Skip to main content

Main menu

  • HOME
  • CONTENT
    • Early Release
    • Featured
    • Current Issue
    • Issue Archive
    • Collections
    • Podcast
  • ALERTS
  • FOR AUTHORS
    • Information for Authors
    • Fees
    • Journal Clubs
    • eLetters
    • Submit
  • EDITORIAL BOARD
  • ABOUT
    • Overview
    • Advertise
    • For the Media
    • Rights and Permissions
    • Privacy Policy
    • Feedback
  • SUBSCRIBE

User menu

  • Log in
  • My Cart

Search

  • Advanced search
Journal of Neuroscience
  • Log in
  • My Cart
Journal of Neuroscience

Advanced Search

Submit a Manuscript
  • HOME
  • CONTENT
    • Early Release
    • Featured
    • Current Issue
    • Issue Archive
    • Collections
    • Podcast
  • ALERTS
  • FOR AUTHORS
    • Information for Authors
    • Fees
    • Journal Clubs
    • eLetters
    • Submit
  • EDITORIAL BOARD
  • ABOUT
    • Overview
    • Advertise
    • For the Media
    • Rights and Permissions
    • Privacy Policy
    • Feedback
  • SUBSCRIBE
PreviousNext
Research Articles, Neurobiology of Disease

Activation of Rod Input in a Model of Retinal Degeneration Reverses Retinal Remodeling and Induces Formation of Functional Synapses and Recovery of Visual Signaling in the Adult Retina

Tian Wang, Johan Pahlberg, Jon Cafaro, Rikard Frederiksen, A.J. Cooper, Alapakkam P. Sampath, Greg D. Field and Jeannie Chen
Journal of Neuroscience 21 August 2019, 39 (34) 6798-6810; DOI: https://doi.org/10.1523/JNEUROSCI.2902-18.2019
Tian Wang
1Zilkha Neurogenetic Institute, Department of Physiology and Neuroscience, Keck School of Medicine, University of Southern California, Los Angeles, California 90089,
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
Johan Pahlberg
2Department of Ophthalmology, Stein Eye Institute, University of California, Los Angeles, California 90095, and
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
  • ORCID record for Johan Pahlberg
Jon Cafaro
3Department of Neurobiology, Duke University School of Medicine, Durham, North Carolina 27710
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
Rikard Frederiksen
2Department of Ophthalmology, Stein Eye Institute, University of California, Los Angeles, California 90095, and
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
  • ORCID record for Rikard Frederiksen
A.J. Cooper
1Zilkha Neurogenetic Institute, Department of Physiology and Neuroscience, Keck School of Medicine, University of Southern California, Los Angeles, California 90089,
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
Alapakkam P. Sampath
2Department of Ophthalmology, Stein Eye Institute, University of California, Los Angeles, California 90095, and
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
  • ORCID record for Alapakkam P. Sampath
Greg D. Field
3Department of Neurobiology, Duke University School of Medicine, Durham, North Carolina 27710
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
  • ORCID record for Greg D. Field
Jeannie Chen
1Zilkha Neurogenetic Institute, Department of Physiology and Neuroscience, Keck School of Medicine, University of Southern California, Los Angeles, California 90089,
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
  • ORCID record for Jeannie Chen
  • Article
  • Figures & Data
  • Info & Metrics
  • eLetters
  • PDF
Loading

Abstract

A major cause of human blindness is the death of rod photoreceptors. As rods degenerate, synaptic structures between rod and rod bipolar cells disappear and the rod bipolar cells extend their dendrites and occasionally make aberrant contacts. Such changes are broadly observed in blinding disorders caused by photoreceptor cell death and are thought to occur in response to deafferentation. How the remodeled retinal circuit affects visual processing following rod rescue is not known. To address this question, we generated male and female transgenic mice wherein a disrupted cGMP-gated channel (CNG) gene can be repaired at the endogenous locus and at different stages of degeneration by tamoxifen-inducible cre-mediated recombination. In normal rods, light-induced closure of CNG channels leads to hyperpolarization of the cell, reducing neurotransmitter release at the synapse. Similarly, rods lacking CNG channels exhibit a resting membrane potential that was ~10 mV hyperpolarized compared to WT rods, indicating diminished glutamate release. Retinas from these mice undergo stereotypic retinal remodeling as a consequence of rod malfunction and degeneration. Upon tamoxifen-induced expression of CNG channels, rods recovered their structure and exhibited normal light responses. Moreover, we show that the adult mouse retina displays a surprising degree of plasticity upon activation of rod input. Wayward bipolar cell dendrites establish contact with rods to support normal synaptic transmission, which is propagated to the retinal ganglion cells. These findings demonstrate remarkable plasticity extending beyond the developmental period and support efforts to repair or replace defective rods in patients blinded by rod degeneration.

SIGNIFICANCE STATEMENT Current strategies for treatment of neurodegenerative disorders are focused on the repair of the primary affected cell type. However, the defective neurons function within a complex neural circuitry, which also becomes degraded during disease. It is not known whether rescued neurons and the remodeled circuit will establish communication to regain normal function. We show that the adult mammalian neural retina exhibits a surprising degree of plasticity following rescue of rod photoreceptors. The wayward dendrites of rod bipolar cells re-establish contact with rods to support normal synaptic transmission, which is propagated to the retinal ganglion cells. These findings support efforts to repair or replace defective rods in patients blinded by rod cell loss.

  • gene therapy
  • neural plasticity
  • neural transmission
  • photoreceptor cell death
  • retinal circuitry
  • retinal degeneration

Introduction

Diseases that afflict sensory systems typically result from deficiencies within the sensory receptor cells themselves, either within sensory transduction or synaptic transmission (Bermingham-McDonogh and Reh, 2011). Deficits in visual processing are no exception, with the majority of blinding diseases (such as retinitis pigmentosa and age-related macular degeneration) result from the dysfunction or death of the primary input cells, the retinal rod and cone photoreceptors (Quartilho et al., 2016). Synaptic remodeling of retinal circuits, in particular between photoreceptor cells and their downstream neurons, occur early in retinal degeneration (Soto and Kerschensteiner, 2015). Remodeling of bipolar and horizontal cell dendrites is thought to occur in response to deafferentation (Marc and Jones, 2003). Changes that occur include homeostatic downregulation of synaptic structures, exuberant extension of dendritic processes, which sometimes contact off-target sites (Marc and Jones, 2003; Puthussery and Taylor, 2010), and even switching of postsynaptic receptor types from mGluR to iGluR expression (Chua et al., 2009). In genetically inherited forms of retinal degeneration, synaptic changes may already occur during a critical period of retinal development. It is not known how these changes in retinal circuitry may ultimately limit recovery of normal vision, although several approaches are being implemented to rescue dying photoreceptors using gene therapy, or replace them with stem cells (Scholl et al., 2016; Garg et al., 2017; Yao et al., 2018). To address this gap in knowledge, this study focuses on cellular plasticity in retinal circuits of young adult mice with rod degeneration, and how the synaptic structures and circuits that receive rod input respond to rod rescue.

We genetically engineered a mouse line in which rod function can be uniformly rescued via tamoxifen-induced cre-mediated recombination. The line was generated to lack expression of the cyclic nucleotide gated (CNG) channel β-1 subunit (CNGB1) because of an insertion of a neomycin cassette at the endogenous gene to disrupt expression (Wang and Chen, 2014; T. Wang et al., 2017). This mouse model recapitulates the effects of mutations in human CNGB1 and CNGA1 genes that cause autosomal recessive retinitis pigmentosa (Biel and Michalakis, 2007). Without the CNGB1 subunit, the CNG channels in rod outer segments fail to form normally functioning channels, which leads to a slow form of rod death that occurs over 4–6 months (Zhang et al., 2009; T. Wang et al., 2017), or longer (Hüttl et al., 2005). Importantly, the neomycin cassette is flanked by loxP sites, which allows for cre-mediated excision and the expression of CNGB1 from the endogenous locus. Thus, this mouse line provides an opportunity to introduce precisely a “cure” for the underlying genetic defect at different time points during degeneration.

