Serotonin 2B Receptors in Mesoaccumbens Dopamine Pathway Regulate Cocaine Responses

Generation of Htr2b floxed mice.

Genomic contigs of Htr2b encompassing exon 1 and 2 and flanking sequence were obtained by screening of a 129S2 mouse genomic library. For the gene-targeting construct, a 10 kb BamHI-XhoI fragment containing the two first exons was selected, while a 4 kb SacI-SacI fragment containing exon 2, which includes the ATG start codon and 5′ UTR, was used to induce the targeted deletion. A LoxP site was inserted in the 5′-UTR and a neomycine-resistance cassette flanked by two LoxP sites in the ClaI site of the second intron. Then, the SacI-SacI fragment comprising the floxed construct was excised and electroporated into 129S2 embryonic stem (ES) cells, which were subjected to G418 selection. Targeted homologous recombination was confirmed by PCR and Southern blot analysis. A positive ES-cell clone was injected into C57BL/6NCrl blastocysts and implanted into pseudopregnant mice. A chimeric male displaying germ-line transmission was then used to propagate the floxed Htr2b (Htr2b^fl/fl) allele on a C57BL/6NCrl background for the first two generations. More than 10 backcrosses of Htr2b^fl/fl mice with 129S2 (Htr2b^+/+) mice were performed. Htr2b^fl/fl alleles were detected by PCR using the oligonucleotide F1: CTAACATTTTTCATCCACATCTA as forward primer located in the 5′ UTR (position of the primers is indicated in Fig. 6a). Paired to this primer, the reverse primer R1: TCCCTCGAAGCTTATCGGCGCG, located in the 5′ end of the second intron, led to the amplification of a 1 kbp product in the presence of the Htr2b^fl/fl allele, while the reverse primer R2: ACTTTAATTGGGACTCGCTGAT, located in the 3′ side of the ClaI site, permits amplification of a 309 bp amplicon indicative of the Htr2b-null allele.

DA neurons selective ablation of Htr2b.

Adult Htr2b^fl/fl mice were exclusively inactivated in DA neurons for Htr2b by crossing with DAT-Cre^+/0 (BAC–Slc6-icre) mice (Turiault et al., 2007). Htr2b^fl/fl;DAT-Cre^+/0 (Htr2b^DAKO) were generated on a mixed 129S2.B6 background used as F3 on 129S2 strain with littermate Htr2b^fl/fl;DAT-Cre^0/0 (Htr2b^fl/fl) as control mice. Identification of DA neurons was performed in DAT-Cre^+/0;Gt(ROSA)26Sor^{tm1.1(CAG-EGFP)Fsh} (DAT-Cre^+/0;RCE or Dat-GFP) mice, which expressed EGFP only after recombination [Jackson Laboratory; also named RCE:loxP mice, which harbor the R26R CAG-boosted EGFP (RCE) reporter allele with a loxP-flanked STOP cassette upstream of the enhanced green fluorescent protein (EGFP) gene: MGI:4412373.

Locomotor activity.

Locomotor activity was measured in an actimeter (circular corridor with four infrared beams placed at 90° intervals; Imetronic), as described previously (Doly et al., 2009). Counts were incremented by consecutive interruption of two adjacent beams (i.e., mice moving through one-quarter of the corridor). Mice were individually placed in the activity box for 30 min followed by an intraperitoneal injection of a saline solution and recorded for another 60 min over 3 consecutive days for habituation before all locomotor experiments. The day of the experiment, mice were injected with a saline solution or 5-HT_2B antagonists (RS127445, 0.5 mg/kg, or SB206553, 3 mg/kg) and individually placed in the activity box for 30 min before being intraperitoneally injected with a saline or cocaine (7.5–20 mg/kg) solution and the locomotor activity was recorded for 2 h.

Locomotor sensitization.

For locomotor sensitization in this study, we used a two-injection protocol shown to be as efficient as a repeated-injection protocol but involving much less handling of mice, thus minimizing stress and contextual habituation, which can be confounding factors (Valjent et al., 2010). After 30 min in the actimeter, mice received a first injection of cocaine (7.5, 15, or 20 mg/kg) and the locomotor activity was recorded for 2 h. Mice were then challenged 7 d later with a second injection of cocaine at the same concentration as the first injection, same injection protocol, and the locomotor activity was recorded for 2 h.

Microdialysis in freely moving mice.

