Article Figures & Data
Figures
- Figure 1.
Locomotor defects of C. elegans models of ALS and their modification by the loss of ERAD and UPS genes. A, Pronounced defects in locomotion were seen in the animals overexpressing mutSOD1, wtTDP-43, and mutTDP-43 in the nervous system in comparison with N2 (WT) (F(4,20) = 36.75, p < 0.0001). *p < 0.05 (Dunnett's multiple-comparison test). ****p < 0.001 (Dunnett's multiple-comparison test). B, Locomotion of mutTDP-43 animals in the background of various mutant ERAD and UPS alleles. Average speed of animals of indicated genotypes in a 30 s forced swimming assay in M9. Both suppressors and enhancers were found. No change, There was no significant change in the locomotor deficit of that background (p > 0.05, Student's t test). Enhancer, There was a significant decrease in the average speed of the animals (p < 0.05, Student's t test). Suppressor, There was a significant increase in the average locomotor speed of those animals (p < 0.05, Student's t test). cdc-48.1 (tm544); cdc-48.2 (tm659) mutants are synthetic lethal; therefore, the effect of both mutants together cannot be tested in this study. C, Loss of rad-23 and ufd-2 suppresses mutTDP-43 toxicity likely via independent pathways. Average speed of animals of indicated genotypes in a 30 s forced swimming assay in M9. A one-way ANOVA reveals group differences in the average speed of mutTDP-43, mutTDP-43; rad-23 (tm3690), mutTDP-43; ufd-2 (tm1380), and mutTDP-43; rad-23 (tm3690); ufd-2 (tm1380) (F(3,16) = 13.41; p = 0.0001). *p < 0.05. ****p < 0.001. D, Loss of rad-23 and ufd-3 suppresses mutTDP-43 toxicity via likely independent pathways. Average speed of animals of indicated genotypes in a 30 s forced swimming assay in M9. A one-way ANOVA reveals group differences in the average speed of mutTDP-43, mutTDP-43; rad-23 (tm3690), mutTDP-43; ufd-3 (tm2915), and mutTDP-43; rad-23 (tm3690); ufd-3 (tm2915) (F(3,16) = 60.55; p < 0.0001). *p < 0.05. **p < 0.01. ****p < 0.001.
- Figure 2.
Loss of rad-23 in C. elegans protects against models of ALS via an effect in the nervous system. A, Schematic of C. elegans RAD-23 gene with predicted protein shown. Lines indicate areas with insertions and/or deletions in the used mutants. B, C, Loss of rad-23 (tm2595) (B) or (tm3690) (C) causes a twofold suppression in the locomotor deficit of mutTDP-43 but has no effect on wtTDP-43 (p = 0.108 for tm2595 and p = 0.473 for tm3690). D, E, Loss of rad-23 (tm2595) (D) or (tm3690) (E) leads to a twofold suppression in the locomotor deficit of mutSOD1 animals but has no effect on the wtSOD1 animals (p = 0.615 for tm2595 and p = 0.274 for tm3690). F, Neither rad-23 allele is different from WT speed in the swimming assay. F(2,12) = 0.006579; p = 0.9934. G, mutSOD1 fed rad-23 RNAi for two generations shows no change (p = 0.7748), but mutSOD1; sid-1; Punc-119::SID-1 animals show a significant improvement in the swimming assay. H, Outcrossing the rad-23 (tm3690) allele from mutTDP-43; tm3690 leads to a rescue of the mutTDP-43 locomotor deficit. I, Overexpression of RAD-23 in the nervous system of mutTDP-43; rad-23 (tm3690) is sufficient to rescue the mutTDP-43 locomotor deficit. J, There is no change in the average locomotor speed of the mutTDP43 animals when RAD-23 is overexpressed in the nervous system using the Punc-119 promoter (F(5,24) = 1.112; p = 0.3801). *p < 0.05 (Student's t test). **p < 0.01 (Student's t test). ***p < 0.005 (Student's t test). ns, Not significant.
- Figure 3.
