpc4gt−1 cells show augmented differentiation into TH+ neurons with molecular features of midbrain DA neurons and improve recovery of motor functions in a rat model of PD. Importantly, knockdown of Gpc4 decreases the formation of teratoma-like structures and increases animal survival.
Our data indicate that Gpc4 depletion enhances DA neuron fate commitment in vitro and in vivo. Further studies will clarify whether loss of Gpc4 activity impacts also on the development of other neuronal cell types and whether distinct culture conditions could promote the capability of Gpc4 mutant cells to develop into DA neurons. Mechanistically, glypicans can interact with several signaling pathways, such as Wnt, SHH, FGFs, and BMPs, and they function either as positive or negative regulators of these signaling pathways depending on the cellular context (Galli et al., 2003; Fico et al., 2011). We have recently shown that Gpc4 maintains mouse ES cell self-renewal by positively modulating Wnt/β-catenin signaling (Fico et al., 2012). Both the canonical (Wnt/β-catenin) and noncanonical (Wnt/PCP) Wnt pathways have been implicated in midbrain DA neuron generation in vivo (Castelo-Branco and Arenas, 2006). In particular, Wnt5a deficiency induces premature Nurr1 expression and a transitory increase in DA neurons in the ventral midbrain (Andersson et al., 2008). In ES cells, blocking the Wnt canonical signaling increases neural induction and dopaminergic differentiation (Cajánek et al., 2009). Thus, it is possible that fine-tuning of Wnt signaling by Gpc4 might be a regulatory mechanism controlling the generation of midbrain DA neurons in vitro and/or in vivo.
Independent of the mechanisms by which the loss of Gpc4 increases midbrain-like DA neurons, we show that reduction of Gpc4 signaling permits enhancement of DA neuron differentiation from ES cells without adding any exogenous factor, both in vitro and in vivo in a 6-OHDA rat model of PD. Moreover, at the functional level, Gpc4 hypomorphic cell-grafted rats showed strong relief of the lesion-induced motor dysfunction not only in the amphetamine-induced rotation test but also in the cylinder test, a nondrug induced test for akinesia-like deficits that is considered very stringent.
Finally, we find reduced cell overgrowth by Gpc4 hypomorphic grafts. Even the one animal in this group showing a large graft area (Fig. 3A) showed no signs of teratogenesis and survived until the end of the experiment. This is in agreement with previous work showing that Gpc4 hypomorphic ES cells do not generate teratomas after injection in the flank of nude mice (Fico et al., 2012). Thus, control of Gpc4 may represent a means to reduce ES cell tumorigenic features while at the same time increasing neuronal features. Because Gpc4 is a cell surface protein, it appears as an attractive target to design drugs that improve security and functional improvement in PD cell therapeutic approaches.
Footnotes
This work was supported by Fondation pour la Recherche Médicale (Equipe FRM), Agence Nationale de la Recherche (ForDopa), Fondation de France (Committee Parkinson), European Commission (IAPP Dopanew) to H.C., FIRB-Mertit-N-RBNE08LN4P-002, FIRB International 2006RBIN062YH4 to A.F., Fondation pour la Recherche Médicale, Fondation Bettencourt-Schueller to F.M., and SATT Sud Est-Accelerator of Technology Transfer, Association France Parkinson, Fondation de France (Committee Parkinson), AFM-Téléthon, COST Action CM1106, and Stemchem to R.D. We acknowledge the France-BioImaging/PICsL infrastructure (ANR-10-INSB-04-01). We thank G. Luxardi for contribution at the initial stage of this project and G. Millet for technical assistance and the IBDML imaging and animal house platforms.
The authors declare no competing financial interests.
- Correspondence should be addressed to either Dr. Rosanna Dono or Dr. Harold Cremer, Aix-Marseille University, Centre National de la Recherche Scientifique, Marseille, IBDM, UMR7288, Marseille, France, rosanna.dono{at}univ-amu.fr or harold.cremer{at}univ-amu.fr