Abstract
The activity of background potassium and sodium channels determines neuronal excitability, but physiological roles for “leak” Na+ channels in specific mammalian neurons have not been established. Here, we show that a leak Na+ channel, Nalcn, is expressed in the CO2/H+-sensitive neurons of the mouse retrotrapezoid nucleus (RTN) that regulate breathing. In RTN neurons, Nalcn expression correlated with higher action potential discharge over a more alkalized range of activity; shRNA-mediated depletion of Nalcn hyperpolarized RTN neurons, and reduced leak Na+ current and firing rate. Nalcn depletion also decreased RTN neuron activation by the neuropeptide, substance P, without affecting pH-sensitive background K+ currents or activation by a cotransmitter, serotonin. In vivo, RTN-specific knockdown of Nalcn reduced CO2-evoked neuronal activation and breathing; hypoxic hyperventilation was unchanged. Thus, Nalcn regulates RTN neuronal excitability and stimulation by CO2, independent of direct pH sensing, potentially contributing to respiratory effects of Nalcn mutations; transmitter modulation of Nalcn may underlie state-dependent changes in breathing and respiratory chemosensitivity.
SIGNIFICANCE STATEMENT Breathing is an essential, enduring rhythmic motor activity orchestrated by dedicated brainstem circuits that require tonic excitatory drive for their persistent function. A major source of drive is from a group of CO2/H+-sensitive neurons in the retrotrapezoid nucleus (RTN), whose ongoing activity is critical for breathing. The ionic mechanisms that support spontaneous activity of RTN neurons are unknown. We show here that Nalcn, a unique channel that generates “leak” sodium currents, regulates excitability and neuromodulation of RTN neurons and CO2-stimulated breathing. Thus, this work defines a specific function for this enigmatic channel in an important physiological context.
Introduction
Neural control of respiration involves a brainstem central pattern generator (CPG) that regulates lung ventilation and gas exchange (Feldman et al., 2013; Smith et al., 2013; Guyenet and Bayliss, 2015). Persistent rhythmic activity of the respiratory CPG requires tonic excitatory input, which is modulated by respiratory feedback and information regarding brain state (Feldman et al., 2013; Smith et al., 2013; Guyenet and Bayliss, 2015).
The tonically active, Phox2b-expressing glutamatergic neurons of the retrotrapezoid nucleus (RTN) are a principal site responsible for integrating feedback/feedforward information for transmission to the respiratory CPG (Feldman et al., 2013; Smith et al., 2013; Guyenet and Bayliss, 2015). Optogenetic activation of RTN neurons stimulates respiratory output (Abbott et al., 2009), whereas optogenetic/chemogenetic inhibition of RTN neurons can abruptly stop breathing (Marina et al., 2010; Basting et al., 2015). In addition, tonic RTN neuron activity is influenced by changes in blood gases and brain pH (i.e., chemosensitivity) (Mulkey et al., 2004; Gourine et al., 2010; Wang et al., 2013a, b; Guyenet and Bayliss, 2015; Kumar et al., 2015), with effects on respiration that are dependent on sleep–wake state (Burke et al., 2015). Patients with congenital central hypoventilation syndrome have mutations in Phox2b and suffer from blunted respiratory chemosensitivity and potentially fatal episodes of hypoventilation during sleep (Amiel et al., 2003; Weese-Mayer et al., 2010); moreover, a mouse genetic model incorporating a common disease-causing polyalanine expansion mutation in Phox2b (Phox2b27Ala/+) phenocopies the congenital central hypoventilation syndrome breathing disturbances, and RTN neurons specifically fail to develop in those mice (Dubreuil et al., 2008; Ramanantsoa et al., 2011).
A dynamic balance of inward and outward current regulates spontaneous discharge in tonically firing neurons. In RTN neurons, background “leak” K+ channels provide a hyperpolarizing current that is regulated by pH to mediate neuronal chemosensitivity (Mulkey et al., 2004; Wang et al., 2013a, b; Kumar et al., 2015). However, the nature of the countervailing background depolarizing current has not been established. In various spontaneously firing neurons, background Na+ currents are mediated by persistent, resurgent, or “window” activity from voltage-gated NaV channels (Raman and Bean, 1997; Taddese and Bean, 2002; Bean, 2007; Koizumi and Smith, 2008; Khaliq and Bean, 2010; Smith et al., 2013), but in some cases TTX-insensitive, voltage-independent background currents have also been described (Raman et al., 2000; Eggermann et al., 2003; Jackson et al., 2004). A potential conduit for such background inward current is Nalcn (Na+ leak channel, nonselective) (Lu et al., 2007, 2009; Ren, 2011; Cochet-Bissuel et al., 2014). Although structurally related to the NaV family of voltage-dependent Na+-selective channels, Nalcn is TTX resistant and forms a voltage-independent, nonselective cation channel that generates a “leak” inward current, carried primarily by Na+ ions under physiological conditions (Lu et al., 2007, 2009; Ren, 2011; Cochet-Bissuel et al., 2014); Nalcn current can be further enhanced by various neuromodulators (Lu et al., 2009; Ren, 2011; Cochet-Bissuel et al., 2014). Notably, global genetic deletion of Nalcn leads to disrupted respiration and early postnatal death in mice (Lu et al., 2007), and patients with Nalcn mutations present with respiratory dysfunction, among other disorders (Al-Sayed et al., 2013; Köroğlu et al., 2013; Cochet-Bissuel et al., 2014; Chong et al., 2015; Gal et al., 2016). A contribution of Nalcn to endogenous currents in respiratory neurons has not been demonstrated.