Loss of rad-23 in C. elegans protects against neurodegeneration following expression of mutTDP-43 in vivo. We generated animals with GABAergic motor neurons labeled with GFP using Punc-25::GFP in WT (N2; “control”), mutTDP-43, and mutTDP-43; rad-23 (tm3690) backgrounds. A, Loss of rad-23 reduces the percentage of C. elegans with mutTDP-43 that display broadening of axons. B, mutTDP-43 causes an increase in the number of gaps within the ventral nerve cord of animals compared with control. ***p < 0.005 (Dunnett's multiple-comparison test following one-way ANOVA). ns, Not significant. Loss of rad-23 reduces the number of ventral nerve cord gaps in the mutTDP-43 animals to WT. There is no significant difference in the number of gaps in mutTDP-43; rad-23 animals compared with control (WT). C, Representative images of WT, mutTDP-43, and mutTDP-43; rad-23 (tm3690) animals labeled with Punc-25::GFP.
- Figure 4.
RAD-23 protein is expressed throughout the worm, including the worm nervous system. A–C, A RAD-23 protein translational fusion with GFP driven by the endogenous rad-23 promoter (PRAD-23::RAD-23::GFP) is expressed throughout the worm in young adult animals. D, RAD-23 protein is expressed in the cell body and processes of a mechanosensory neuron (arrowhead), (E) vulva of the worm, (F) nerve cord (arrowhead), and (G) the head.
- Figure 5.
Loss of RAD-23 in C. elegans protects against aging decline and proteotoxicity. A–D, Biomechanical profiling of N2 (WT) and rad-23 (tm3690) animals (n ≥ 10/group). There is no difference between WT and rad-23 (tm3690) in speed (A), force (B), and power (C) at L4 through 3 d after L4. At 4 and 5 d after L4, rad-23 animals perform better in speed (A), force (B), and power (C) measurements than WT. D, Rad-23 animals show a more coordinated biomechanical profile at 5 d after L4 than WT. E, The lifespan of rad-23 animals is extended by 22.2% compared with WT on tunicamycin (p < 0.0001), but the lifespans of WT and rad-23 are identical on vehicle (p = 0.646). F, Rad-23 animals show an ∼25% lifespan extension during heat stress compared with WT (p < 0.0001). G, There are no group differences in survival among WT, wtTDP-43, mutTDP-43, wtSOD1, and mutSOD1 with increasing doses of UV irradiation (F(4,15) = 0.1285; p = 0.9697). There are group differences among WT, rad-23 (tm2595 and tm3690), and mutTDP-43 and mutSOD1 in the rad-23 (tm3690) background (F(6,21) = 2.961, p < 0.05). As predicted, loss of rad-23 (tm2595 and tm3690) causes a hypersensitivity to UV stress compared with WT animals (p < 0.001). MutTDP-43 and mutSOD1 in the loss of rad-23 background show a synthetic hypersensitivity to UV stress (p < 0.001). *p < 0.05 (Student's t test). **p < 0.01 (Student's t test). ***p < 0.005 (Student's t test). ****p < 0.001 (Student's t test).
- Figure 6.
Loss of rad-23 does not suppress the C. elegans mutTDP-43 locomotor deficit via known pathways. Loss of (A) png-1 (cy9), or (B) xpa-1, or (C) ercc-1 (C), or (D) csb-1 does not protect against the locomotor deficit caused by mutTDP-43 in the swimming assay (p > 0.05, Student's t test). One representative experiment is shown. Description of alleles: ok698, 913 bp deletion; tm2073, 804 bp deletion; ok2335, 1620 bp deletion; cy9, single nucleotide polymorphism. n.s, Not significant.
- Figure 7.