The microdialysis experiment was performed using awake mice as described previously (Doly et al., 2009). Initially, anesthetized animals were placed in a stereotaxic frame (David Kopf Instruments) and a stainless-steel guide cannula (CMA/12, CMA Microdialysis; outer diameter, 0.7 mm) was implanted in the NAcc. The cannula was then secured to the skull with dental cement, and the skin was sutured. Animals were kept in individual cages for a 7 d recovery period. Dialysis probes were equipped with a Cuprophan membrane (membrane length, 1 mm; diameter, 0.24 mm; cutoff, 5000 Da; Microdialysis). Using the Paxinos and Franklin (2001) atlas as our guide, we established stereotaxic coordinates for the NAcc as follows: 1.2 mm anteroposterior and 0.6 mm mediolateral relative to bregma, and 4.2 mm dorsoventral relative to the dura surface. After insertion, probes were perfused at a constant rate of 1 μl/min with artificial CSF containing the following: 154.1 mm Cl⁻, 147 mm Na⁺, 2.7 mm K⁺, 1 mm Mg²⁺, and 1.2 mm Ca²⁺, adjusted to pH 7.4 with 2 mm sodium phosphate buffer. The microdialysis experiment was performed using awake mice. Dialysates were collected every 20 min. All measurements were performed 150 min after the beginning of perfusion, by which time a steady state was achieved. Mice were injected with cocaine (20 mg/kg, i.p.) 20 min after the beginning of measurements. At the end of the experiment, all brains were fixed in a 4% formaldehyde solution and serial coronal slices were cut on a microtome. Histological examination of cannula tip placement was subsequently made on 100 μm safranine-stained coronal sections. Dialysate samples were injected without any purification into an HPLC system that consists of a pump linked to an automatic injector (Agilent, 1100), a reverse-phase column (3.5 lm, 150·4.6 mm; Zorbax SB C18, Agilent Technologies), and a coulometric detector (Coulochem III, ESA Biosciences) with a 5011 analytical cell to quantify DA or 5-HT. The first electrode was fixed at −100 mV and the second electrode at +300 mV. The gain of the detector was set at 50 nA. The signal of the second electrode was connected to an HP Chemstation for HPLC. The composition of the mobile phase was 50 mm NaH₂PO₄, 0.1 mm Na₂EDTA, 0.65 mm octyl sodium sulfate, and 14% (v/v) methanol, pH 3.5. The flow rate was set at 1 ml/min. The quantity of neurotransmitters was calculated based on standard injected in each HPLC run in the same range of concentrations as experimental samples.

Tissue preparation and immunofluorescence.

Ten minutes after cocaine or saline injection and locomotor recording, mice were rapidly anesthetized with pentobarbital (500 mg/kg, i.p.; Sanofi-Aventis) and perfused transcardially with 4% (w/v) paraformaldehyde in 0.1 m sodium phosphate buffer, pH 7.5 (Bertran-Gonzalez et al., 2008). Brains were postfixed overnight in the same solution and stored at 4°C. Thirty-micrometer-thick sections were cut with a Vibratome (Leica) and stored at −20°C in a solution containing 30% (v/v) ethylene glycol, 30% (v/v) glycerol, and 0.1 m sodium phosphate buffer, until they were processed for immunofluorescence. Free-floating sections were rinsed in Tris-buffered saline (TBS; 0.10 m Tris, 0.14 m NaCl), pH 7.4, incubated for 5 min in TBS containing 3% H₂O₂ (v/v) and 10% methanol (v/v), and rinsed three times 10 min in TBS. After 20 min incubation in 0.2% Triton X-100 in TBS (v/v), sections were rinsed three times in TBS, blocked with 30 g/L BSA in TBS, and incubated overnight (or longer as indicated) at 4°C with the primary antibodies. Antibody for tyrosine hydroxylase (TH) is a mouse monoclonal (1:750 with an incubation ≥2 d; Sigma-Aldrich) and for phosphorylated extracellular signal-regulated kinase (pERK) using rabbit polyclonal antibodies against diphospho-Thr-202/Tyr-204-ERK1/2 (1:400; Cell Signaling Technology). After incubation with primary antibody, sections were rinsed three times for 10 min in TBS and incubated for 45 min with chicken Cy3-coupled (1:400; Jackson Laboratory) or goat Alexa Fluor 488-coupled (1:400; Invitrogen) secondary antibodies. Finally, sections were rinsed for 10 min twice in TBS and twice in Tris buffer (0.25 m Tris, pH 7.4) before mounting in Vectashield (Vector Laboratories). Brain regions were identified using a mouse brain atlas and sections equivalent to 1.54 mm from bregma were taken. Sections were processed as previously described (Doly et al., 2008). Confocal microscopy and image analysis were performed at the Institut du Fer à Moulin Imaging Facility. Labeled images from each region of interest were obtained bilaterally using sequential laser-scanning confocal microscopy (SP2 and SP5, Leica). Neuronal quantification was performed in 375 × 375 μm images by counting nuclear/cytoplasm Cy3 immunofluorescence (for pERK1/2). Cell counts were performed by an observer unaware of the treatment received by the mice.