We use this novel mouse line to determine the extent to which activating rod input in the degenerating retina allows recovery of the structure and function of well defined rod-driven retinal circuits in young adult mice. The lack of CNG channels caused stereotypic degenerative changes in the retina that included rhodopsin mislocalization, activation of Müller glia, and a reduction of presynaptic and postsynaptic proteins between rods and rod bipolar cells by as early as 4 weeks of age. Signal transmission from rods to rod bipolar cells was abrogated and sensitivity of retinal ganglion cells (RGCs) was reduced ~100-fold. Tamoxifen-induced restoration of CNG channel expression initiated at 4 weeks of age led to an expected recovery of rod photoreceptor function. Importantly, we show that initiation of rod input in the deafferented adult retina also induced a high degree of structural plasticity between rods and their primary postsynaptic partner, rod (ON) bipolar cells. Specifically, rod bipolar cell dendrites sprouted fine tips and mGluR6 clusters formed on these tips, which made new synapses with rods. This structural transformation resulted in near-normal light responses in both bipolar cells and RGCs, the output neurons of the retina. Our findings indicate substantial plasticity in the adult mammalian retina, suggesting favorable outcomes for interventions targeting the rescue of dysfunctional rods from death.

Materials and Methods

Generation of transgenic mice.

The use of mice in these experiments was in accordance with the National Institutes of Health guidelines and the Institutional Animal Care and Use Committee of our respective universities. Targeting of the neoloxP to the Cngb1 locus in mouse embryonic stem cells and generation of transgenic mice from verified stem cell clones were described previously (Chen et al., 2010). The CAGGCre-ER transgenic line, Tg(CAG-cre/Esr1*)5Amc/J, was obtained from The Jackson Laboratory and crossed with Cngb1neo/neo mice.

Tamoxifen treatment.

One-hundred milligrams of tamoxifen was dissolved in 500 μl of 95% ethanol and diluted with 4.5 ml corn oil to give final concentration of 20 mg/ml. Four-week-old cre-positive mice were given a dose of 3 mg/25 g body weight by oral gavage for 4 or 7 consecutive days. Alternatively, mice were fed tamoxifen-augmented chow (500 mg/kg, Envigo) for 7 d. In control experiments shown in Figure 1, some cre-negative mice did not receive tamoxifen. For all other experiments, cre-negative littermate mice were also treated with tamoxifen to control for the possible effect of tamoxifen on photoreceptor cell survival (X. Wang et al., 2017).

PCR genotyping.

Genomic DNA was isolated from the neural retina. Three PCR primers were used to detect the presence or absence of the neoloxP cassette. Primer 1 sequence (GTTTTATGTAGCAGAGCAGGGAC) is located on intron 19, primer 2 sequence (GAGGAGTAGAAGGTGGCGC) is on neoloxP, and primer 3 sequence (CCACTCCTTAGTACATACCTAAGC) is located on exon 20. A product size of 620 bp from primer pairs (2 + 3) indicates the presence of neoloxP, and an 802 bp PCR band from primer pairs (1 + 3) indicates the absence of the neoloxP insert.

Retinal morphology.

Mice were rendered unconscious by isoflurane inhalation and immediately followed by cervical dislocation. Retinal sections were prepared as previously described (Concepcion and Chen, 2010; Wang and Chen, 2014). Briefly, before enucleation, eyes were marked for orientation by cauterization on the superior aspect of the cornea. Eyes were placed in ½ Karnovsky buffer (2.5% glutaraldehyde, 2% formaldehyde in 0.1 m cacodylate buffer, pH 7.2). The cornea and lens were removed, and the remaining eyecup was further fixed overnight. Fixed eyes were rinsed in 0.1 m cacodylate buffer, fixed for 1 h in 1% OsO4, dehydrated in graded EtOH and embedded in epoxy resin. Eyecups were hemisected along the superior–inferior axis, and 1 μm sections along the central meridian were obtained for light micrographs. For transmission electron microscopy, 50 μm sections were obtained, stained with uranyl acetate and lead citrate as described previously (Concepcion and Chen, 2010). Images were taken with a JEOL JEM 2100 microscope.

Immunocytochemistry.

Eyecups were prepared as described above in Retinal morphology section, except the tissues were dissected in cold 4% formaldehyde in PBS and further fixed for 15 min on ice. For frozen sections, eyecups were rinsed in cold PBS, placed in 30% sucrose for 1 h, embedded in Tissue-Tek OCT Compound (Sakura Finetek) and flash frozen in liquid N2. Ten micrometer frozen sections were obtained. For retinal flat mounts, four relaxing cuts (0°, 90°, 180°, 270°) were made on the edge of the neural retina and the flattened tissue was immobilized on a piece of nitrocellulose membrane (Whatman, GE Healthcare Life Sciences), photoreceptor side down, as described previously (Anastassov et al., 2019). The tissues were incubated with the following antibodies: rhodopsin 1D4 (generously provided by R. Molday, University of British Columbia), GFAP (AB5804, Millipore), CtBP2 (612044, BD Biosciences), PKC (ab32376, Abcam), mGluR6 (generously provided by K. Martemyanov, The Scripps Research Institute), ARR3 (generously provided by C. Craft, University of Southern California). Images were acquired on a Zeiss LSM800 confocal microscope. For quantifications of mGluR6 puncta, images were imported into Fiji (ImageJ2), adjusted to similar threshold and the number and areas of puncta were quantified using the analyze particles function.

Western blots.

Each isolated retina was homogenized in 150 μl buffer (150 mm NaCl, 50 mm Tris pH 8.0, 0.1% NP-40, 0.5% deoxycholic acid, 0.1 mm PMSF and complete mini protease inhibitor (Roche Applied Sciences), incubated with DNase I (30 U, Roche Applied Sciences) at room temperature for 30 min. An equal amount of retinal homogenate from each sample was electrophoresed on 4–12% Bis-Tris SDS-PAGE Gel (Invitrogen). Protein was transferred onto nitrocellulose membrane (Whatman, GE Healthcare Life Sciences) and incubated overnight with the following primary antibodies: rabbit anti-PDE polyclonal antibody (PAB-06800, Cytosignal), rabbit anti-ROS-GC1 polyclonal antibody (sc50512, Santa Cruz Biotechnology), mouse Anti-Gtα antibody (371740, EMD4Biosciences), rabbit polyclonal anti-GCAP1 and GCAP2 antibodies (Hoyo et al., 2014; Wang and Chen, 2014), mouse anti-CNGB1 4B1 antibody (Poetsch et al., 2001), mouse anti-CNGα antibody PMc 1D1 (Cook et al., 1989), mouse NCKX1 8H6 antibody (Vinberg et al., 2015), and mouse anti-Actin antibody (MAB1501, Millipore). The membranes were then incubated with fluorescently labeled secondary antibodies (1:10,000; LI-COR biosciences, 926-31081) at room temperature for 1 h and detected by Odyssey infrared imaging system.

Whole retina and single-cell recordings from rods and bipolar cells.

Mice were maintained on a normal 12 h day/night cycle and were dark-adapted overnight (>12 h) before experiments. All further manipulations were performed in total darkness under infrared illumination visualized with infrared image converters (BE Meyers). Following euthanasia, eyes were enucleated, the lens and cornea were removed, and eyecups were stored in darkness at 32°C in Ames' media buffered with sodium bicarbonate (Sigma-Aldrich, catalog #A1420) equilibrated with 5% CO2/ 95% O2.