Knockdown of RAD-23 orthologs in mammalian motor neurons protects against toxicity of SOD1 or TDP-43. A–E, hR23A or hR23B miRNA knocks down endogenous target in HEK293 cells (n = 3/group) but does not knock down the expression of a cotransfected GFP plasmid. *p < 0.05. **p < 0.01. F, HSV infection of miRNA to hR23A or hR23B in mixed spinal cord cultures leads to specific knockdown of target protein compared with control. G, Infection of mixed spinal cord cultures with LacZ or an hR23A, hR23B, or control miRNA has no effect on motor neuron survival (F(3,12) = 0.8132, p = 0.3166). Knockdown of hR23A or hR23B protects against motor neuron death caused by wtSOD1 (F(3,12) = 17.39, p = 0.0001) and mutSOD1 (F(3,12) = 54.64, p < 0.0001). mutSOD1 infection causes a greater degree of motor neuron death than wtSOD1 (p = 0.0078). H, Infection of mixed spinal cord cultures with LacZ or a scrambled, hR23A, or hR23B miRNA has no effect on motor neuron survival (F(3,12) = 0.8875, p = 0.2100). Knockdown of hR23A or hR23B protects against motor neuron death caused by wtTDP-43 (F(3,12) = 16.66, p = 0.0001) and mutTDP-43 (F(3,12) = 48.07; p < 0.0001). **p < 0.01. ***p < 0.005. ****p < 0.001. ns, n.s, Not significant. MutTDP-43 infection causes a greater degree of motor neuron death than wtTDP-43 (p = 0.0255). I, Representative bright-field images of mixed spinal cord cultures infected as indicated stained for SMI-32 motor neuron marker. Coinfection of mutSOD1 cultures with HSV-miRNA to hR23A or hR23B increases motor neuron survival. J, Knockdown of hR23A or hR23B protects against motor neuron death caused by mutSOD1 (F(2,6) = 13.99, p = 0.0055) but has no effect on survival in motor neurons infected with LacZ (F(2,6) = 4.745, p = 0.0581) in cultures treated with vehicle. Knockdown of hR23B protects cultures infected with HSV-LacZ (F(2,6) = 11.82, p = 0.0083) or HSV-mutSOD1 (F(2,6) = 101.9, p < 0.0001) from toxicity of ER stress induced with tunicamycin.
- Figure 8.
hR23A expression is increased in the spinal cord of mutSOD1 mice at P90 and P120. A, B, Representative Western blot (A) and quantification (n = 3–5/group) (B) of hR23A expression in the spinal cord and brain of age-matched males. hR23A expression is increased in the spinal cord of mutSOD1 mice compared with WT (C57BL6) at P90 and P120, but not at P60. C, D, Representative Western blot (C) and quantification (n = 3–5/group) (D) of hR23B expression in the spinal cord and brain of age-matched males. There is no change in hR23B expression in the spinal cord or brain at P60, P90, or P120. *p < 0.05 (Student's t test). **p < 0.01 (Student's t test).
- Figure 9.
Manipulations of RAD-23 expression change TDP-43 and SOD1 abundance and solubility. A, Representative Western blots of the total amount of wtTDP-43 and mutTDP-43 following overexpression or knockdown of hR23A or hR23B. B, The quantification of the amount of total wtTDP-43 or mutTDP-43 following overexpression or knockdown of hR23A or hR23B. There is an ∼90% decrease (p < 0.005) in the abundance of mutTDP-43 following knockdown of hR23A or hR23B. C, There is no change in the amount of hTDP-43 mRNA normalized to actin in HEK293 cells following hR23A or hR23B knockdown (n = 3/group). hTDP-43 mRNA from untransfected cells was subtracted from all values. D, Representative Western blots of wtTDP-43 or mutTDP-43 expression for the indicated time points following CHX treatment with either a control or hR23A miRNA. F(2,8) = 0.1380; p = 0.8732. E, Quantification (n = 4 independent experiments) of percentage of starting wtTDP-43 or mutTDP-43 remaining. F, Representative Western blots of wtSOD1 or mutSOD1 expression for the indicated time points following CHX with either a control or hR23A miRNA. G, Quantification (n = 3 independent experiments) of percentage of starting wtSOD1 or mutSOD1 remaining. H, I, Knockdown of hR23A further reduces percentage of starting mutTDP-43 remaining after 270 min of CHX (n = 3 independent experiments). *p < 0.5. H, Representative Western blot and (I) quantification of mutTDP-43 remaining after 270 min of CHX in the presence of the indicated miRNA. J, Western blot image; hR23A miRNA knocks down endogenous hR23A compared with control miRNA but does not knock down RNAi-resistant hR23A (hR23Ares) cDNA. hR23B miRNA knocks down endogenous hR23B compared with control miRNA but does not knock down RNAi-resistant hR23B (hR23Bres) cDNA. K, Cotransfection of an hR23A or hR23B miRNA dramatically decreases total mutTDP-43 protein compared with control. This is blocked by cotransfection with hR23Ares or hR23Bres cDNA. L, Representative Western blot of CPY*-GFP expression for the indicated time points following CHX treatment with indicated miRNA. *p < 0.05 (Student's t test). **p < 0.01 (Student's t test).
- Figure 10.