Food and cocaine self-administration.

Before cocaine self-administration testing, mice were individually housed and food-deprived to 85–90% of their ad libitum-feeding body weight, and then trained to respond for food pellets in mouse operant chambers (Med Associates) equipped with two nose-poke openings, one randomly selected as the active and the other as the inactive nose-poke opening. A cue light located above the active nose-poke opening was paired contingently with the delivery of the reinforcer. Animals were first trained to respond for food pellets (Testdiet) in 1 h daily self-administration sessions on a fixed ratio 1 (FR1) schedule of reinforcement until responding for food criteria was acquired (≥20 reinforcers, >75% of correct responding, and stabilization for 2–3 d; for time scale of these experiments, see Fig. 8a). After this initial training, mice were kept in ad libitum conditions to recover their body weight before proceeding with the catheter implantation as previously described (Soria et al., 2005). Mice were anesthetized with a mixture of ketamine/xylazine (5:1; 0.10 ml/10 g, i.p.) and implanted with indwelling intravenous SILASTIC catheters on their right jugular vein, as previously described (Soria et al., 2005). After surgery, animals were allowed to recover for 3 d before initiation of self-administration sessions. To prevent any food-seeking or food-extinction disturbance in succeeding cocaine self-administration, saline solution self-administration sessions were performed until a reliable and stable responding pattern was obtained. Mice were then trained to self-administer cocaine at the dose of 0.250 mg/kg/infusion during 8 d on a FR1 schedule of reinforcement, with stability criteria set at ≥5 cocaine infusions and 75% responding on the active nose-poke opening over 3 d. Once stable patterns of responses were established, all mice underwent dose–response experiments, where cocaine was presented at doses of 0.125 or 0.500 mg/kg/infusion over 4 consecutive days. Subsequently, a progressive ratio procedure was performed to test the motivation of the mice to work for cocaine at the dose of 0.125 mg/kg/infusion, where the response requirements to earn an infusion escalated according to the following series: 1-2-3-5-12-18-27-40-60-90-135-200-300-450-675-1000. The patency of intravenous catheters was evaluated at the end of the experiments by an infusion of 0.05 ml of thiopental sodium (5 mg/ml; Braun Medical) through the catheter. If prominent signs of anesthesia were not apparent within 3 s of the infusion, the mouse was removed from the experiment.

Sucrose preference.

Sucrose preference was evaluated in the two-bottle choice test in individually caged Htr2b^+/+ and Htr2b^−/− mice. In the first phase, two bottles of water were available over 2 consecutive days. Then, the liquid from one of the bottles was replaced with a 2% sucrose solution, and made available over 3 d. Total liquid intake, as well as sucrose preference, was determined by weighing the bottles once every morning.

Single-cell reverse-transcription PCR.