Trans-retinal electroretinograms (ERGs) were recorded from isolated retinas as described previously (Pahlberg et al., 2017). Retinas were mounted in a specialized recording chamber (Vinberg et al., 2014) and superfused in darkness with 35–37°C Ames' media buffered with sodium bicarbonate and equilibrated with 5% CO2/ 95% O2, pH ~7.4. An additional 10 mm BaCl was added to the solution facing the inner retina to mitigate Müller cell activity. The trans-retinal potential change to flashes of LED light (λmax ~ 505 nm; Cairn Instruments) was measured using Ag/AgCl half-cells connected to a differential amplifier (model DP-311, Warner Instruments). A-waves were separated from b-waves by superfusing retinas with Ames' media containing synaptic blockers (50 μm DL-AP4 and 13 mm Na+Aspartate; Tocris Bioscience and Sigma-Aldrich), and b-waves were subsequently derived by subtracting a-waves from full ERGs. Recordings were sampled at 1 kHz and low-pass filtered at 30 Hz.

Recordings of the photovoltage from individual rods and rod bipolar cells was made by whole-cell patch-clamp from dark-adapted retinal slices as described previously (Pahlberg et al., 2017). Briefly, a small piece of dark-adapted retina was embedded in low-gelling temperature agar, slices were cut on a vibrating microtome, transferred into a recording chamber, and superfused with Ames' media equilibrated with 5%CO2/95%O2 while maintained at 35–37°C. The pipette internal solution consisted of the following (in mm): 125 K-aspartate, 10 KCl, 10 HEPES, 5 N-methyl glucamine-HEDTA, 0.5 CaCl2, 1 ATP-Mg, 0.2 GTP-Mg; pH was adjusted to 7.2 with N-methyl glucamine hydroxide. Light-evoked responses were recorded following the delivery of 10 ms flashes from a blue LED (λmax ~ 470 nm, full-width half-maximum ~30 nm) whose strength varied from producing a just-measurable response, and increased by factors of 2. Recordings were sampled at 1 kHz and low-pass filtered at 300 Hz.

In vivo ERG.

Mice were dark-adapted overnight and recordings were performed under dim red light conditions as described previously (Moaven et al., 2013). Series of light flashes ranging from 0.03 mcd to 25 cd were delivered, and responses were recorded using OcuScience HMsERG.

RGC recording, stimulation and analysis.

RGCs were recorded from dorsal retina using a large scale, dense hexagonal multielectrode array (MEA) covering ~0.34 mm2 of the retina (519 electrodes with 30 μm spacing; Field et al., 2010). The pigmented epithelium remained attached to the retina for these recordings. The retina was perfused with Ames' solution (30–31°C) bubbled with 95/5% O2/CO2. Spikes were identified and assigned to specific RGCs on the MEA as previously described (Yu et al., 2017). Dim flashes were delivered at 3 s intervals using a 490 nm LED. Light intensity was controlled using pulse duration, 2–8 ms, and neutral density filters. Dim flash responses were measured by counting spikes on each trial within a 100 ms window that was centered on the peak of the peristimulus time histogram.

Experimental design and statistical analyses.

Because our initial studies did not show gender-specific differences, the genders were pooled. Student's t test was used to determine statistical significance in morphometric measurements when comparing values between cre-negative and cre-positive mice. RGC response thresholds were measured from three Cngb1ΔCaM retinas (102–232 cells), five Cngb1neo/neo retinas (100–336 cells), and three Cngb1neo/neo rescue retinas (53–186 cells). Cumulative threshold histograms were calculated in each tissue and averaged across all retinas within a condition. A two-tailed Kolmogorov–Smirnov goodness-of-fit hypothesis test was used to assess the statistical difference between average cumulative histograms. The fraction of cells for which no response surpassed threshold was also measured in each recorded retina. A two-sample t test was used to evaluate significance between conditions.

Results

Generation of a novel animal model of genetically reversible rod degeneration

One challenge to identifying how plasticity among inner retinal neurons impacts functional recovery is the lack of an experimental system that is noninvasive and allows for stringent regulation of the timing and uniformity of rescue. For example, viral-mediated (gene therapy) approaches for treating rod dysfunction and death (1) take weeks for expression to occur, (2) they do not infect all targeted cells, (3) they may not drive proper protein expression levels, (4) and the subretinal injections used for viral delivery can damage the retina. A systematic investigation into the consequences of rod degeneration and subsequent rescue of the retinal circuitry requires an experimental system wherein both events occur uniformly in the retina. Toward this goal, a neoloxP cassette was inserted into intron 19 of the Cngb1 gene by homologous recombination in mouse embryonic stem cells (Fig. 1A). Mice harboring this insertion were subsequently derived (Cngb1neo/neo). The presence of the cassette disrupted a splice site and prevented CNGB1 expression (Fig. 1B). Expression of CNGA1 was also substantially attenuated (Fig. 1B), a phenomenon attributed to mistrafficking (Hüttl et al., 2005) and structural stability conferred by association of both subunits. The expression levels of other major phototransduction proteins were minimally perturbed in retinas of 1-month-old (MO) mice (Fig. 1B; NCKX1, GC1, PDE6A, and GNAT1). Consistent with previous reports on conventional Cngb1 knock-out mice (Hüttl et al., 2005; Zhang et al., 2009), the lack of CNG channel expression led to a progressive thinning of the outer nuclear layer over the course of 6 months (Fig. 1C). At 2 weeks, the outer nuclear layer (ONL) containing primarily rod photoreceptor cell nuclei reached its maximum thickness. This thickness was reduced by ~20% in 1 MO mice and to ~50% in 2 MO mice. By 6 MO, the ONL was absent. Thus, these mice exhibit slow rod degeneration relative to other commonly used models of rod degenerative diseases, such as rd1 (Farber and Lolley, 1974) and rd10 mice (Chang et al., 2007).

Figure 1.
  • Download figure
  • Open in new tab
  • Download powerpoint
Figure 1.

Retinas from Cngb1neo/neo mice exhibit stereotypic degenerative changes. A, The 1.8 kb neomycin cassette, flanked by loxP sites, was inserted into intron 19 of the Cngb1 gene. B, Western blots of retinal homogenates from control and Cngb1neo/neo mice show that the neomycin insertion blocked expression of CNGB1, and downregulated expression of CNGA1 channel proteins. C, Light micrograph of representative retinal sections prepared from Cngb1neo/neo mice at the indicated ages. Scale bar, 20 μm. D–I, Cryosections from 1 MO C57 (left) and Cngb1neo/neo mice (right) stained for rhodopsin (Rho) and GFAP. Nuclei are stained with DAPI (blue). H, C57 and (I) Cngb1neo/neo retinal sections stained for synaptic ribbons (CtBP2, blue) of photoreceptors and mGluR6 puncta (red) of bipolar cell dendrites. Representative transmission electron micrographs of C57 (J) and Cngb1neo/neo (K) retinal sections. Rod spherules containing synaptic triads are marked with red asterisk. Dystrophic spherules that contain membranous material and vacuoles (arrows) can be seen in the mutant retina. R: rod nuclei, C: cone pedicle. OS, Outer segment; INL, inner nuclear layer; GCL, ganglion cell layer.

As expected, the absence of the CNGB1 recapitulated the stereotypic sequence of events associated with rod degeneration (Marc and Jones, 2003; Puthussery and Taylor, 2010; Soto and Kerschensteiner, 2015). For example, rhodopsin mislocalization and activation of Müller glia were observed in 4-week-old Cngb1neo/neo mice (Fig. 1, compare F,G, with control retina, D,E). Further, their outer segments were shortened (see also below), and the membranous disks become disorganized (Fig. 3I; Gilliam et al., 2012).