Reducing R23 abundance accelerates SOD1 and TDP-43 turnover in MEFs and primary spinal cord neurons. A, Amount of mutTDP-43 remaining is reduced after 180 min of CHX in hR23A- and hR23B-null MEFs compared with WT. B, WT or hR23B-null (hR23B−/−) MEFs were cotransfected with mutTDP-43 construct and LacZ or full-length (FL) hR23B construct. Media was changed 24 h later, and cells were replated at equal densities another 24 h later. CHX was then added 24 h after replating for the indicated periods of time. Samples were processed for Western blot and probed with myc and actin antibodies. C, Representative Western blot of wtSOD1 and mutSOD1 abundance in neurons after 0 and 180 min of CHX. Mixed rat spinal cord culture neurons were infected with HSV to express wtSOD1 or mutSOD1 along with HSV expressing the hR23A, hR23B, or control miRNA. D, Representative Western blot of wtTDP-43 and mutTDP-43 abundance in neurons after 0 and 180 min of CHX. Mixed rat spinal cord culture neurons were infected with HSV to express wtTDP-43 or mutTDP-43 along with HSV expressing the hR23A, hR23B, or control miRNA.
- Figure 11.
Inhibition of the proteasome and autophagy blocks the enhanced clearance of mutTDP-43 by loss of RAD-23. A, Timeline of CHX experiment performed with inhibitors. HEK293 cells were transfected with mutTDP-43 and hR23A, hR23B, or control miRNA. CHX was added for 4.5 h and indicated drug was added 30 min after CHX. B, Representative Western blots for +hR23B miRNA experiment. Treatment with MG-132, epoxomicin, or 3-MA blocks the clearance of mutTDP-43 seen after 270 min of CHX treatment in the vehicle (DMSO) group. C, Quantification of Western blots. Treatment with MG-132, epoxomicin (“epox”), and 3-MA blocked the turnover of mut-TDP43 by ∼25%. n = 5 independent experiments for +scrambled miRNA; n = 3 independent experiments for +hR23A miRNA; n = 3 independent experiments for +hR23B miRNA. F(8,20) = 3.156; p = 0.0176. *p < 0.05. **p < 0.01. D, Total polyubiquitinated (polyUb) substrate load in indicated MEF lines following −MG-132 (DMSO) or +MG-132 treatment for 12 h. MG-132 induction ratio: +MG-132/−MG-132 (all normalized to actin). E, F, Representative Western blot of polyUb-mutTDP-43 following immunoprecipitation (IP) of myc-wtTDP-43 (E) or myc-mutTDP-43 (F) in HEK293 cells cotransfected with hR23A, hR23B, or control miRNA. Knockdown of hR23A or hR23B inhibits the ubiquitination of mutTDP-43 but has no effect on the ubiquitination status of wtTDP-43. G, Representative Western blot showing total polyUb-load in HEK293 cells transfected with mutTDP-43 and indicated miRNA. Cells were treated with DMSO (−MG-132) or MG-132 (+MG-132) 12 h before cell lysis as indicated. H, Myc-mutTDP-43 was immunoprecipitated and immunoblotted for ubiquitin and myc; representative Western blot is shown. I, Quantification (n = 3 independent experiments) of Western blots shown in H. Data were normalized to average +control miRNA condition. There is an increase in ubiquitinated mutTDP-43 and its flux through the proteasome following RAD-23 knockdown.
- Figure 12.
Loss of rad-23 reduces TDP-43 and SOD1 insolubility. A, Representative Western blot of hTDP-43 protein abundance following a sequential detergent extraction of C. elegans overexpressing mutTDP-43 in WT or rad-23 backgrounds. Loss of rad-23 causes a shift of TDP-43 to a more soluble (TX) fraction over insoluble (SARK, UREA) fractions. B, There is a decrease of phospho-TDP-43 in the loss of rad-23 background in soluble and insoluble fractions in C. elegans. C, Total wtTDP-43 levels are indistinguishable in the loss of rad-23 (tm3690) background compared with the control WT TDP-43 background in C. elegans. D, Representative Western blot showing that there is an increase in the abundance of insoluble mutTDP-43 in HEK293 cells following cotransfection with the hR23A cDNA. E, qPCR (n = 3/group) measuring hTDP-43 mRNA abundance normalized to tba-1 in indicated C. elegans strains. #Undetected. **p < 0.01. ***p < 0.01. F, Rad-23 (tm3690) and ufd-2 (tm1380) cause an additive effect in reducing mutTDP-43 and phosophorylated-TDP43 abundance in C. elegans. G, H, FRAP on mutSOD1-YFP aggregates within the C. elegans nervous system. mutSOD1-YFP has a higher rebound with loss of rad-23 (tm3690). G, Representative images of FRAP assay. H, Quantification of FRAP (n = 14/group). *p < 0.05. Data are normalized to starting fluorescence intensity.