Here, we used shRNA-mediated knockdown to demonstrate that Nalcn contributes to background Na+ current and excitability in pH-sensitive RTN neurons, and is required for activation of RTN neurons by the neuropeptide substance P (SP). Further, we show that RTN-selective depletion of Nalcn in vivo constrains CO2-induced activation of RTN neurons and blunts respiratory responses to CO2. Thus, these data define a specific physiological role for Nalcn in control of breathing by RTN respiratory integrator neurons.
Materials and Methods
Experiments were performed on mice of either sex, following procedures adhering to National Institutes of Health Animal Care and Use Guidelines and approved by the Animal Care and Use Committee of the University of Virginia. These studies used a Phox2b::GFP BAC transgenic mouse line (Jx99), developed by the GENSAT project and characterized previously (Lazarenko et al., 2009).
Single-cell molecular biology of RTN neurons.
Individual GFP-labeled RTN neurons were harvested for RT-PCR either after acute dissociation or following patch-clamp recording in brainstem slices or slice cultures from neonatal Phox2b::GFP mice (P7-P11), essentially as described previously (Lazarenko et al., 2010; Wang et al., 2013a, b; Kumar et al., 2015). For dissociated RTN neurons, single fluorescent cells were identified in the recording chamber of a fluorescence microscope (Zeiss Axioimager FS) and aspirated into a glass capillary; for RTN neurons functionally characterized by patch-clamp recording, cell contents were aspirated after obtaining whole-cell access. Analysis of multiple genes in single-cell assays used either multiplex nested single-cell RT-PCR (sc-PCR) or multiplex quantitative sc-PCR (sc-qPCR). Intron-spanning, nested primer sets across splice sites for each gene of interest were used in sc-PCRs (for sc-PCR and sc-qPCR primer information, see Table 1). All primer sets were independently validated, and no-template negative controls were included for each reaction. For sc-qPCR, we followed published procedures (Liss, 2002). In brief, we used an iCycler iQ (Bio-Rad) and Bio-Rad iQ SYBR Green Supermix in a 25 μl reaction volume. Specificity of the primers was assessed by generating a melting curve of the PCR product and standard curve; PCR efficiencies were determined for all primer pairs used in sc-qPCR assays (92%–100%). The protocol entailed: denaturation (95°C, 10 min), amplification and quantification (42 cycles: 95°C, 20 s; 60°C, 20 s; 72°C, 20 s), and melt curve analysis (ramp from 55°C to 95°C, 0.5°C increments for 2 s). Cycle threshold (Ct) levels were rescaled by their average and transformed into relative quantities using the amplification efficiency, as described previously (Pfaffl, 2001). The Ct values of test genes were normalized to GAPDH, an internal reference gene.
Virus production.
We used two different viral transduction systems to infect RTN neurons in vitro and in vivo: adeno-associated virus 2 (AAV2) for slice cultures and lentivirus for in vivo studies. For AAV2 production, different Nalcn shRNA hairpin sequences were inserted into a self-complementary AAV targeting construct downstream of an H1 promoter; the vector also provided an mCherry reporter driven by a CMV-synapsin promoter (see Fig. 2). To test knockdown efficiency of each shRNA hairpin, HEK293T cells were cotransfected with the viral targeting construct and a rat Nalcn plasmid that shared the shRNA target sequences (Lee et al., 1999). Knockdown efficiency was evaluated by qRT-PCR (24, 48, and 72 h after transfection) and the most effective shRNA (∼70% knockdown), with its corresponding scrambled control were selected for preparation of high-titer AAV2 virus (1.0 × 1012 transduction units (TU)/ml; Vector Core, University of North Carolina, Chapel Hill, NC). The shRNA hairpin sequences used in this study were previously described (Nalcn shRNA: AAGATCGCACAGCCTCTTCAT; scrambled: GCTCAGTACGATCATACTCAC) (Swayne et al., 2010).
For in vivo experiments, a customized lentivirus targeting vector was prepared (see Fig. 5) that used an artificial PRSx8 promoter to drive the same shRNA hairpin sequence, along with mCherry, selectively in Phox2b-expressing RTN neurons (Hwang et al., 2001; Abbott et al., 2009). With this construct, knockdown was also ∼70% in HEK293T cells coexpressing Nalcn. Replication-deficient high-titer lentivirus was produced in-house. Briefly, HEK293T cells were transfected with a second-generation packaging plasmid (pPAX2) and a pseudotyping envelope plasmid (pMD2.G). The viral supernatant was harvested 48–72 h later, when transfection efficiency was ∼100% (gauged by mCherry fluorescence). The virus was purified by low-speed centrifugation and syringe filtration (Merck Millipore SLHV033RS) to remove cellular debris, and then concentrated by ultra-centrifugation (30,000 RPM, 2.5 h, at 4°C; Beckman SW41 Ti rotor). The pellet was resuspended in DMEM, and the virus was stored at −80°C. For titer estimation, we incubated HEK293T cells with a dilution series of virus and counted the number of fluorescent cells (1.0 × 1011 TU/ml).
Organotypic slice culture.
Cultured slices were prepared from neonatal Phox2b::GFP mice (P6-P7), as described previously (Qin et al., 2005; Lim et al., 2014). Briefly, pups were anesthetized with ketamine and xylazine (375 mg/kg and 25 mg/kg, i.m.). Brainstems were removed in ice-cold Hank's Balanced Salt Solution, containing the following (in mm): 1 kynurenic acid, 1 HEPES, 20 glucose, and 10 MgCl2. Slices were cut in the coronal plane (400 μm) with a microslicer (DSK 1500E; Dosaka) and then transferred onto a Millicell-CM culture inserts (0.4 mm pore size; Millipore) containing 1 ml of culture medium (mm) as follows: 30 HEPES, 1 glutamine, 13 d-glucose, 5 NaHCO3, 1 CaCl2, 2 MgSO4, with 50% minimal essential medium, 20% heat-inactivated horse serum, 1 mg/ml insulin, and 0.012% ascorbic acid at pH 7.28 and 320 mOsm. Slices were maintained at 35°C in a humidified incubator equilibrated with 95% O2 and 5% CO2. For viral transduction, 10 μl of AAV2 (diluted to ∼1 × 109 TU/ml) was pipetted onto the surface of each slice at day 3 after slice preparation; slices were used within 2–4 weeks.
