Article Figures & Data
Figures
- Figure 1.
IC excitatory and inhibitory neurons as starter cells for rabies-based monosynaptic tracing. A, Characterization of Vglut2-Cre mice with Vglut2 ISH (top row) and VGAT-Cre mice with VGAT ISH (bottom row). Almost all EGFP-positive neurons expressed Vglut2 mRNA in Vglut2-Cre mice (top, arrowheads) and VGAT mRNA in VGAT-Cre mice (bottom, arrowheads). B, Construction of the AAV helper virus and rabies virus (left) and time course of the experiment (right). C, Schematic diagram of extrinsic connections to the IC. Cre-expressing–infected cells express EGFP-TVA (green dots) and RG. Neurons that contact these neurons are infected retrogradely and express DsRed alone (red dots, input neurons). Neurons expressing both EGFP and DsRed are the starter neurons (yellow dots). D Left, An image of the IC showing the input (red) and starter neurons (yellow) superimposed on the drawing of the IC subdivisions. The ICC (central IC) is the core, and the ICD (dorsal IC) and ICX (external IC) are grouped as the shell. The DsRed fluorescence intensity was enhanced to emphasize the labeled fibers primarily located in the ICD and ICX. Right, Starter neurons were identified by colocalization of EGFP (green) and DsRed (red) protein. E, Injection of AAV-DIO-RG and RV without prior AAV-DIO-EGFP-TVA injection in the Vglut2-Cre mice resulted in no DsRed-labeled neurons. F, Injection of AAV-DIO-EGFP-TVA and RV without prior AAV-DIO-RG injection in the Vglut2-Cre mice resulted in no DsRed-labeled input neurons. G, Injecting AAV-DIO-EGFP-TVA, AAV-DIO-RG, and RV to the wild-type mice and performed ISH for VGAT mRNA to identify the GABAergic neurons in the injection site. H, Non-Cre, nonspecific-labeled RV neurons that expressed DsRed in the injection site. I, GABAergic neurons that identified by ISH. J, Six RV neurons (arrowheads) among the 27 RV neurons were GABAergic. K, The 19.9% proportion of Cre-independent RV neurons was GABAergic (14 brain slices collected from 4 mice). Scale bars: A, H, I, J, 20 μm; D, Left, 250 μm; D, Right, 50 μm; E, F, 200 μm.
- Figure 2.
Brainwide monosynaptic inputs to IC excitatory and inhibitory neurons. A, The distribution of the injection center of all cases examined in this study. Red dots indicate Vglut2-Cre cases. Blue dots indicate VGAT-Cre cases. Numbers indicate the animal ID (see also Fig. 2B). B, Core and shell cases of Vglut2-Cre and VGAT-Cre mice. Cases in which the proportion of starter cells in the ICC and IC shell met the 70% threshold were classified as core and shell cases, respectively. The remaining cases with a lower threshold are shown with a faint color (A, B). C, The number of starter neurons ranged from 89 to 2377. D, The number of input neurons ranged from 3482 to 13,208. E, A linear relationship was detected between the number of starter and input neurons.
- Figure 3.