- Figure 13.
hR23A and hR23B are aberrantly expressed in human ALS tissue. A, B, There is mislocalization of hR23A and hR23B in motor neurons of the spinal cord in ALS cases. A, Representative images of motor neurons within the gray matter of spinal cord from control and ALS cases. Insets within ALS Case 2, Granular cytoplasmic and nuclear staining often found in ALS cases. B, Distribution of hR23A and hR23B cytoplasm and nuclear staining found in control (n = 9) and ALS cases (n = 12). C, There is an increase in hR23A and hR23B protein expression in ALS (n = 5) spinal cord sections compared with controls (n = 5). **p < 0.01 (Student's t test). D, Proposed model. Loss of rad-23 destabilizes aggregates, allowing them to become more soluble and more easily degraded.
Tables
Mammalian gene Worm gene Putative function Mutant available Mutation description Comment EDEM1 C47E12.3 Glycosylhydrolase-47 family ok2898 378 bp deletion EDEM2 F10C2.5 Glycosylhydrolase-47 family tm6057 563 bp deletion Affects >1 gene OS9 Y105E8A0.2 Inspects client proteins for terminal α1,6 linked mannose tm5511 517 bp deletion TEB4 F55A3.1 DOA10 ligase component gk218188 Introduces stop codon mid-gene Erasin ZK353.8 DOA10 ligase component tm3247 323 bp deletion Tested HRD1 F55A11.3 E3 ubiquitin ligase tm1743 473 bp deletion + 38 bp insertion HRDL-1 F26E4.11 E3 ubiquitin ligase gk28 1981 bp deletion Derlin-1 F25D7.1 HRD ligase component; retrotranslocon tm2839 224 bp deletion Tested Derlin-2/Derlin-3 R151.6 HRD ligase component tm5861 499 bp deletion RNF5 C16C10.7 RMA1 ligase tm794 647 bp deletion p97 (VCP) C06A1.1 Extractor tm544 688 bp deletion Tested p97 (VCP) C41C4.8 Extractor tm659 639 bp deletion Tested UFD-2 T05H10.5 p97 (VCP) cofactor tm1380 915 bp deletion Tested UFD-3 C05C10.6 p97 (VCP) cofactor tm2915 747 bp deletion Tested RAD-23 ZK20.3 Proteasome adaptor tm3690; tm2595 432 bp deletion; 677 bp deletion + 28 bp insertion Tested UBQLN-2 F15C11.2a Proteasome adaptor tm1574 755 bp deletion Tested ↵aThere are ∼25 ERAD genes predicted to be conserved in C. elegans. Of these, viable mutants are available in many and were used in a candidate gene approach to identify novel modifiers of mutTDP-43 toxicity in C. elegans. Several conserved mammalian ERAD genes in the nematode have no mutants available at the time of this study, including the following: Ubc14 (Y87G2A0.9); Ube2K (F40G9.3); Ube2G (F58A4.10.1); ERManI (T03G11.4); Npl4 (F59E12.5); Ufd-1 (F19B6.2a); Ube2J1/Ube2J2 (D1022.1a); and Ube2G2 (Y87G2A0.9).
- Table 2.