Electrophysiology.
Acute slice preparation was essentially as described above, except that 300 μm brainstem slices were cut from P7-P11 mice in ice-cold sucrose-substituted solution, containing the following (in mm): 260 sucrose, 3 KCl, 5 MgCl2, 1 CaCl2, 1.25 NaH2PO4, 26 NaHCO3, 10 d-glucose, and 1 kynurenic acid. Slices were incubated for 30 min at 37°C and subsequently at room temperature in normal Ringer's solution containing the following (in mm): 130 NaCl, 3 KCl, 2 MgCl2, 2 CaCl2, 1.25 NaH2PO4, 26 NaHCO3, and 10 d-glucose. Both cutting and incubation solutions were bubbled with 95% O2 and 5% CO2.
Electrophysiological recordings from GFP-labeled neurons in both acute and cultured slices were performed in a recording chamber mounted on a fluorescence microscope (Zeiss Axioimager FS) in HEPES-based perfusate, containing the following (in mm): 140 NaCl, 3 KCl, 2 MgCl2, 2 CaCl2, 10 HEPES, 10 d-glucose; a mixture of blockers was added (10 μm CNQX, 10 μm bicuculline, 30 μm strychnine) to inhibit fast excitatory (glutamate) and inhibitory transmitters (GABA, glycine). The pH of the bath solution was adjusted between 7.0 and 8.0 by addition of HCl or NaOH. For some experiments, we replaced extracellular Na+ with equimolar N-methyl d-glucamine (NMDG+). Patch electrodes had a DC resistance of 3–6 mΩ. For cell-attached recordings of firing rate, as well as whole-cell recordings of membrane potential and pH-sensitive background currents, we used pipette solution containing the following (in mm): 120 KCH3SO3, 4 NaCl, 1 MgCl2, 0.5 CaCl2, 10 HEPES, 10 EGTA, 3 Mg-ATP, 0.3 GTP-Tris, pH 7.2 (with KOH). We used a Cs+-based internal solution for voltage-clamp recordings of shRNA effects on NMDG- and SP-sensitive background currents, containing the following (in mm): 104 CsCH3SO3, 1 MgCl2, 0.5 CaCl2, 30 TEACl, 10 HEPES, 10 EGTA, 3 Mg-ATP, 0.3 GTP-Tris, pH 7.2 (with CsOH); electrode tips were coated with Sylgard 184 (Dow Corning). TTX (1 μm) was added to the bath for voltage-clamp recordings of NMDG- and SP-sensitive currents. We used brief bath applications of 5-HT (5 μm) and SP (1 μm); because of poor wash and likely desensitization, individual slices were exposed to 5-HT and SP only once.
Recordings were performed in either cell-attached or whole-cell configurations at room temperature using pClamp, a Multiclamp amplifier, and a Digidata 1440A analog-to-digital converter (all from Molecular Devices). Cell-attached and whole-cell recordings were made under voltage clamp at a holding potential (Vh) of −60 mV (Perkins, 2006); resting membrane potential was obtained from stable interspike intervals shortly after whole-cell access using current-clamp configuration. The pH sensitivity of individual RTN neurons was assessed by measuring cell-attached firing responses in bath solutions titrated to different pH levels (from pH 7.0 to pH 8.0), and using linear regression analysis to interpolate a pH50 value at which firing was reduced to half that observed at pH 7.0 (Lazarenko et al., 2009). NMDG and SP currents in RTN neurons were characterized under whole-cell voltage clamp at Vh = −60 mV. Effects of NMDG and SP on holding current and conductance were followed over time with repeating voltage steps (Δ −50 mV, 140 ms, 0.067 Hz); current-voltage (I–V) relationships were obtained under steady-state conditions with a family of voltage steps (Δ 10 mV from −120 to −40 mV, 400 ms), and the reversal potential of NMDG-sensitive currents was estimated from the intersection of linear fits to those I–V curves. All membrane voltages were corrected for a 10 mV liquid junction potential. Compensation for series resistance (60%–70%) and cell capacitance was obtained using the amplifier circuits. To calculate specific membrane resistance (kΩ/cm2) from conductance values obtained under voltage clamp, we assumed a specific capacitance of 1 μF/cm2.
Lentivirus injection into the RTN of Phox2b::GFP mice.
Adult Phox2b::GFP mice were anesthetized with ketamine/dexmedetomidine HCl (100 mg/kg and 0.2 mg/kg, i.p.), mounted in a stereotaxic apparatus, and maintained at 37°C with a servo-controlled heating pad. After craniotomy, a pipette filled with PRSx8-shRNA-mCherry or PRSx8-scrambled-mCherry lentivirus (diluted to ∼2 × 109 TU/ml) was inserted at coordinates ∼1.4 mm lateral to midline, 1.0 mm caudal to bregma, and 5.2–5.5 mm ventral to the pial surface of the cerebellum (Paxinos and Franklin, 2001). In addition to stereotaxic coordinates, the tip of the pipette was positioned precisely 100 μm below the facial motor nucleus, which was identified by recording antidromic field potentials elicited by stimulating the mandibular branch of the facial nerve (Abbott et al., 2009; Kumar et al., 2015). The glass pipette was connected to an electronically controlled pressure valve (Picospritzer II), and brief pressure pulses (3–6 ms) were used to inject 150 nl of virus bilaterally, at each of 3 rostrocaudally aligned sites separated by 200 μm. After surgery, mice were treated with ampicillin (100 mg/kg, s.c.), atipamezole (2 mg/kg, s.c.), and ketoprofen (4 mg/kg, s.c.). At least 4 weeks elapsed following virus injection before mice were examined in ventilatory and histochemical assays.