We also observed in Cngb1neo/neo mice that synaptic contacts between rods and rod bipolar cells were structurally abnormal. Immunohistochemistry using a marker for the presynaptic ribbon protein CtBP2 (ribeye) and the postsynaptic glutamate receptor, mGluR6, revealed clear differences between Cngb1neo/neo and control retinas. In control retinas, these structures were closely apposed, and both were contained within a well defined outer plexiform layer (OPL; Fig. 1H,). However, in Cngb1neo/neo retinas these structures were less aligned within the laminar boundary of the outer plexiform layer and some were situated deep into the photoreceptor nuclear layer (ONL; Fig. 1I, arrows). The ultrastructure of rod synapses was further evaluated by transmission electron microscopy (TEM). Representative images of retinal sections from 1 MO C57 mice show numerous triads consisting of the synaptic ribbon, and horizontal and bipolar cell dendrites within rod spherules (Fig. 1J, red asterisks). Diads were also observed when one of these elements was out of the plane of the section. Triads were less numerous in rod spherules of age-matched Cngb1neo/neo mice; instead, many dysmorphic membranous and vesicular structures were present (Fig. 1K, arrows). Importantly, no such structures were observed in C57 TEM images. Quantification of triads, diads, and dysmorphic structures are shown in Figure 5E.

Lack of CNGB1 expression attenuated rod photoresponses and rod bipolar cell light responses

Previous work has indicated that lack of CNGB1 expression compromises rod vision (Biel and Michalakis, 2007). To verify compromised rod function in Cngb1neo/neo mice, we performed ex vivo whole-retina ERGs under scotopic conditions. The ERG reflects the averaged activity across all retinal neurons (Granit, 1933). ERGs from C57 retinas exhibited a well characterized biphasic response (Fig. 2A; Saszik et al., 2002) with the initial negative-voltage deflection (a-wave) indicative of the rod hyperpolarization to the flash stimulus, and the subsequent positive-voltage rebound indicative of predominantly the rod bipolar cell depolarization (b-wave). We isolated a-waves during the superfusion of synaptic blockers and rod b-waves by subtracting a-waves from the full ERG. Recordings were also performed on control Cngb1ΔCaM mice in which the calmodulin binding site was removed (Chen et al., 2010). No differences were observed between Cngb1ΔCaM and C57 retinas (data not shown).

Figure 2.
  • Download figure
  • Open in new tab
  • Download powerpoint
Figure 2.

Characterization of rod and rod bipolar function by ex vivo ERGs. Rod-driven a-waves were isolated with pharmacological inhibitors of synaptic transmission (see Materials and Methods), and rod bipolar-dominated b-waves were subsequently derived by subtracting the a-wave from the full ERG. A, Example recordings from a typical C57 retina, and two 1 MO Cngb1neo/neo retinas with a-waves and b-waves separated. Flash strengths in all families ranged between 0.10 and 40,000 photons·μm2, with nonresponding and supersaturating responses omitted for clarity. B, Response-intensity relationships for isolated a-waves and derived b-waves. Points plotted as mean ± SEM. A-wave and b-wave data were fit by Hill Equations with the exponent fixed at 1. C57 a-wave fits yielded an Rmax of 520 μV and I1/2 of 75 photons·μm2, with Cngb1neo/neo a-wave fits yielding an Rmax of 140 μV and I1/2 of 1030 photons·μm2. C57 b-waves fits yielded an Rmax of 1070 μV and I1/2 of 5.8 photons·μm2, with Cngb1neo/neo b-wave fits yielding an Rmax of 420 μV and I1/2 of 930 photons·μm2. Dashed lines are included from the I1/2 value of each fit to the light intensity axis to allow comparison of the larger relative desensitization of b-waves compared with a-waves.

Although ERGs from 1 MO Cngb1neo/neo retinas exhibit some variability, all exhibit reduced function. As shown in Figure 2, 1 MO Cngb1neo/neo retinas displayed reduced sensitivity a-waves and b-waves. Light responses were not fully eliminated in these rods; this is likely because of residual activation of homomeric channels composed of CNGA1 (see Discussion). B-waves, however, ranged in size between somewhat desensitized to completely absent. Response-intensity relationships (Fig. 2B) demonstrate a rightward shift of both a-waves and b-waves in Cngb1neo/neo retinas, indicating an ~14-fold desensitization of the a-wave but ~160-fold desensitization of the b-wave. The larger relative desensitization of the b-wave is indicative of a synaptic deficit in addition to the deficit in phototransduction. This observation complements the abnormal synaptic structures observed between rods and rod bipolar cells via light and electron microscopy. Together, these results indicate that synaptic transmission between rods and rod bipolar cells is severely dysfunctional in Cngb1neo/neo mice. Thus, we sought to determine the extent to which normal synaptic structures and transmission between rods and rod bipolar cells could be recovered by the rescue of CNGB1 expression in mature retinas.

Cre-mediated excision of the NeoLoxP cassette leads to normal CNGB1 expression

To activate CNGB1 expression in the Cngb1neo/neo retina, we used the CAGGCre-ER transgene (Hayashi and McMahon, 2002) to enable tamoxifen-dependent, cre-mediated excision of the NeoloxP cassette. We previously demonstrated that mice derived from germline excision of this cassette exhibit normal retinal morphology with a uniform and normal expression level of CNGB1 (Chen et al., 2010). The homologous recombination strategy that introduced the NeoloxP cassette also removed a stretch of 14 aa that encompassed the calmodulin binding domain on CNGB1 (Grunwald et al., 1998). Importantly, rods that expressed CNGB1ΔCaM exhibited normal light responses as mentioned (Chen et al., 2010). We hypothesize that using the CAGGCre-ER transgene would provide temporal control over expression of the functional CNG channel. To determine the efficacy of cre-mediated excision of the neoloxP cassette, 4-week-old cre-positive and cre-negative Cngb1neo/neo littermate mice were divided into two groups. One group was given tamoxifen for 4 consecutive days by oral gavage, and the other group did not receive drug treatment.

A PCR strategy was designed to detect the extent of neoloxP excision in genomic DNA extracted from isolated retinas: the primer pair (2 + 3) detects the presence of the neoloxP insert, whereas primer pair (1 + 3) gives rise to a diagnostic band when the large neoloxP insert is excised (Fig. 3A). After 4 consecutive days of tamoxifen treatment, both sets of primers produced positive bands. This result indicates a mixed population of cells at this stage, some of which have undergone excision while others have not. However, when tamoxifen treatment was given for 7 consecutive days a positive signal was detected only by primers (1 + 3). This result indicates that following a 7 d tamoxifen treatment, most, if not all cells have undergone neoloxP excision (Fig. 3A, bottom). Thus, a 7 d treatment was used for further structural and functional studies.

Figure 3.
  • Download figure
  • Open in new tab
  • Download powerpoint
Figure 3.

Excision of the floxed neomycin cassette restores CNG channel expression and rescues rod cell death. A, PCR primers 1, 2, and 3 were designed to detect the presence or absence of the neoloxP cassette. Littermate mice were treated with tamoxifen (TM) for the indicated number of days starting at 4 weeks and retinal DNA was extracted from mice at 8 weeks. Control retinal DNA “c” is from a germline-floxed mouse wherein the neoloxP cassette has been removed in all tissues (Cngb1ΔCaM). B, Western blots of retinal homogenates from cre-negative and cre-positive littermate mice of the indicated ages (6 weeks, 8 weeks) that were treated with TM or vehicle (corn oil) beginning at 4 weeks old for 4 consecutive days. C, Western blot of retinal homogenate prepared from the contralateral eye from mice used in A. Representative retinal morphology and outer segment structure of 3 MO cre-negative (D, E) or cre-positive littermates (F, G) mice treated with tamoxifen for 7 consecutive days beginning at 4 weeks. Quantification of outer nuclear layer thickness (H) and outer segment length (I) across the central meridian of the retina at 20 positions along the inferior–superior axis (mean ± SD, n = 4 for cre-positive; n = 5 for cre-negative mice). Positions showing significant difference by Student's t test are marked by *p < 0.05 and **p < 0.01. Retinal morphology from 5 MO cre-negative (J) and cre-positive (K) littermates treated with tamoxifen for 4 consecutive days starting at P28. L, In vivo ERG from tamoxifen-fed Cngb1neo/neo mice (n = 3, individual mice are color-coded light gray, dark gray, and black) recorded after the indicated days of tamoxifen treatment. Traces shown are from individual mice responding to 1 mcd light flash. M, Summary of b-wave values (mean ± SD) from L. Filled circles represent data from tamoxifen-fed Cngb1neo/neo mice and open circles represent values from age-matched C57 controls.