A list of the C. elegans strains used in this study and their corresponding informationa
Strain name Coinjection marker Description RK65 NA tm3690 RK66 NA tm2595 RK67 NA mutTDP-43 (M337V); RK65 (tm3690) RK68 NA mutTDP-43 (M337V); RK66 (tm2595) RK69 NA wtTDP-43; RK65 (tm3690) RK70 NA wtTDP-43; RK66 (tm2595) RK71 NA mutSOD (G85R); RK65 (tm3690) RK72 NA mutSOD (G85R); RK66 (tm2595) RK73 NA wtSOD; RK65 (tm3690) RK74 NA wtSOD; RK65 (tm3690) RK75 NA mutTDP-43 (M337V); png-1 (cy9) RK76 NA mutTDP-43 (M337V); xpa-1 (ok698) RK77 NA mutTDP-43 (M337V); csb-1 (tm2073) RK78 NA mutTDP-43 (M337V); ercc-1 (ok2335) RK79(rkEx1) None PRAD23::RAD23::GFP (fosmid injected at 5 ng/μl) RK80 NA tm2909 RK81 NA tm1574 RK82 NA tm2915 RK84 NA tm544 RK85 NA tm3247 RK86 NA mutTDP-43 (M337V); RK81 (tm1574) RK87 NA mutSOD (G85R); RK81 (tm1574) RK88 NA mutTDP-43 (M337V); RK82 (tm2915) RK91 NA mutTDP-43 (M337V); RK84 (tm544) RK92 NA mutTDP-43 (M337V); RK85 (tm3247) RK93 NA RK88; RK65 mutTDP-43 (M337V); tm2915; tm3690 RK94 NA mutTDP-43 (M337V); tm1380 RK95 NA RK94; RK65 mutTDP-43 (M337V); tm1380; tm3690 RK96 NA tm659 RK97 NA mutTDP-43 (M337V); tm659 OG695(drEx230) Punc-119::GFP mutTDP-43 (M337V); (injected at Punc-119::RAD23::unc54 3′UTR–LINE1 100 ng/μl) (construct injected at 30 ng/μl) OG696(drEx231) Punc-119::GFP mutTDP-43 (M337V); (injected at Punc-119::RAD23::unc54 3′UTR–LINE2 100 ng/μl) (construct injected at 30 ng/μl) OG697(drEx232) Punc-119::GFP mutTDP-43 (M337V); (injected at Punc-119::RAD23::unc54 3′UTR–LINE3 100 ng/μl) (construct injected at 30 ng/μl) OG692(drEx227) Punc-119::GFP mutTDP-43 (M337V); rad23 (tm3690); (injected at Punc-119::RAD23::unc54 3′UTR–LINE1 100 ng/μl) (construct injected at 30 ng/μl) OG693(drEx228) Punc-119::GFP mutTDP-43 (M337V); rad23 (tm3690); (injected at Punc-119::RAD23::unc54 3′UTR–LINE2 100 ng/μl) (construct injected at 30 ng/μl) OG694(drEx229) Punc-119::GFP mutTDP-43 (M337V); rad23 (tm3690); (injected at Punc-119::RAD23::unc54 3′UTR–LINE3 100 ng/μl) (injected at 30 ng/μl) ↵aAll strains used in this set of studies were backcrossed to ancestral N2 5 times. NA, Not applicable.
Gene Allele Primer (5′-3′) (upper/lower) rad-23 tm2595 caggatggttttgtccgttac acatgcgaaataagcctccac tm3690 aaggcgatgaatacacattcttgg atcgataacctggatgagggatgg ufd-3 tm2915 ttttgggcaatagatggaggc aaatgcccgagcttctgg ufd-2 tm1380 tacttggagagccaacttcgc acaaaatccatagaagatgcc cdc-48.1 tm544 ttccacgtggtggcttgatac aacccgcattcacgtgctc derlin-1 tm2909 ttccatcttgaccgtgaatacc atatctacttccttctcgaaccg ubxn-4 tm3247 acatgtttgtcggcctctcg aactttcaacacctagtcc ubql-1 tm1574 gcatattgaagctcgcgcg acggtgatttcacgtgaac xpa-1 ok698 gaccgttgagcttattgcag taacttgttgtggccatgcg csb-1 ok2335 gaagactgatcatcggagcg ggctgggggattcaaattat ercc-1 tm2073 ttcggtgtcgtctatctcag tttttgcgacatccctggcg png-1 cy9 gtcgataattttaccgaattttccac tatctccaagtgacgtcaaccac ↵aAll of the primers used in genotyping the C. elegans strains used in this study. Further information is available upon request.