Breathing measurements.
Ventilatory responses were measured in conscious, unrestrained mice by whole-body plethysmography (EMKA Technologies) (Kumar et al., 2015). A mass flow regulator provided quiet, constant, and smooth flow through the animal chamber (0.5 L/min). We habituated mice to the plethysmography chamber for 4 h before testing. The protocol entailed three sequential incrementing CO2 challenges (7 min exposures to 4%, 6%, 8% CO2, balance O2; each separated by 5 min of 100% O2). Hypercapnic exposure was performed in hyperoxia to minimize contributions of peripheral chemoreceptors to the hypercapnic ventilatory reflex (Basting et al., 2015) and attribute ventilatory effects to central chemoreceptors. For hypoxia challenges, mice were exposed to 10% O2, balance N2 for up to 15 min.
Analysis of responses to ventilatory challenge.
Ventilatory flow signals were recorded, amplified, digitized, and analyzed using Iox 2.7 (EMKA Technologies) to determine ventilatory parameters over sequential 20 s epochs (∼50 breaths), during periods of behavioral quiescence and regular breathing. Minute ventilation (VE, ml/min/g) was calculated as the product of respiratory frequency (fR, breaths/min) and tidal volume (VT, ml/breath), and normalized to body weight (g). For analysis of the acute hypercapnic ventilatory response, we sampled 10 consecutive epochs (200 s, representing ∼400–500 breaths at rest) that showed the least interbreath irregularity during the steady-state plateau period after each CO2 exposure, as determined by Poincaré analysis (Loria et al., 2013; Kumar et al., 2015). The response to hypoxia was determined from the peak VE (20 s epoch) during the hypoxic exposure (Kumar et al., 2015).
In vivo hypercapnia-induced cFos expression.
In vivo activation of RTN neurons by CO2 was assessed in adult Phox2b::GFP mice (P60-P100) by cFos expression (Kumar et al., 2015). Mice were habituated to the plethysmography chamber for 4 h on the day before the experiment. Mice were then exposed to 2 h hyperoxia, and then the 8% CO2 stimulus (hypercapnia) for 45 min, followed by 45 min of hyperoxia. Following this, mice were anesthetized with ketamine and xylazine (200 mg/kg and 14 mg/kg, i.p.) and perfused transcardially with 4% PFA/0.1 m phosphate buffer (PB). Brainstems were cut on a vibrating microtome (Leica) into 30 μm transverse sections and immunostained for fluorescence markers, GFP and mCherry (primary: chicken anti-GFP, Aves Laboratories, GFP-1020; rabbit anti-DsRed, Clontech, 632496; secondary: donkey anti-chicken Alexa488, Jackson ImmunoResearch Laboratories, 703–545-155; donkey anti-rabbit Cy3, Jackson ImmunoResearch Laboratories, 711–166-152), followed by overnight incubation with c-Fos primary antibody (goat anti-cFos, Santa Cruz Biotechnology, sc-52-G); sections were then incubated for 1 h with biotinylated secondary antibody (donkey anti-goat, Jackson ImmunoResearch Laboratories, 705–065-147) and avidin-HRP (Vector Laboratories, PK6100) for 45 min followed by development of nickel-intensified 3, 3′-diaminobenzidine reaction product.
Combined in situ hybridization and immunohistochemistry.
Mice were perfused transcardially with 4% PFA/0.1 m PB and brainstems cut in the transverse plane (30 μm); RNA probe production, tissue preparation, and staining procedure followed published protocols (Kumar et al., 2012). Nalcn, VGlut2, and NK1R transcript expression was assessed using cRNA probes (Nalcn: 1805 bp, from nucleotide 4734 of NM_177393; VGlut2: 1195 bp, from nt 1085 of NM_080853; NK1R: 926 bp, starting from nt 1 of NM_009313). Briefly, DNA fragments were amplified from mouse brain with primers that included T7 and SP6 polymerase promoter sequences and used as templates for digoxigenin (DIG)-labeled RNA probe synthesis. The hybridization step was performed with 0.5 μg/ml of DIG-labeled RNA probe, and subsequently the tissue was incubated for 48 h at 4°C with an alkaline phosphatase-conjugated antibody to DIG (sheep anti-DIG, Roche, 11093274910) and primary antibodies for GFP and/or DsRed (as above). Subsequently, the sections were incubated for 2 h at room temperature in secondary antibodies for detection of GFP and DsRed (as above), and hybridization signal was detected using alkaline phosphatase substrate, 4-nitroblue tetrazolium/5-bromo-4-chloro-3-indolyl-phosphate solution. Sense probes were used as negative control.
Cell counts and analysis.
Serial sections (1:3 series) through the rostrocaudal extent of the RTN were mounted on glass slides, and images were acquired using an epifluorescence microscope (Zeiss Axioimager Z1) equipped with Neurolucida software. Labeled neurons were counted and aligned for averaging according to defined anatomical landmarks (Paxinos and Franklin, 2001). No stereological correction factor was applied; therefore, actual cell numbers will be ∼3 times higher than counted. The investigator assessing and quantifying cellular profiles was blinded to treatment.
Statistics.
Results are presented as mean ± SEM. All statistical analyses were performed using GraphPad Prism (version 6.07); details of specific tests are provided in the text or figure legends. Statistical significance was set at p < 0.05.