Swiss-Webster mice carrying Drd2-EGFP bacterial artificial chromosome transgenes were generated by the Gene Expression Nervous System Atlas program at Rockefeller University. For single-cell reverse-transcription PCR (RT-PCR) experiments, 1–2-week-old Drd2-EGFP mice were used to direct EGFP protein expression to D2-receptor-expressing neurons. Mice were anesthetized and decapitated, and the brain was rapidly dissected out. Horizontal slices (250 μm thick) were prepared using a vibratome, in ACSF supplemented with sucrose. After a 1 h recovery period, individual slices were placed in an electrophysiology chamber continuously perfused with ACSF bubbled with carbogen and maintain at 22°C. Neurons were visualized using an Olympus BX51WI upright microscope holding ×5 and ×40 objectives, a fluorescent lamp, and infrared, red, and green fluorescence filters. The methodology involving harvesting of cytoplasmic content and subsequent single-cell PCR amplification has been described previously (Cauli et al., 1997). Briefly, borosilicate glass pipettes (3–5 MΩ) were made in a HEKA PIP5 puller and filled with 8 μl of autoclaved RT-PCR internal solution containing (in mm) the following: 144 K-gluconate, 3 MgCl₂, 0.5 EGTA, 10 HEPES, pH 7.2 (285/295 mOsm). Single DA neurons in the VTA and substantia nigra compacta (SNc) were approached with a pipette and, after a whole-cell connection was established, cytoplasmic content of the cell was harvested by applying gentle negative pressure to the pipette. Cell content was expelled into a tube where an RT reaction was performed in a final volume of 10 μl. Target cDNA sequences were thereafter amplified by conducting a multiplex nested PCR, designed to simultaneously detect the enzyme TH, the D2 receptor, and 5-the HT_2B receptors. The primers used were as follows: TH, external sense CTGGCCTTCCGTGTGTTTCAGTG, external antisense CCGGCTGGTAGGTTTGATCTTGG, internal sense AGTGCACACAGTACATCCGTCAT and internal antisense GCTGGTAGGTTTGATCTTGGTA; D2 receptor external sense GCAGCCGAGCTTTCAGAGCC, external antisense CCTGCGGCTCATCGTCTTAAG, internal sense AGAGCCAACCTGAAGACACCAC and internal antisense CTTAAGGGAGGTCCGGGTTTTG; 5-HT_2B external sense CACTGGAGAAAAGGCTGCAGTA, external antisense TTGCACTGATTGGCCTGAATTG, internal sense GGCTATATGGCCCCTCCCAC and internal antisense GGTCCAGGGAAATGGCACAG.

Initially, all three genes were simultaneously amplified in a single tube using 10 μl of cDNA, 200 nm of each primer, and 2.5 U of Taq polymerase in a final volume of 100 μl. The PCR was performed using a 6 min hot start at 94°C, followed by a 21-cycle program (94°C for 30 s, 60°C for 30 s, and 72°C for 30 s). Subsequently, 2 μl of the amplified cDNA was used as the template for the second amplification step, in which each gene was individually amplified in a separate tube, with a 35-cycle program using the same cycling conditions as mentioned above, in a final volume of 100 μl. The products of the second PCR were analyzed by electrophoresis in 2.5% agarose gels using ethidium bromide. The sizes of the PCR-generated fragments were as predicted by the mRNA sequences and were further verified by direct sequencing of the final products.

In vivo electrophysiology: extracellular single-cell recordings.

Mice were anesthetized with chloral hydrate (400 mg/kg, i.p.) supplemented as required to maintain optimal anesthesia throughout the experiment, and were positioned in a stereotaxic frame (David Kopf Instruments). Body temperature was kept at 37°C by means of a thermostatically controlled heating blanket. Procedures for DA cell electrophysiological recording were described previously (Mameli-Engvall et al., 2006). An incision was made in the midline to expose the skull. A burr hole was drilled above the VTA (coordinates: between 3.5 ± 0.3 mm posterior to bregma and 0.5 ± 0.3 mm lateral to midline; Paxinos and Franklin, 2001). Recording electrodes were pulled with a Narishige electrode puller from borosilicate glass capillaries with outer and inner diameters of 1.50 and 1.17 mm, respectively (Harvard Apparatus). The tips were broken under microscope control and filled with 1.5% Neurobiotin in 0.5% Na-acetate. These electrodes had tip diameters of 1–2 mm and impedances of 4–8 MΩ. They were lowered through the burr hole with a microdrive, and a reference electrode was placed in the subcutaneous tissue. Electrical signals were amplified by a high-impedance amplifier (Molecular Devices) and monitored visually with an oscilloscope (Tektronix, TDS 2002) and audibly through an audio monitor (A.M. Systems). When a single unit was well isolated, the oscilloscope sweep was triggered from the rising phase of the action potential and set sufficiently fast to display the action potential over the entire screen (usually 0.5 ms per unit). Such continuous observation of the expanded action potential provided assurance that the same single unit was being monitored throughout the experiment. The unit activity digitized at 25 kHz was stored in the Spike2 program (Cambridge Electronic Design).

Firing pattern quantification.