Characterization of the input neurons (red) and collicular fibers (green) in the ascending, descending, and neuromodulator nuclei of Vglut2-Cre mice. i, Ipsilateral inputs; c, contralateral inputs. A, Input neurons in the ascending nuclei, the cDCN and cVCN, with IC descending fibers. B, cVCN input neurons (red, arrows) were negative for VGAT mRNA (green). C, Inputs from the ipsilateral SOC subnuclei. In the case shown here, input neurons were found in the LSO, MSO, and SPN, along with dense IC descending fibers in the VTB. DPO, Dorsal periolivary nucleus; VMPO, ventromedial periolivary nucleus; VTB, ventral nucleus of the trapezoid body; LTB, lateral nucleus of the trapezoid body; SPN, superior paraolivary nucleus; MNTB, medial nucleus of the trapezoid body. D, Input neurons in ascending nuclei, the iVLL and iDLL, with IC descending fibers. E, The iVLL input neurons were determined to be inhibitory due to the colocalization (arrowheads) of VGAT mRNA (green) with DsRed (red). F, Left, Input neurons came from the PIL but were absent in the dorsal, medial, and ventral part of the medial geniculate nucleus (MGD, MGM, and MGV). SG, Suprageniculate thalamic nucleus; PTL, pretectothalamic lamina. Middle, Cortical input neurons from layer 5 (L5) and layer 6 (L6). Right top, Location of the auditory thalamus and cortex in the brain atlas. Right, bottom, Distribution of input neurons in the AC and temporal association area (TEA). G, Input neurons from neuromodulatory nuclei, the dorsal raphe (left) and SPF (right), with reciprocal IC projection fibers. Scale bars: A, C, D, E, Left, 50 μm; B, 20 μm; E, Right, 20 μm; F, 100 μm; G, 10 μm.
- Figure 4.
Topographical distribution of the starter and input neurons. Representative starter neurons (A) and input neurons (B) of corresponding core and shell cases (C, D) for Vglut2-Cre and VGAT-Cre mice. Yellow represents the ipsilateral IC, which contains starter neurons. Red dots indicate input neurons.
- Figure 5.
Dominant ascending inputs in the shell subdivision. A, The ratio of descending inputs to ascending inputs in shell glutamatergic neurons was not significantly higher than that in core glutamatergic or shell GABAergic neurons, but the ratio was still far <1. Larger dots indicate two shell cases without starter neurons in the core subdivision. B, Shell glutamatergic and GABAergic neurons received more ascending inputs than descending or core inputs. C, In the classical model, neurons within the IC shell subdivision are thought to receive more descending or core inputs. D, In the new model, neurons within the IC shell subdivision receive more ascending inputs. *p < 0.05, **p < 0.01, ***p < 0.001, ****p < 0.0001. A, Two-way ANOVA with Bonferroni correction. B, One-way ANOVA with Tukey correction.
- Figure 6.
Glutamatergic neurons in the core and shell are subdivided into populations that receive inputs from different combinations of nuclei, whereas GABAergic neurons in the core receive inputs from the same combination of nuclei. A, In the core subdivision, the iLSO and cDCN inputs are negatively correlated for glutamatergic neurons but positively correlated for GABAergic neurons. r, Pearson's correlation coefficient. Each dot indicates an individual mouse. B, C, Patterns of Pearson's correlation coefficient values and cluster trees showing the dissimilarities in input nuclei. In the core subdivision, three clusters of input nuclei that shared a high correlation were found for glutamatergic neurons, suggesting three populations that received inputs from different combinations of nuclei (B, top), whereas all input nuclei shared a high correlation for GABAergic neurons, suggesting a single population that received inputs from the same combination of nuclei (B, bottom). Likewise, in the shell subdivision, two populations of glutamatergic neurons were identified that received inputs from different combinations of nuclei (C, top, “I” and “II”), whereas the GABAergic population was not separated as they received inputs from mixed combinations of nuclei (C, bottom). D, Suggested bipartite domain of glutamatergic neurons: The deep shell domain (“I” and triangles in L3) mainly received ascending inputs. In contrast, the nonlemniscal domain in the other part of the shell (“II” and open circles in L3 and L1/2) mainly received descending inputs.
- Figure 7.