To assess the level of protein expression at 6 or 8 weeks (corresponding to 1 or 3 weeks after drug treatment), Western blots were prepared from whole retinal homogenates from both cohorts (Fig. 3B). Expression of CNGB1 protein was observed only in tamoxifen-treated, cre-positive mice. No expression was observed in cre-positive mice without drug treatment, indicating a lack of basal recombinase activity. We next examined how excision of the neoloxP insert affected the expression of CNGB1 and other major phototransduction proteins. We found that following neoloxP excision, there was a striking increase in CNGB1 expression (Fig. 3C). There was also an increase in the detected levels of other phototransduction proteins GC1, PDE6A, GNAT1, and GCAP2 at 8 weeks (Fig. 3C). To determine whether this is because of rod rescue, cre-negative and cre-positive Cngb1neo/neo littermate mice were administered tamoxifen for 7 consecutive days beginning at 4 weeks, and retinal sections were prepared from 3 MO mice. In the absence of rescue, cre-negative sibling mice show a reduction in outer nuclear layer thickness and disrupted outer segment structures (Fig. 3D,E), whereas the cre-positive mice showed more layers of photoreceptor cells, and the rod outer segment were longer and contained organized disks. Importantly, disruption of outer segment structure in the Cngb1 knock-out rods is evident by postnatal day (P)20 (data not shown; but see Zhang et al., 2009; Gilliam et al., 2012). Therefore, this result reveals an inherent ability of the outer segment renewal process to form organized discs upon gene rescue; the outer segment renewal process takes 10 d in the mouse retina as the newly formed discs at the base reaches the tip of the outer segment (LaVail, 1973). Quantification of the outer nuclear layer thickness at 20 different positions along the central meridian of the retina showed a significant difference at the inferior-central region (Fig. 3H). Difference in the outer segment length was more striking, and significant differences were seen in most regions of the retina (Fig. 3I). Expression of CNGB1 exhibited a long term rescuing effect on rod survival (Fig. 3J,K; tamoxifen was administered for 4 consecutive days starting at P28), consistent with a previous report on AAV-mediated Cngb1 gene replacement therapy (Koch et al., 2012). The time course of functional recovery following 7 d tamoxifen treatment was measured by in vivo ERG (Fig. 3L,M) where the dimmest flash (1 mcd) reliably recorded from C57 mice are used for visual threshold. No responses were detected until 6 d after initiation of drug treatment, and after 10 d the responses from cre-positive mice appeared similar to that of C57 mice (Fig. 3L). Quantification of b-wave amplitudes as a function of time is shown in Figure 3M. In sum, these data show that the Cngb1neo/neo mice allowed us to regulate the expression of CNGB1 from the endogenous locus in a temporally-controlled manner. Further, this excision is nearly complete with a 7 d tamoxifen treatment and that upon expression of CNGB1, the rods elaborate long outer segments and are stably rescued from cell death.

We measured the responsiveness of rod photoreceptors following drug treatment in patch-clamp recordings from individual rods in retinal slices. In voltage-clamp (Vm = −40 mV), rods from 1 MO Cngb1neo/neo mice displayed diminished response amplitudes (~6-fold) and a ~10-fold reduction in light sensitivity (Fig. 4A), a result consistent with the diminished a-wave in ex vivo ERG recordings (Fig. 2B). In current-clamp (i = 0), Cngb1neo/neo rods exhibit a resting membrane potential that was ~10 mV hyperpolarized compared with WT rods [−47 ± 1.3 mV (5) vs −37 ± 2.3 mV (6), mean ± SEM]. These results are consistent with reduced CNG channel expression (see Discussion) and indicate reduced glutamate release in darkness. However, rods from tamoxifen-treated Cngb1neo/neo mice displayed responses with characteristics very similar to C57 mice (Fig. 4B), consistent with near-normal function and rescue of the photoreceptor layer (Fig. 3).

Figure 4.
  • Download figure
  • Open in new tab
  • Download powerpoint
Figure 4.

Light sensitivity is improved following expression of CNGB1. A, Single cell recordings show small, desensitized response families in Cngb1neo/neo mice likely reflecting residual CNG channels composed of CNGA1 monomers. Flashes generated 79, 160, 310, 630, and 1300 Rh*/rod. B, Following tamoxifen treatment, rod responses showed amplitudes and sensitivity resembling those of C57; flash strengths were 9, 17, 34, 68, 140, 270, and 540 Rh*/rod. C, Response-intensity relationships from single-cell recordings display ~10-fold reduction in sensitivity between WT (black dots) and Cngb1neo/neo [red dots; I½ values were 27 ± 4 (n = 5) and 360 ± 8 (n = 9), respectively]. This sensitivity shift is nearly restored following reintroduction of the CNGB1 [blue dots; I½ = 43 ± 3 (n = 10)].

Expression of CNGB1 induces normal synaptic structures between rods and rod bipolar cells

Given that tamoxifen administration in Cngb1neo/neo mice rescued rods from death (Fig. 3D–K) and rescued normal rod light responses (Fig. 4), we next examined the synaptic contacts between rods and rod bipolar cells to determine how rod rescue impacts these structures. Tamoxifen treatment was initiated at 4 weeks for 7 consecutive days, and retinal structure was examined at 3 MO. Comparisons were made between 1 MO C57 and Cngb1neo/neo mice and 3 MO tamoxifen-treated mice to examine the effect of rod rescue that was initiated at 1 MO. Synaptic structures were labeled in retinal flat mounts stained for the presynaptic ribbon synapse protein (CtBP2, blue) and postsynaptic mGluR6 (orange; Fig. 5A,B,C). To distinguish between rod and cone synapses, cone pedicles were further labeled with the cone-arrestin antibody (ARR3, green). Rod bipolar cell morphology, visualized by PKCα staining, and the mGluR6 puncta that decorate their dendritic tips are shown in retinal cross sections on the right.

Figure 5.
  • Download figure
  • Open in new tab
  • Download powerpoint
Figure 5.

Expression of CNGB1 reverses presynaptic and postsynaptic retinal remodeling in Cngb1neo/neo retina. Shown are representative images from N = seven independent experiments. A–C, Left, Retinal flat mounts from 1 MO C57, 1 MO Cngb1neo/neo, and 3 MO rescued Cngb1 mice treated with tamoxifen for 7 consecutive days beginning at 4 weeks of age, respectively. The flat mounts were stained with the presynaptic ribbon marker, CtBP2 (blue), and postsynaptic marker mGluR6 (orange). Cone pedicles were visualized using cone arrestin, ARR3 (green). Right, Retinal cross sections from mice of the same genotype as the flat mounts. The retinal sections were stained with antibodies to mGluR6 (red) and the rod bipolar cell marker, PKCα (teal). D, Representative TEM of Cngb1 rescued mice. Rod spherules containing synaptic elements are marked by red asterisk. E, Quantification of synaptic triads and diads as well as dystrophic spherules from C57, Cngb1neo/neo, and Cngb1 rescued mice (n = 3 for each group). Each independent sample are marked by a different color, and each point represents the number of synaptic structures counted in one TEM image field, normalized to 10 μm distance of the outer plexiform layer. No dystrophic structures were observed in images from C57 retinas. Values are mean ± SD. Groups are compared first by one-way ANOVA followed by Tukey HSD.