DA cell firing in vivo was analyzed with respect to the average firing rate and the percentage of spikes within a burst [SWBs; the number of SWBs divided by total number of spikes in a given window of 1 min duration (%SWB)]. DA cell firing in vivo was analyzed with respect to the average firing rate and the %SWB. Neuron basal activity was defined on the basis of ≥5 min or 500 spikes. The electrophysiological characteristics of VTA neurons were analyzed in the active cells encountered by systematically passing the microelectrode in a stereotaxically defined block of brain tissue, including the VTA. Its margins ranged from 2.92 to 3.88 mm posterior to bregma, 0.24 to 0.96 mm mediolateral with respect to the bregma point, and 3.7 to 4.7 mm ventral to the cortical surface, according to the coordinates of Paxinos and Franklin (2001). Sampling was initiated on the right side and then on the left side. Each electrode descent was spaced ≥10 μm from the others.

DA cell identification.

Extracellular identification of DA neurons was based on their location as well as on the set of unique electrophysiological properties that characterize these cells in vivo: (1) a typical triphasic action potential with a marked negative deflection; (2) a characteristic long-duration (>2.0 ms) action potential; (3) an action potential width from start to negative of >1.1 ms; (4) a slow firing rate (<10 Hz) with an irregular single spiking pattern and occasional short, slow bursting activity. These electrophysiological properties distinguish DA from non-DA neurons. The mouse was killed with an overdose of anesthetic. The brain was removed and placed in a 4% paraformaldehyde solution. Sixty-micrometer-thick VTA sections were cut and stained with Neurobiotin and TH antibody (a mouse monoclonal antibody for TH, 1:500 with an incubation >2 d; Sigma-Aldrich), and the recorded neurons were identified by fluorescence microscopy. We also added two criteria: (1) that the recording be stable (i.e., the absence of cell perturbation following our saline solution injection); and (2) that the recorded cells be >4 mm from the surface of the brain. These parameters have been used classically to identify DA cells (Mameli-Engvall et al., 2006).

Electrophysiological response to cocaine and quinpirole.

The firing rate and %SWB were evaluated using a 60 s moving window and a 15 s time step. Each cell activity was rescaled by its baseline value averaged during the 3 min period before 10 μl of cocaine (20 mg/kg) or quinpirole (0.25–0.50 mg/kg) in 0.9% NaCl was injected intraperitoneally. For firing frequency, rescaling was defined using x * 100/xb with xb being the baseline firing frequency. The results are presented as mean ± SEM. The effect of cocaine or quinpirole was tested by comparing the maximum firing frequency observed during baseline and after cocaine injection. For each neuron, we determined xav, the maximum firing frequency fluctuations before cocaine injections (during the 2.5 min period used as baseline); xav = max (x)av − mean (x) av, and xap is the maximum firing frequency after cocaine (or quinpirole) injection (during the 3 min period after drug injection). We used a paired nonparametric Wilcoxon test (Wilcoxon signed-rank test) to compare xav and xap for firing frequency in the two populations.

Electrophysiological recordings from brain slices.

AMPA/NMDA ratio of evoked EPSCs from putative DA neurons of the VTA were obtained with whole-cell voltage-clamp recordings using a CsCl-based internal medium, as described previously (Glangetas et al., 2015). Six-to-seven-week old Htr2b^+/+ control and Htr2b^−/− mice were anesthetized (ketamine/xylazine) for slice preparation. Horizontal 250 μm slices were prepared in bubbled ice-cold 95% O₂/5% CO₂-equilibrated solution containing the following (in mm): 110 cholineCl, 25 glucose, 25 NaHCO₃, 11.6 ascorbic acid, 3.1 Na⁺-pyruvate, 2.5 KCl, 1.25 NaH₂PO₄, 7 MgCl₂, 0.5 CaCl₂. The slices were then heated for 10 min in the same medium at 32°C. Subsequently, slices were stored at room temperature in 95% O₂/5% CO₂-equilibrated ACSF containing the following (in mm): 124 NaCl, 26.2 NaHCO₃, 11 glucose, 2.5 KCl, 1 NaH₂PO₄, 2.5 CaCl₂, 1.3 MgCl₂. Slices were kept at 32–34°C in a recording chamber and were continuously perfused with 2.5 ml/min ACSF. Whole-cell voltage-clamp recording techniques were used to measure excitatory synaptic responses of the VTA. Synaptic currents were evoked by pulses (60 μs) delivered at 0.1 Hz through a glass pipette placed 200 μm rostral to the patched neurons. Recordings were made in the presence of picrotoxin (100 μm) to block GABA_A-receptor-mediated currents. Putative DA neurons were identified as large cells (>30 pF capacitance) in the lateral part of the VTA, which are prone to project to the NAcc (Lammel et al., 2008). Currents were amplified, filtered at 5 kHz, digitized at 20 kHz, and recorded at a holding potential of +40 mV (IGOR PRO, Wavemetrics). Access resistance was monitored by a step of −4 mV (0.1 Hz) and experiments were discarded if the access resistance increased >20%. The internal solution contained the following (in mm): 130 CsCl, 4 NaCl, 2 MgCl₂, 1.1 EGTA, 5 HEPES, 2 Na₂ATP, 5 Na⁺-creatine-phosphate, 0.6 Na₃GTP, and 0.1 spermine, with a liquid junction potential of −3 mV. AMPA-receptor (AMPAR)-EPSCs were pharmacologically isolated using NMDA-receptor (NMDAR) antagonist APV (50 μm), while NMDAR EPSCs were then calculated by subsequent digital subtraction. The ratio of AMPAR/NMDAR responses was calculated by taking the peak values of these averaged (20 sweeps) currents. All drugs were obtained from Abcam, Tocris Bioscience, and HelloBio. APV was dissolved in water, whereas picrotoxin was dissolved in DMSO (diluted 1000× in the final volume). On-line/off-line analysis was performed using IGOR-6 (Wavemetrics) and Prism (GraphPad). Compiled data are expressed as mean ± SEM.