Results
Nalcn is expressed at variable levels in chemosensitive RTN neurons
In Phox2b::GFP mice, virtually all GFP-labeled cells in the RTN express Phox2b and are CO2/H+-sensitive, firing at higher rates during extracellular acidification and lower rates during alkalization (Lazarenko et al., 2009). By combining immunostaining for GFP with in situ hybridization for detection of Nalcn transcripts, we found that most GFP-labeled RTN neurons located at or near the ventral medullary surface express Nalcn (Fig. 1A); cell counts revealed that ∼90% of RTN neurons express Nalcn in neonatal (90.7 ± 0.4%, n = 4) and adult mice (89.7 ± 0.4%, n = 12). In addition, by multiplex sc-PCR from GFP-labeled cells dissociated from neonatal mice (Fig. 1B), we identified Nalcn transcripts in ∼95% of Phox2b- and VGlut2-expressing RTN neurons (n = 156/164, from 24 mice).
We tested whether naturally varying levels of Nalcn expression are associated with different neuronal firing properties. Using cell-attached recordings in acute slice preparations (in the continued presence of fast synaptic blockers), RTN neurons were identified that differed in the pH range over which they maintain their discharge (Fig. 1C); this was reflected in their pH50 values (the pH at which action potential discharge drops to 50% of that obtained at pH 7.0) (Lazarenko et al., 2009). Following functional characterization, whole-cell access was obtained and the contents of the recorded neurons were aspirated into the recording pipette to measure Nalcn transcript levels by sc-qPCR. There was a strong positive correlation between higher pH50 values and Nalcn expression levels (Fig. 1D, left). Using a previously established pH50 cutoff (Lazarenko et al., 2009), we classified RTN neurons with pH50 <7.42 as Type I and those with pH50 >7.42 as Type II; Nalcn expression was significantly higher in Type II RTN neurons (Fig. 1D, right).
Knockdown of Nalcn in vitro decreases basal discharge of RTN neurons
For a more direct test of Nalcn contributions to RTN neuronal function, we developed a viral-mediated shRNA strategy for depleting Nalcn from neurons maintained in slice culture. From multiple candidates, we identified a previously described shRNA construct that reduced expression of cotransfected recombinant Nalcn in HEK293 cells by ∼70% (Lee et al., 1999; Swayne et al., 2010). This shRNA species and its scrambled control were incorporated downstream of a PolIII (H1) promoter into self-complementary AAV targeting vectors that also included a CMV-synapsin promoter to drive neuronal mCherry expression (Fig. 2A). The corresponding AAV (serotype 2) virus was applied to the media of cultured brainstem slices, and infected neurons were identified in the RTN region by coexpression of GFP and mCherry from 2 to 4 weeks after infection (Fig. 2A). We used sc-qPCR to verify that Nalcn expression was strongly reduced in shRNA-expressing RTN neurons compared with uninfected cells, RTN neurons expressing scrambled shRNA, or RTN neurons dissociated from acute slices (Fig. 2B).
We performed cell-attached recordings of firing behavior from RTN neurons expressing either Nalcn or control shRNA. Cells infected with Nalcn shRNA-expressing virus had significantly lower firing rates under baseline conditions (Fig. 2C,D) and ceased discharge at relatively mild levels of alkalization compared with scrambled shRNA-expressing or uninfected RTN neurons. After recording pH effects on firing rate, we obtained whole-cell current recordings in a subset of these cells and found that Nalcn-depleted RTN neurons had a significantly more negative resting membrane potential than control cells (Fig. 2E). Nalcn depletion shifted pH50 values to more acidified levels (Fig. 2F). This shift reflects the lower initial firing rate observed in Nalcn-depleted RTN neurons, rather than a difference in intrinsic neuronal pH sensitivity, because there was no difference in pH effects on firing in control or Nalcn shRNA-expressing neurons (i.e., slopes: −2.9 ± 0.6 Hz/pH vs −2.6 ± 0.3 Hz/pH, n = 46 and n = 29, p > 0.80; Fig. 2F) and the pH-sensitive background K+ current in RTN neurons was unaffected by Nalcn knockdown (Fig. 2G). The effects of Nalcn depletion on firing are likely underestimated because we excluded silent RTN neurons that failed to discharge even in acidified bath solutions, pH 7.0, a population that was higher after Nalcn knockdown (Nalcn shRNA: 15.4% silent, n = 24/156; control cells: 2.4% silent, n = 3/125; p < 0.0002 by χ2). As expected, Nalcn expression was also eliminated in a subset of RTN neurons infected with Nalcn shRNA virus that were processed for sc-qPCR after recording (data not shown). Thus, Nalcn knockdown hyperpolarizes RTN neurons and decreases their basal discharge.
Knockdown of Nalcn decreases a TTX-resistant background Na+ current in RTN neurons
We made whole-cell voltage-clamp experiments in cultured slices to assess effects of Nalcn knockdown on TTX-resistant inward current in RTN neurons (Fig. 3A). At a holding potential of −60 mV in the presence of TTX, Nalcn-depleted neurons displayed a significantly lower inward current compared with control cells that were either uninfected or expressing scrambled shRNA (Fig. 3A–C); when corrected for cell size (i.e., capacitance), the inward current density after Nalcn knockdown was also lower than in uninfected or scrambled shRNA-infected RTN neurons cells (Fig. 3C; at −60 mV: −0.9 ± 0.1 pA/pF vs −2.7 ± 0.5 pA/pF or −2.7 ± 0.9 pA/pF; n = 11, 7 and 5, p < 0.01). Likewise, input conductance was significantly lower in Nalcn shRNA-expressing RTN neurons than in control cells (Fig. 3A,B; 1.0 ± 0.1 nS vs 2.4 ± 0.4 nS or 2.3 ± 0.3 nS; n = 11, n = 7, and n = 5, p < 0.0001), with a clear decrease in slope of the averaged whole-cell current density-voltage relationship (I–V) (Fig. 3C). In cells depleted of Nalcn, specific membrane resistance was ∼2- to 3-fold greater than in either group of control cells (39.0 ± 3.7 kΩ/cm2 vs 13.6 ± 1.9 or 17.0 ± 4.6 kΩ/cm2; n = 11, n = 7, and n = 5, p < 0.0001).