ALS sALS or fALS Case description Age (yr)/sex Approximate symptom duration (mo) Autopsy interval (h) hR23A cytoplasm pattern hR23A nucleus pattern hR23B cytoplasm pattern hR23B nucleus pattern Case JH83 fALS SOD1 N193K Onset: left leg 50/M 74 14.5 Strong deposits Strong staining Strong deposits Punctate staining JH43 fALS SOD1 A4V Onset: LE/left leg 55/M 21 Unknown Reticular Punctate staining Weak deposits Strong staining JH74 (ALS Case 2 in Fig. 12) fALS SOD1 A4V
Bulbar onset47/M 15 18.5 Strong and weak deposits Strong staining Strong and weak deposits Punctate staining JH82 sALS Onset: LE/left leg 66/M 43 13 Absent Strong staining Weak deposits Punctate staining JH73 sALS Onset: LE/left foot 70/F 36 8 Strong deposits Strong staining Punctate and strong deposits Strong staining JH86 FTD + fALS (C9ORF72+) Onset: legs/cognition 74/M ∼84 32 Strong deposits Strong staining Strong deposits Weak staining JH79 sALS Bulbar onset 70/F 28 12 Strong deposits Strong staining Strong deposits Strong straining JH22 fALS (C9ORF72+) Onset: UE/left arm 66/M 22 6 Punctate throughout Punctate staining Absent Strong staining JH49 sALS Onset: UE/right hand 68/F 70 4 Strong and weak deposits Weak staining Weak deposits Punctate staining JH88 FTD + fALS (C9ORF72+) Bulbar onset 59/M 20 10 Reticular Weak staining Strong and weak deposits Weak staining JH07 (ALS Case 1 in Fig. 12) sALS (C9ORF72+) Bulbar onset 67/M 14 8 Strong deposits Weak staining Strong deposits Strong staining JH80 sALS Onset: UE (right) 56/F 50 21 Strong deposits Punctate staining Strong and weak deposits Punctate staining ↵aThe 12 ALS cases from which postmortem spinal cord tissue was taken following autopsy. UE, Upper extremities; LE, lower extremities; sALS, sporadic ALS; fALS, familial ALS (i.e., positive family history). ALS cases in Figure 12C were loaded in Western blot in this order: JH79, JH82, JH74, JH74, JH83.
Control case Age (yr)/sex Cause of death Autopsy interval hR23A cytoplasm pattern hR23A nucleus pattern hR23B cytoplasm pattern hR23B nucleus pattern 23 (Control Case 2 in Fig. 8) 77/M Cardiac failure 6 h Diffuse Light staining Absent Absent 26 49/M Cancer and obesity 4 h Diffuse Absent Some reticular with weak deposits Absent 31 67/M Lung cancer 3.5 h Deposits Absent Weak deposits Absent 37 57/M Cardiac arrest due to ventricular fibrillation 14 h Deposits Some light nuclear staining Diffuse throughout and scattered Absent 42 61/M Brain tumor 6 h Scattered throughout cytoplasm Light staining Deposits Light staining 44 80/F Liver failure 5 h Some weak deposits Light staining Reticular Absent 65 82/M Unknown 4 h Reticular Present Diffuse and reticular Absent 67 77/M Unknown 4 h Reticular Present Deposits Strong staining 78 (Control Case 1 in Fig. 8) 58/F Vasculitis, cerebral hemorrhage, hepatitis C 3 h Reticular Absent Reticular Absent ↵aThe 9 control cases from which postmortem spinal cord tissue was taken following autopsy. Control Case 1 in Figure 12A was 78 and Control Case 2 in Figure 12A was 23. Control cases in Figure 12C were loaded in Western blot in this order: 6, 23, 67, 31, 26.
Substrate RAD-23 manipulation Effect on substrate Platform Reference Arg-β-Gal Overexpression Stabilizes Yeast Ortolan et al., 2000 Rad-4 Overexpression Stabilizes Yeast Ortolan et al., 2004 Ub-Pro-β-Gal Overexpression Stabilizes Yeast Ortolan et al., 2000 Lactalbumin Replacement Stabilizes Ub-depleted reticulocyte extract Raasi and Pickart, 2003 Ub5-DHFR Replacement Stabilizes HEK293T cells Raasi and Pickart, 2003 BCA2 Overexpression Stabilizes U202 and H1299 cells Bacopulus et al., 2012 p53 Overexpression Stabilizes U202 cells Brignone et al., 2004 p53 Loss of function (hR23A and hR23B) Destabilizes U202 cells Brignone et al., 2004 Ub-Pro-β-Gal Loss of function Stabilizes Δrad23 yeast Lambertson et al., 1999 UbV76-V-β-gal Loss of function Stabilizes Δrad23 yeast Rao et al., 2002; Kim et al., 2004 Sic1 Replacement Destabilizes Proteasomes purified from Δrad23 yeast Verma et al., 2004 Far1 Loss of function Stabilizes Δrad23 yeast Verma et al., 2004 ↵aSummary of past findings on RAD-23 manipulation and substrate turnover.