Control retinas (C57), exhibited a close juxtaposition between the rod's single ribbon and the mGluR6 puncta on the dendritic tips of rod bipolar cells (Figs. 5A, 1G). However, in Cngb1neo/neo retinas from 1 MO mice, both the number of synaptic ribbons and mGluR6 puncta appear reduced in the retinal flat mount (Fig. 5B, left). This reduction is likely due, in part, to mislocalization of some of these structures into the outer nuclear layer (Fig. 1I). Rod bipolar cell dendrites were also unevenly distributed in Cngb1neo/neo retinas, and the size of the mGluR6 puncta appeared smaller (Fig. 5B). In contrast, retinas from the tamoxifen-treated, cre-positive littermates exhibited robust staining of synaptic ribbons along with their associated mGluR6 puncta, and rod bipolar cell dendrites were evenly extended and the mGluR6 puncta appeared more uniform in shape (Fig. 5C). The rod spherule of the rescued mice were further examined by TEM, where triads were reliably observed (Fig. 5D). Interestingly, many of these appear larger and contain more extensive cellular processes compared with triads in C57 spherules (Fig. 1J). Notably, similar to C57 controls, no dysmorphic synaptic structures were observed in sections from tamoxifen-treated mice. Quantification of synaptic structures in TEM sections from 1 MO C57, Cngb1neo/neo and rescued mice is shown in Figure 5E (mean ± SD, N = 3 for each group). A significant reduction in triads was observed in Cngb1neo/neo retinal sections compared with that from C57 mice, and these structures increased upon tamoxifen treatment. The overall decrease in the number of synapses is consistent with the degree of rod loss before tamoxifen rescue. These results indicate that inducing expression of CNGB1 in mature retina causes a recovery of synaptic structures between rods and rod bipolar cells.

Rescue of CNGB1 expression in mature retina recovers rod bipolar light responses

The results above indicate a structural recovery of synapses following expression of CNGB1. In addition to this structural recovery, ex vivo whole-retina ERGs revealed a recovery and stabilization of the rod bipolar cell-driven b-wave (Fig. 6A). Because of variations in the size of the a-wave and b-wave in Cngb1neo/neo mice, in Figure 6A (right) we show the normalized b-wave response-intensity relationships from Figure 2B along with the recovery. These data show that the sensitivity of the b-wave recovers following tamoxifen treatment to values similar to C57 retinas. Thus, structural and functional measures broadly indicate recovery of synaptic function between rods and rod bipolar cells. To examine further synaptic function before and following rod rescue, we performed patch-clamp recordings from rod bipolar cells in retinal slices. In untreated Cngb1neo/neo mice there was a complete absence of functional transmission of between rods and rod bipolar cells (Fig. 6C); 1 MO Cngb1neo/neo rod bipolar cells never yielded light-evoked responses (n = 15 from 5 retinas; see also Discussion). However, in Cngb1neo/neo mice administered tamoxifen for 7 d at 4 weeks of age and recorded at 3 MO, rod bipolar cells exhibited robust light-evoked responses similar to control animals (Fig. 6D). The extent of functional recovery in rod bipolar cells was characterized in plots of the response amplitude versus the flash strength. These intensity-response relationships were fit with a Hill curve and compared quantitatively to control responses. The half-maximal flash strength (I1/2) increased by ~twofold in rescued animals (Fig. 6E), consistent with some rod loss (see Discussion). However, other features of the rod bipolar light response that are critical for function near visual threshold had recovered to near control values. For example, the Hill exponent for the fit of the response-intensity relationship matched that in control, indicating a similar nonlinear relationship between the flash strength and the response amplitude. The extent of nonlinearity reflects the rate of glutamate release from rod synapses (Sampath and Rieke, 2004). In addition, the time course of rod bipolar cell responses was similar in rescued animals (Fig. 6A,C,E, dashed line), further indicating the anatomical and physiological recovery of synaptic transmission in tamoxifen-treated animals. These results indicate that rescuing rod function in the mature mouse retina produces a cascade of structural and functional recovery in synaptic transmission between rods and rod bipolar cells, and thus the primary rod pathway (Dacheux and Raviola, 1986).

Figure 6.
  • Download figure
  • Open in new tab
  • Download powerpoint
Figure 6.

Physiological responses from rod bipolar cells in retinal slices. A, Ex vivo ERG b-wave responses from 3 to 6 MO Cngb1neo/neo Cre+ mice after tamoxifen treatments. Flashes delivered 0.33, 1.1, 4.0, 20, 72, and 240 photons·μm−2. Please compare with Figure 2A. Voltage-clamp rod bipolar cell recordings (Vm = −60 mV) from the following mice: (B) C57 rod bipolar cells (2–3 MO); (C) Cngb1neo/neo rod bipolar cells (1 MO); (D) Cngb1 tamoxifen-treated (3 MO). Flashes generated 2, 4, 8, 16, 31, 62, and 130 Rh*/rod for C57 rod bipolar cells, and 280, 560, 1100, and 2200 Rh*/rod for Cngb1neo/neo rod bipolar cells. Light-evoked responses were never observed in Cngb1neo/neo rod bipolar cells (15 cells across five retinas; flashes generated 2200 Rh*/rod). E, Response-intensity relationships from mean data show that this relationship is shifted to higher flash strengths in rescued mice, reflecting some rod loss. The Hill exponent of rod bipolar cells were similar to normal following rod recovery (Hill exponent = 1.6 ± 0.05; n = 12), in support of a restoration of the normal rod-to-rod bipolar cell synaptic structure and the dark rate of glutamate release.

Rescuing rods recovers absolute sensitivity of retinal output

RGCs provide the sole output from the retina and can integrate input from thousands of rods, making them the most light-sensitive cells in the retina (Chichilnisky and Rieke, 2005; Field and Sampath, 2017). RGC sensitivity relies on functioning photoreceptors and highly tuned synaptic connections via the primary rod pathway (Field and Rieke, 2002; Sampath and Rieke, 2004). To understand how rescuing rod function in the 1 MO Cngb1neo/neo retina impacts RGC sensitivity, we used a large-scale MEA to record spikes from hundreds of RGCs. We tested the sensitivity of the RGCs by stimulating the retina with brief, dim flashes (0.001–10 Rh*/rod) and compared RGC responses in 3 MO control Cngb1ΔCaM, Cngb1neo/neo, and 4–5 MO Cngb1 tamoxifen rescued mice. Flashes producing <1 isomerization per rod faithfully produced spike rate modulations in many RGCs from control mice (Fig. 7A shows an example cell). The same flash intensities did not reliably modulate the spike output of most RGCs in retinas from 3 MO Cngb1neo/neo mice (Fig. 7B shows an example cell). Indeed, most RGCs from Cngb1neo/neo mice did not show reliable responses until flash intensities exceeded 1 Rh*/rod (Fig. 7B3). However, similar to the control retinas, RGC responses were often evident at low flash intensities in 4–5 MO Cngb1 rescued mice (Fig. 7C shows an example cell). These example cells suggest that rod and circuit functionality are broadly and stably rescued in some RGCs for Cngb1 rescued mice.

Figure 7.
  • Download figure
  • Open in new tab
  • Download powerpoint
Figure 7.

Dim flash responses from RGCs in whole-mount retina show recovery from early rod rescue. A1–C1, Spike times of 80–100 trials of three example cells to a single dim flash (0.75 Rh*/rod). A2–C2, PSTHs for three increasingly bright dim flashes (0.002, 0.02, 0.75, Rh*/rod). A3–C3, The mean spike rate ± SD, measured on each trial in a 100 ms window around the peak of the PSTH. Dim flash thresholds were estimated from these curves for 1954 cells. The average cumulative distribution function show higher thresholds responses in Cngb1neo/neo mice RGCs than Cngb1ΔCaM and tamoxifen-treated Cngb1neo/neo mice RGCs (D). The shaded regions illustrate standard error of the mean (SEM) across 3–4 experimental preparations. Additionally, flash thresholds could not be identified in a larger portion of RGCs from Cngb1neo/neo mice (E). *p < 0.01, ns, not significant.