We substituted NMDG for sodium (in bath solutions containing TTX) to examine Na+ contributions to the background current reduced by Nalcn knockdown (Fig. 3A,D–H). In uninfected RTN neurons or cells expressing scrambled shRNA, changing from an Na+- to an NMDG-containing bath solution reduced inward holding current and decreased input conductance (Fig. 3A,D–G). By contrast, NMDG substitution had a much smaller effect on Nalcn shRNA-expressing RTN neurons (Fig. 3A,G,H). The averaged I–V values were relatively linear through the voltage range tested (Fig. 3F,H), and the NMDG-sensitive current in control cells reversed at −20.8 mV; both the NMDG-sensitive current and conductance at −60 mV were significantly lower in Nalcn-depleted RTN neurons (Fig. 3I). Moreover, there was a strong correlation between NMDG-sensitive current amplitude and Nalcn expression levels determined by sc-qPCR from the recorded neurons (Fig. 3J). The residual NMDG-sensitive background current in Nalcn shRNA-expressing cells (Fig. 3I) could reflect incomplete knockdown of Nalcn or expression of alternative TTX-resistant cationic channels that are active near resting membrane potentials (e.g., TRP channels). Nonetheless, the data to this point demonstrate that Nalcn underlies a major, TTX-resistant background Na+ current that contributes to basal activity of RTN neurons.
Nalcn underlies a SP-activated background Na+ current in RTN neurons
Nalcn can be activated by neuropeptides, including SP (Lu et al., 2009), and SP strongly excites RTN neurons, both in vitro and in vivo (Mulkey et al., 2007). To determine whether Nalcn contributes to SP-mediated activation of RTN neurons, we tested effects of SP (1 μm) on control or Nalcn-depleted cells in slice cultures. In control RTN neurons, SP caused a marked increase in firing rate (Fig. 4A,C), which was even more pronounced than that seen with bath acidification in the same cells (Δ ∼5–7 Hz vs ∼2 Hz at pH 7.0). By contrast, SP had little effect in RTN neurons expressing Nalcn shRNA (Fig. 4A,C). This was not due to the lower initial firing rate because the increased firing evoked by 5 μm 5-HT, which acts via modulation of KCNQ and HCN channels in RTN neurons (Hawryluk et al., 2012; Hawkins et al., 2015), was unaffected by Nalcn knockdown (Fig. 4B,C). Nalcn expression was eliminated in RTN neurons expressing Nalcn shRNA, with no off-target effects on expression of either NK1R or VGlut2 (Fig. 4D). In addition, there was no effect of Nalcn shRNA on expression of other tachykinin receptors, which were either undetectable (NKA receptor, NK2R, n = 0/11 cells, data not shown) or found at lower levels in a subset of RTN neurons (NKB receptor, NK3R, ∼54% of cells, n = 20/37) (Fig. 4D). Finally, in corroborating voltage-clamp experiments, we found that the SP-sensitive current and SP-activated conductance were strongly reduced by Nalcn knockdown (Fig. 4E). Thus, Nalcn accounts for much of the SP-activated current that excites RTN neurons.
Selective Nalcn depletion from RTN neurons in vivo reduces CO2-evoked neuronal activation and ventilatory stimulation
The tonic and CO2-regulated activity of Phox2b-expressing RTN neurons provides a major excitatory drive to the brainstem centers that control breathing (Guyenet and Bayliss, 2015). To test a role for Nalcn in RTN-mediated respiratory control, we developed a lentiviral approach for shRNA-mediated knockdown of Nalcn specifically in Phox2b-expressing chemoreceptor RTN neurons in vivo (Fig. 5A,B). The lentiviral construct incorporates a PRSx8 promoter sequence to direct expression selectively to Phox2b-expressing neurons (Hwang et al., 2001; Abbott et al., 2009) and embeds a Nalcn (or control) shRNA sequence into a Drosha site derived from miR30a in an artificial intron driven by the PRSx8 promoter (McBride et al., 2008; Berger et al., 2010). For a reporter, the mCherry coding sequence was placed downstream of an intron splice acceptor site. Four weeks after bilateral injections of the corresponding lentivirus into the brainstem of anesthetized Phox2b::GFP mice, using stereotaxic coordinates and antidromic facial field potentials to localize the RTN region (Abbott et al., 2009; Basting et al., 2015; Kumar et al., 2015), we found mCherry labeling nearly exclusively in GFP-positive RTN neurons (i.e., 98.2 ± 0.2% and 97.7 ± 0.2% for Nalcn and scrambled virus, n = 15 each). Viral transduction efficiency within the RTN (i.e., the fraction of GFP+ RTN neurons that were also mCherry+) ranged from ∼20% to 90% in individual mice and was not different with Nalcn or scrambled virus (58.6 ± 5.9% vs 64.6 ± 6.1%, n = 15 each, p > 0.48).
We used in situ hybridization to evaluate viral-mediated knockdown of Nalcn (Fig. 5C–F). Expression of Nalcn was eliminated specifically in mCherry+ cells transduced with Nalcn shRNA (i.e., Fig. 5C, yellow arrows; Nalcn labeling in 0.6 ± 0.2% of mCherry+ RTN neurons, n = 15 mice). By contrast, Nalcn expression was preserved in ∼90% of nearby, uninfected RTN neurons in those same mice (Fig. 5C, green arrows; in 89.7 ± 0.4% of mCherry-/GFP+ neurons), and was also evident in nearby cell groups not targeted by the PRSx8 promoter (Fig. 5C, white arrows). Likewise, Nalcn expression was maintained in ∼90% of both infected and uninfected RTN neurons after injection of control shRNA-expressing lentivirus (Fig. 5D,F; 89.7 ± 0.4% and 89.5 ± 0.5%, n = 15 mice). Importantly, we found no differences in the percentage of RTN neurons expressing NK1R (∼90%) or VGlut2 (∼100%) after injections of either Nalcn or control shRNA virus (Fig. 5E,F). These data indicate effective and selective knockdown of Nalcn in RTN neurons with this system and support using this viral-based shRNA approach to evaluate Nalcn contributions to RTN function in vivo.