Extrinsic inputs and outputs differ between glutamatergic and GABAergic neurons. A, Summary of the proportion of extrinsic inputs from the nuclei categorized as ascending, descending, neuromodulatory nuclei, and contralateral IC. Bars represent the average percentage inputs of all input neurons per region (mean ± SEM). The statistical significance was calculated from a two-way ANOVA with Bonferroni correction for the ascending group of nuclei and a multiple two-tailed unpaired t test followed by Holm–Sidak correction for the other groups. B, C, Projections to the PAG and SC. B, Left, Projections to the PAG in VGAT-Cre mice. Inset, DR, Dorsal raphe. Magnified images show the axonal fibers within the PAG. Right, Projections to the PAG in Vglut2-Cre mice. C, Left, Projections to the SCd in Vglut2-Cre mice. Superficial, intermediate, and deep layer of the SC (SCs, SCi, and SCd). Right, Magnified images show the axonal fibers within the SCd. Scale bar, 100 μm. D, Schematic diagram drawn from the current results and previous studies. Red and blue represent soma and axon of excitatory and inhibitory neurons, respectively. Core GABAergic neurons received a higher proportion of inhibitory VLL inputs than excitatory neurons (wide vs slim solid line) and projected to the core thalamus (dotted line). Shell GABAergic neurons tended to receive a higher proportion of excitatory VCN inputs than glutamatergic neurons and projected to the shell thalamus and PAG. Core glutamatergic neurons received a higher proportion of VCN inputs than GABAergic neurons and projected to the core thalamus, whereas shell glutamatergic neurons tended to receive a higher proportion of cortical inputs than inhibitory neurons, and projected to the shell thalamus, PAG, and SC. *p < 0.05; **p < 0.01; ***p < 0.001; ****p < 0.0001.
- Figure 8.
Disinhibitory commissural connections. A, Left, Commissural projection pattern of shell GABAergic neurons. Right, Magnified images show the axonal fibers in the core (1 and 2) and shell (3). Denser fibers were found in the contralateral shell. B, Symmetrical contralateral input pattern in VGAT-Cre mice. C, ISH staining for VGAT mRNA (green) in contralateral input neurons (red) in a VGAT-Cre mouse. Top, A few VGAT-expressing input neurons (yellow) were found in the contralateral core. Bottom, Many of the input neurons expressed VGAT mRNA in the contralateral shell. Arrowheads indicate VGAT-positive. Arrows indicate VGAT-negative. Scale bars: A, left, 250 μm; A, right, C, 20 μm; B, 200 μm. *Location of the injection sites. D, GABAergic neurons received a higher proportion of VGAT-positive input from the contralateral IC shell than glutamatergic neurons. ****p < 0.0001 (two-tailed unpaired t test followed by Holm–Sidak correction). E, Inhibitory dominant projection in the shell (blue color solid line) and excitatory dominant projection in the core (red color solid line). Contralateral inhibition of ipsilateral GABAergic neurons could disinhibit their targets through efferent projections (blue color dotted line).
- Figure 9.
Local circuits. A, V-shape intrinsic connection patterns of Vglut2- and VGAT-Cre mice with the approximate locations of the starter neurons labeled (yellow spot). Scale bars, 150 μm. B, The ratio of intrinsic (intersubdivision plus local) inputs to extrinsic inputs was higher in the IC shell neurons than in the core neurons and higher in the IC GABAergic neurons than in the glutamatergic neurons. *p < 0.05 (two-tailed unpaired t test). **p < 0.01 (two-tailed unpaired t test). C, A model that explains the multisensory function of the ICX. The shell GABAergic module receives ipsilateral somatosensory inputs (black solid line). In the shell extramodular region, inhibitory neurons receive a higher proportion of ascending VCN inputs (red solid line), and shell inhibitory neurons mainly innervate contralateral shell inhibitory neurons (blue solid line that crossed midline). Those inhibitory neurons also receive more intrinsic inputs (blue solid line) and may project to neighbor neurons (blue dotted line).
Tables
Probe Accession no. Probe region Primer sequence Vglut2 NM_080853-3 720-1635 Forward: TGGATGGTCGTCAGTATTT Reverse: ACCGTAAGATTTGGTGGT VGAT NM_031782 239-1192 Forward: AGGGAGACATTCATTATCAGCG Reverse: AGGGCAACGGGTAGGACA