Immunoblot analysis.

Wild-type and mutant mice (2-month-old, age-matched) were killed by decapitation and their brains were immediately dissected out from the skull and frozen on dry ice. Microdiscs of tissue were punched out from frozen slices (500 μm thick) within the striatum using a stainless-steel cylinder (1.4 mm diameter). Samples were homogenized in 1% SDS, equalized for their protein content, and analyzed by Western blot. The antibody dilutions were 1/1000 and 1/500 for antibodies against Golf and D1 receptor, respectively. Antibody for Golf was from our laboratory (Corvol et al., 2001). Antibody for D1 receptor was from Luedtke et al. (1999). Antibodies were revealed by Fluoprobes 682 goat anti-rabbit or mouse IgG (Interchim) at a 1:5000 dilution. The fluorescent immunocomplexes were detected with Odyssey (LI-COR Biosciences). Quantification was performed by measuring the average intensity in regions of interest using the Odyssey software and data were analyzed with the Prism 6 software (GraphPad Software).

Retrograde tracing of VTA or SNc neurons.

Drd2-EGFP mice were anesthetized with ketamine (50 mg/kg) and xylazine (2 mg/kg) and fixed in a stereotaxic apparatus. Stereotaxically guided injections were made through holes in the dorsal surface of the cranium. Glass capillary tubes were pulled (HEKA pipette puller PIP5) and tips were broken to 40 μm diameter. Capillaries were filled with Dextran Alexa Fluor 568 (Invitrogen). Pressure injections of tracer (0.1 μl for 10 min) were targeted to the NAcc (80 nl) or dorsal striatum (200 nl) for labeling VTA or SNc neurons, respectively. Micropipettes were left in place 10 min before removal to minimize leakage. The stereotaxic coordinates used for these injections were obtained from the Paxinos and Franklin (2001) atlas adapted and checked in pilot experiments for postnatal day 15 mice (NAcc: +1 mm anteroposterior and +0.6 mm mediolateral relative to bregma; −3.5 mm dorsoventral relative to the dura surface; dorsal striatum: +1 mm anteroposterior and +1.5 mm mediolateral relative to bregma; −2 mm dorsoventral relative to the dura surface). Correct placement site was verified by red-dextran injection. After 10 d, surviving animals were used in the single-cell PCR experiment.

Binding assays.

Mice were decapitated and brain regions, including the prefrontal cortex and striatum, were dissected on ice and homogenized with 25 ml of ice-cold buffer containing 50 mm Tris, 5 mm MgCl₂, pH 7.4. Homogenates were centrifuged for 20 min at 15,000 × g. The pellet was resuspended and centrifuged under the same condition three times. To the final suspension (0.2–0.6 mg/ml) was added for 1 h, [³H]raclopride (81.3Ci/mmol; PerkinElmer) or [³H]SCH23390 (85.6Ci/mmol; PerkinElmer; 2 nm) for binding the D2 and D1 receptors, respectively. The process was terminated by immersing the tubes in ice-cold buffer followed by rapid filtration through Whatman GF/B filters (Sigma-Aldrich). Radioactivity was measured using liquid scintillation counting. Binding data were analyzed using the iterative nonlinear fitting software GraphPad Prism 6 to estimate dissociation constants (K_D) and maximum number of sites (B_max).