Activation of RTN neurons in vivo by elevated CO2/H+ can be assessed indirectly by expression of cFos (Sato et al., 1992; Kumar et al., 2015). As is typical for RTN neurons in control mice (Kumar et al., 2015), cFos immunoreactivity was found in ∼35% of RTN neurons in mice injected with control virus after exposure to 8% CO2 (Fig. 6A,B), regardless of whether or not they were transduced (34.7 ± 1.5% and 34.0 ± 1.3%, n = 6 mice). Likewise, a similar number of nontransduced, cFos-positive RTN neurons were obtained in mice injected with Nalcn shRNA virus (34.7 ± 1.8%, n = 8 mice). However, among RTN cells that were transduced with Nalcn shRNA, only approximately half the number of cFos-labeled neurons were observed (18.9 ± 1.6%, p < 0.0001).
Because RTN neuronal activity directly regulates breathing (Abbott et al., 2009; Marina et al., 2010; Basting et al., 2015), we tested whether Nalcn depletion and diminished RTN activation by CO2 would alter in vivo ventilatory responses to raised CO2 (Fig. 7). We used whole-animal plethysmography to determine effects on ventilation of increasing CO2 concentrations in the inspired air (balance O2), before and then 4 weeks after injection of Nalcn shRNA (or control) lentivirus into the RTN (Fig. 7A). Under these hyperoxic conditions, carotid body peripheral chemoreceptors are essentially silent and CO2 effects on breathing are primarily determined by brainstem chemoreceptors (e.g., RTN neurons) (Basting et al., 2015). Before virus injection, the effect of CO2 on ventilation (VE; ml/min/g) was not different in mice that received injections of either Nalcn shRNA or control virus (Δ VE ∼2.7 ml/min/g at 8% CO2; Fig. 7B,C). When assessed after Nalcn depletion from RTN neurons, the ventilatory response to CO2 was significantly reduced (by ∼37%, ∼1.7 ml/min/g) (Fig. 7B,C); this was due to diminished CO2-induced increases in both fR (breaths/min) and VT (ml/breath/g) (Fig. 7B). Notably, for mice injected with Nalcn shRNA-expressing virus, there was a significant negative correlation between the fraction of virally transduced RTN neurons and the degree of inhibition of CO2-evoked breathing (Fig. 7D). By contrast, CO2-stimulated breathing was unaffected in mice receiving control virus, even at the highest transduction rates (Fig. 7B–D). Importantly, the stimulation of breathing by reduced O2 was not different before or after either Nalcn or control shRNA virus injection (Fig. 7E), consistent with the minimal contribution from RTN neurons to hypoxic hyperventilation (Basting et al., 2015). Thus, selective Nalcn depletion in RTN neurons decreases CO2-evoked neuronal activation in vivo and strongly blunts CO2-stimulated breathing.
Discussion
We used shRNA-mediated knockdown of Nalcn, in vitro and in vivo, to demonstrate that Nalcn provides an important “leak” sodium current that regulates basal and neuropeptide-modulated activity in RTN respiratory chemoreceptor neurons and supports CO2-stimulated neuronal activation and respiratory output. We found that shRNA-mediated knockdown of Nalcn did not directly affect the pH-modulated background K+ currents that mediate intrinsic CO2/H+ sensitivity of RTN neurons (Mulkey et al., 2004; Wang et al., 2013a, b; Kumar et al., 2015), but strongly reduced CO2-mediated respiratory responses in vivo. Thus, distinct and functionally antagonistic “leak” currents, carried by Na+ and K+, regulate ongoing activity and CO2-stimulated breathing by RTN chemoreceptor neurons. Moreover, modulation of this channel provides a mechanism for pH-independent stimulation of RTN neuronal activity to influence CO2-dependent control of breathing. Finally, RTN expression of Nalcn may account, in part, for the breathing deficits in global Nalcn knock-out mice (Lu et al., 2007) and contribute to the reported respiratory insufficiencies in some human patients with Nalcn mutations (Chong et al., 2015; Gal et al., 2016).
Regulation of RTN activity by coexpressed leak Na+ and K+ channels
Individual pH-sensitive RTN neurons discharge tonically, both in vivo and in vitro, with different basal firing rates at physiological pH (Mulkey et al., 2004; Lazarenko et al., 2009; Wang et al., 2013a); these different cellular firing properties presumably permit the population of respiratory chemoreceptor neurons to encode a broad range of ambient CO2/H+ for regulation of breathing in vivo. Our data indicate that Nalcn is responsible for a prominent leak Na+ current in RTN neurons that contributes to these different basal firing rates, providing a depolarizing counterbalance to the background K+ currents that account, directly or indirectly, for the intrinsic pH sensitivity of RTN chemoreceptor neurons (Guyenet and Bayliss, 2015).
Nalcn knockdown led to membrane hyperpolarization and a decrease in RTN neuronal firing activity across the pH range in vitro, but resting ventilation in vivo was unaffected after Nalcn depletion from RTN neurons. This result is not unexpected. Chronic lesion of RTN (and some surrounding) neurons in adult rats using various toxins has relatively modest effects on resting ventilation, apneic threshold, and CO2 sensitivity (Nattie and Li, 2002; Takakura et al., 2008) unless a very high percentage of RTN neurons is eliminated (>70%) (Takakura et al., 2008). Also, adult mice that survive complete genetic lesion of RTN neurons compensate to maintain normal eupneic ventilation despite a blunted CO2 response (Ramanantsoa et al., 2011). Moreover, lesions of serotonergic neurons that decrease CO2-stimulated breathing to a similar degree were also without effect on breathing parameters at rest (Hodges et al., 2008). Because acute inhibition of RTN neurons reduces eupneic breathing (Basting et al., 2015), Nalcn depletion in RTN likely triggers a compensatory mechanism that can restore adequate ventilation at rest in vivo but is insufficient to elicit normal ventilatory stimulation when the mice are challenged with elevated CO2.