To measure the extent that sensitivity across the RGC population recovered in Cngb1 rescued mice, we quantified the response-threshold for all RGCs (N = 1954) in MEA recordings from 11 mice (3 control Cngb1ΔCaM mice, 3 Cngb1neo/neo mice, 5 tamoxifen-treated Cngb1 mice). RGC response thresholds were quantified as the lowest flash intensity needed to drive the average spike rate change 2 SD above baseline (Fig. 7A3,B3,C3; see Materials and Methods). Average RGC response threshold distributions were similar between control and Cngb1 rescued mice, but were significantly higher in untreated Cngb1neo/neo mice (Fig. 7D; KS test, p < 0.05). Additionally, the fraction of RGCs for which no-threshold response could be measured was similar between control and Cngb1 rescued mice but significantly higher in untreated Cngb1neo/neo mice (Fig. 7E; t test, p < 0.05). These results indicate a broad and lasting recovery of rod and circuit functions in Cngb1 rescued mice.

Discussion

In contrast to other neurons, rods and cones are depolarized in darkness and tonically release glutamate through ribbon synapses (Molday and Moritz, 2015), leading to saturation of rod-to-rod bipolar cell synapses (Sampath and Rieke, 2004). Light exposure causes graded hyperpolarization of the photoreceptor cell and suppression of glutamate release. Reductions in glutamate release from photoreceptors that occur during the early process of retinal degeneration lead to homeostatic changes in the downstream neurons and degrade the retinal circuit. This is seen in the dissolution of synaptic structures, dendritic sprouting, formation of ectopic contacts, and gliosis (Marc et al., 2003; Puthussery and Taylor, 2010). Although strategies to rescue and restore function in defective photoreceptors have shown success for regaining some visual function, gene and stem cell therapies for visual restoration are often implemented in the adult; how well these rescued neurons reinstate their detailed circuitries in the remodeled retina is not known. Here we examined functional restoration at the level of inner retinal cells and defined rod-driven circuits in the young adult mouse retina. We show that repairing a primary genetic defect in rods not only restored rod function, but also recovered normal synaptic connectivity with remodeled second order rod bipolar cells.

Rod-to-rod bipolar cell synaptic contacts are reduced in Cngb1neo/neo retina resulting in disrupted synaptic transmission

The relatively slow photoreceptor degeneration we observe in the Cngb1neo/neo mouse model, and observed in human patients (Bareil et al., 2001; Biel and Michalakis, 2007), may be because of the fact that it is not a functional null. A small but measurable light response persisted in Cngb1neo/neo rods from 1 MO mice (Fig. 4A). The residual light response is probably because of the presence of homomeric channels composed of CNGA1 subunits, which are capable of mediating a diminished and desensitized cGMP-dependent current (Kaupp et al., 1989). The small current would reduce Ca2+ influx to the outer segment, causing increased levels of cGMP through stimulation of guanylyl cyclases by Ca2+-free guanylyl cyclase activating proteins 1 and 2 (Mendez et al., 2001; Dizhoor et al., 2010). Elevated cGMP has been shown to be a driver of rod degeneration through activation of protein kinase G (Ma et al., 2015; T. Wang et al., 2017).

In addition to the diminished rod light responses in the Cngb1neo/neo mice, we observed further desensitization of the ERG b-wave reflecting deficiencies in synaptic transmission. This observation was not unexpected, especially given our ultrastructural evidence showing that the number of triads in the Cngb1neo/neo rod spherules was significantly reduced, but not fully eliminated (Figs. 1, 5E). Additionally, a considerable number of dysmorphic spherules were observed in electron micrographs from the Cngb1neo/neo retinas. The total lack of light-evoked responses as measured by patch-clamp recordings from rod bipolar cells, even for bright flashes delivering ~2000 Rh*/rod (Fig. 6C), is somewhat surprising. Perhaps when assessed at the level of single rod bipolar cells the loss of rods within their receptive fields (or dysmorphic rods within their receptive field) causes tremendous desensitization. We speculate that this defect in synaptic transmission is exacerbated by diminished glutamate release at the ribbon synapse given that the lack of CNG channels which should act as a source of “equivalent light”, similar to light-induced closure of CNG channels (Sampath and Rieke, 2004; Dunn et al., 2006). Supporting this idea, the resting membrane potential of Cngb1neo/neo rods are ~10 mV hyperpolarized because of their smaller dark current (Fig. 4A). At the rod's normal resting potential in darkness (~40 mV), calcium enters through the voltage gated channel (Cav1.4) and supports tonic glutamate release at the ribbon synapse (Waldner et al., 2018). Thus the hyperpolarizing shift in resting potential of Cngb1neo/neo rods predicts attenuated glutamate release from the rod spherule.

Interestingly, suppression of glutamate release at the rod synapse is strongly correlated with synaptic remodeling. Examples include blockade of glutamate release by tetanus toxin (Cao et al., 2015), in knock-out mice that lack the presynaptic CaV1.4 Ca2+ channel (Mansergh et al., 2005), and in human patients diagnosed with congenital stationary night blindness (CSNB2) that harbor null mutations in the gene encoding CaV1.4 (Bech-Hansen et al., 1998; Boycott et al., 2000). Calcium entry through CaV1.4 channel is required for neurotransmitter release at the ribbon synapse of both rods and cones. The absence of CaBP4 (Haeseleer et al., 2004) or α2δ4 (Y. Wang et al., 2017) that bind and regulate the activity of CaV1.4, also manifest in retinal remodeling in knock-out mice. These plastic changes occurred with minimal photoreceptor cell loss, suggesting that synaptic remodeling is likely driven by suppression of neural transmission, or deafferentation, rather than photoreceptor cell death per se. Modest synaptic changes were also observed in RIBEYE knock-out retinas. RIBEYE is an essential component of the synaptic ribbon, and its absence abolished all presynaptic ribbons in the retina and severely impaired fast and sustained neurotransmitter release (Maxeiner et al., 2016). Spontaneous miniature release continues to occur without the synaptic ribbon, which may explain the milder retinal remodeling phenotype observed in the RIBEYE knock-out retina (Maxeiner et al., 2016).

Adult rod bipolar cells demonstrate plastic changes to establish functional contacts with rescued rods

The developmental time window for the formation of the rod to rod bipolar cell synapse in mice appears to be from eye opening to P30, during which synaptic proteins are expressed, presynaptic and postsynaptic molecular complexes form, and the rod bipolar cells develop the appropriate number of dendritic tips that make synaptic contacts with rods (Anastassov et al., 2019). Some of the molecules that guide neurite growth during development are absent at maturity (D'Orazi et al., 2014), and if functional connectivity of the neural retina can only occur during a critical period in development, then one would expect that the adult retina may lack the ability to make such connections when rod activity is switched on after this time window. Such developmental processes would have been disrupted in Cngb1neo/neo retinas, wherein pronounced retinal remodeling is observed by P14 (data not shown) and evident by P30 (Fig. 1). We show that tamoxifen-induced CNGB1 expression between P28 and P34 led to establishment of the rod's circulating current in darkness and normal light responses (Fig. 4). Concomitantly, structural changes were observed at the synapse: rod bipolar cells elaborated fine dendritic tips, mGluR6 receptors clustered on these tips which came in close contact with presynaptic ribbons (Fig. 5C). At the ultrastructural level, the number of synaptic triads significantly increased, and dysmorphic structures common in Cngb1neo/neo rod spherules were no longer visible (Fig. 5D,E). These newly formed synaptic structures supported normal neural transmission, as shown by ERG recordings and patch recordings from rod bipolar cells (Fig. 6), and increased light sensitivity in RGCs (Fig. 7). We hypothesize that these changes may be initiated by glutamate release at the rod's synapse, similar to that which occurs at the cortex, where focal uncaging of glutamate in mouse cortical layer 2/3 pyramidal neurons triggered spinogenesis from the dendrite shaft in a location-specific manner (Kwon and Sabatini, 2011).