Nalcn modulation and state-dependent regulation of breathing
We find that Nalcn is responsible, essentially entirely, for the excitatory effects of SP on RTN neurons (Mulkey et al., 2007); after depletion of Nalcn, the SP-evoked increase in firing, inward current, and conductance were nearly completely abolished. This is consistent with earlier reports that neuropeptides, including SP, activate Nalcn in other types of neurons (Lu et al., 2009). Interestingly, although NK and 5-HT2 receptors are coexpressed in many RTN neurons and share the same canonical signaling pathway (i.e., Gαq-PLC), the effects of 5-HT were unaffected by Nalcn knockdown. Thus, these data imply that 5-HT and SP engage different pathways and/or target different effectors in RTN neurons. Indeed, recent work suggests that 5-HT acts via 5-HT2 and 5-HT7 receptors to inhibit KCNQ channels and activate HCN channels, respectively, via PLC-PKC and cAMP pathways (Hawryluk et al., 2012; Hawkins et al., 2015). By contrast, SP effects are independent of KCNQ channels in RTN neurons (Hawryluk et al., 2012), and NK1R couples to Nalcn via a novel G-protein-independent mechanism involving UNC-80 and Src family kinases in other neurons (Lu et al., 2009). Because the 5-HT and SP input to RTN neurons derives mainly from caudal raphe serotonergic neurons (Hökfelt et al., 1978; Mulkey et al., 2007), these parallel effector mechanisms may support nonocclusive cellular actions under conditions when 5-HT and SP may be coreleased. Moreover, these transmitter actions are independent of the effects of CO2/H+ (Mulkey et al., 2007; Hawryluk et al., 2012; Hawkins et al., 2015), allowing RTN activation by neuromodulatory brain systems to be superimposed on chemoreceptor stimulation.
With respect to SP actions, caudal raphe neurons display an activity pattern that tracks motor behavior (Veasey et al., 1995; Jacobs et al., 2002). In addition, raphe neuronal activity is strongly arousal state-dependent, with high firing rates during active waking and low spike discharge during sleep (Veasey et al., 1995; Jacobs et al., 2002). Likewise, effects of CO2 on breathing are greatest during waking and reduced during sleep (Krieger, 2000; Burke et al., 2015), and patients with central hypoventilation syndrome, associated with Phox2b mutations and reduced CO2 sensitivity) have more severe hypoventilation during sleep (Amiel et al., 2003; Weese-Mayer et al., 2010). Thus, neuromodulation of Nalcn in RTN neurons may contribute, at least in part, to the poorly understood exercise or arousal state-dependent changes in breathing (Guyenet and Bayliss, 2015).
An elegant recent study found that activity of circadian neurons in flies and mice was determined by upregulation and downregulation of NA/Nalcn current that was antiphase with expression of a background K+ current in those neurons: a higher ratio of Na+:K+ current yielded greater activity during the waking period (Flourakis et al., 2015). The circadian-dependent changes in Nalcn activity were determined by rhythmic changes in expression of NLF-1, a chaperone protein that delivers the channel to the plasma membrane (Xie et al., 2013), and NLF-1 knockdown or NA mutations disrupted circadian behavior in flies (Flourakis et al., 2015). As discussed above, we also find that expression of Nalcn can activate RTN neurons in opposition to effects of pH-sensitive background K+ currents; in this case, a wake state-dependent influence of Nalcn on RTN neuron activity on respiratory chemosensitivity may reflect transmitter-evoked modulation of the channel rather than (or in addition to) altered expression or membrane targeting.
A role for Nalcn in control of breathing and the respiratory CO2 chemoreflex
Mice with global genetic deletion of Nalcn die of respiratory failure within 24 h of birth (Lu et al., 2007). In addition, missense or nonsense mutations of Nalcn are associated with variable phenotypes that include respiratory distress in some patients (Al-Sayed et al., 2013; Köroğlu et al., 2013; Cochet-Bissuel et al., 2014; Chong et al., 2015; Gal et al., 2016). The different phenotypes likely reflect the broad distribution of the channel in the CNS (Lee et al., 1999; Lu et al., 2007), and respiratory dysfunction could be due to loss of the depolarizing leak Na+ current in any number of cell groups within the respiratory control system (Feldman et al., 2013; Smith et al., 2013). Nonetheless, our experiments reveal that depletion of Nalcn selectively in RTN neurons disrupts their activation by CO2 and blunts the associated ventilatory stimulation. This study therefore presents a cell-specific role for mammalian Nalcn in a defined physiological function and an approach for specific and effective Nalcn knockdown that can be applied to other cell groups where the channel is highly expressed.
Note added in proof: While this manuscript was under consideration, a description of Nalcn contributions to firing and glyoclytic sensitivity of substantia nigra pars reticulata neurons became available (eLife 2016;5:e15271).
Footnotes
This work was supported by National Institutes of Health Grants NS080061 to E.P.-R., HL074011 to P.G.G., and HL108609 to D.A.B.
The authors declare no competing financial interests.
- Correspondence should be addressed to Dr. Douglas A. Bayliss, Department of Pharmacology, University of Virginia Health System, 5009A Jordan Hall, PO Box 800735, 1340 Jefferson Park Avenue, Charlottesville, VA 22908-0735. bayliss{at}virginia.edu