Plasticity at the photoreceptor/bipolar cell synapse has also been observed in a model of photocoagulation of rabbit retina, where the laser ablation acutely removes a patch of photoreceptors while leaving the inner retina intact (Beier et al., 2017). After some days, nearby photoreceptors slowly migrate toward and fill in the lesioned area (Sher et al., 2013). As they do so, they form functional contacts with the deafferented bipolar cells (Sher et al., 2013; Beier et al., 2017). Another example of plasticity at the photoreceptor/bipolar cell synapse is the AAV-mediated gene therapy to replace retinoschisin (RS1) in adult mice (Ou et al., 2015). Retinal development of the RS1 knock-out mice appears to proceed normally. However, the absence of RS1, a cell adhesion protein, eventually causes splitting of the retina and a failure of synaptic maintenance that manifests in reduction of the ERG b-wave amplitude (Sikkink et al., 2007). This defect was reversed upon RS1 gene replacement (Ou et al., 2015). The molecular pathways that regulate retinal plasticity are poorly defined but are likely specific to different synaptic contacts. For example, plasticity of OFF bipolar cells is regulated by Dscam (Simmons et al., 2017). Here we demonstrate that activation of rod input in young adults reversed synaptic changes that occurred during development. The newly functional rods established functional contacts with their downstream neurons in the retinal circuitry of the adult retina. These results support the therapeutic potential of repairing or replacing defective rods in the degenerating retina. However, a critical time window for rescue likely exists: recent clinical trials for Leber congenital amaurosis (LCA) to replace RPE65 in human patients for treating a type of LCA caused by RPE65 mutations show limited success in visual improvement, and the retina continued to degenerate in some patients (Cideciyan et al., 2013). Future experimentation will address whether a critical time window of rescue exists for these approaches.

Footnotes

  • This work was supported by National Institute of Health Grants EY027193 (A.P.S., G.D.F., J. Chen); EY12155 and EY027387 (J. Chen), and Vision Core Grant P30EY029220 to Roski Eye Institute, USC; an unrestricted Grant from Research to Prevent Blindness to the Department of Ophthalmology, UCLA; and Jules Stein Eye Institute Core Grant EY00331 (A.P.S.). We thank Dr. M. Scalabrino for comments on the paper, Dr. K.Martemyanov for providing the mGluR6 antibody, Dr. C. Craft for providing the cone arrestin (ARR3) antibody, and Dr. S. Ruffins at the USC microscopy core for his help with confocal imaging.

  • The authors declare no competing financial interests.

  • Correspondence should be addressed to Alapakkam P. Sampath at asampath{at}jsei.ucla.edu or Greg D. Field at field{at}neuro.duke.edu

References

  1. ↵
    1. Anastassov IA,
    2. Wang W,
    3. Dunn FA
    (2019) Synaptogenesis and synaptic protein localization in the postnatal development of rod bipolar cell dendrites in mouse retina. J Comp Neurol 527:52–66. doi:10.1002/cne.24251 pmid:28547795
    OpenUrlCrossRefPubMed
  2. ↵
    1. Bareil C,
    2. Hamel CP,
    3. Delague V,
    4. Arnaud B,
    5. Demaille J,
    6. Claustres M
    (2001) Segregation of a mutation in CNGB1 encoding the beta-subunit of the rod cGMP-gated channel in a family with autosomal recessive retinitis pigmentosa. Hum Genet 108:328–334. doi:10.1007/s004390100496 pmid:11379879
    OpenUrlCrossRefPubMed
  3. ↵
    1. Bech-Hansen NT,
    2. Naylor MJ,
    3. Maybaum TA,
    4. Pearce WG,
    5. Koop B,
    6. Fishman GA,
    7. Mets M,
    8. Musarella MA,
    9. Boycott KM
    (1998) Loss-of-function mutations in a calcium-channel alpha1-subunit gene in Xp11.23 cause incomplete X-linked congenital stationary night blindness. Nat Genet 19:264–267. doi:10.1038/947 pmid:9662400
    OpenUrlCrossRefPubMed
  4. ↵
    1. Beier C,
    2. Hovhannisyan A,
    3. Weiser S,
    4. Kung J,
    5. Lee S,
    6. Lee DY,
    7. Huie P,
    8. Dalal R,
    9. Palanker D,
    10. Sher A
    (2017) Deafferented adult rod bipolar cells create new synapses with photoreceptors to restore vision. J Neurosci 37:4635–4644. doi:10.1523/JNEUROSCI.2570-16.2017 pmid:28373392
    OpenUrlAbstract/FREE Full Text
  5. ↵
    1. Bermingham-McDonogh O,
    2. Reh TA
    (2011) Regulated reprogramming in the regeneration of sensory receptor cells. Neuron 71:389–405. doi:10.1016/j.neuron.2011.07.015 pmid:21835338
    OpenUrlCrossRefPubMed
  6. ↵
    1. Biel M,
    2. Michalakis S
    (2007) Function and dysfunction of CNG channels: insights from channelopathies and mouse models. Molecular neurobiology 35:266–277. doi:10.1007/s12035-007-0025-y pmid:17917115
    OpenUrlCrossRefPubMed
  7. ↵
    1. Boycott KM,
    2. Pearce WG,
    3. Bech-Hansen NT
    (2000) Clinical variability among patients with incomplete X-linked congenital stationary night blindness and a founder mutation in CACNA1F. Can J Ophthalmol 35:204–213. doi:10.1016/S0008-4182(00)80031-9 pmid:10900517
    OpenUrlCrossRefPubMed
  8. ↵
    1. Cao Y,
    2. Sarria I,
    3. Fehlhaber KE,
    4. Kamasawa N,
    5. Orlandi C,
    6. James KN,
    7. Hazen JL,
    8. Gardner MR,
    9. Farzan M,
    10. Lee A,
    11. Baker S,
    12. Baldwin K,
    13. Sampath AP,
    14. Martemyanov KA
    (2015) Mechanism for selective synaptic wiring of rod photoreceptors into the retinal circuitry and its role in vision. Neuron 87:1248–1260. doi:10.1016/j.neuron.2015.09.002 pmid:26402607
    OpenUrlCrossRefPubMed
  9. ↵
    1. Chang B,
    2. Hawes NL,
    3. Pardue MT,
    4. German AM,
    5. Hurd RE,
    6. Davisson MT,
    7. Nusinowitz S,
    8. Rengarajan K,
    9. Boyd AP,
    10. Sidney SS,
    11. Phillips MJ,
    12. Stewart RE,
    13. Chaudhury R,
    14. Nickerson JM,
    15. Heckenlively JR,
    16. Boatright JH
    (2007) Two mouse retinal degenerations caused by missense mutations in the beta-subunit of rod cGMP phosphodiesterase gene. Vision Res 47:624–633. doi:10.1016/j.visres.2006.11.020 pmid:17267005
    OpenUrlCrossRefPubMed
  10. ↵
    1. Chen J,
    2. Woodruff ML,
    3. Wang T,
    4. Concepcion FA,
    5. Tranchina D,
    6. Fain GL
    (2010) Channel modulation and the mechanism of light adaptation in mouse rods. J Neurosci 30:16232–16240. doi:10.1523/JNEUROSCI.2868-10.2010 pmid:21123569
    OpenUrlAbstract/FREE Full Text
  11. ↵
    1. Chichilnisky EJ,
    2. Rieke F
    (2005) Detection sensitivity and temporal resolution of visual signals near absolute threshold in the salamander retina. J Neurosci 25:318–330. doi:10.1523/JNEUROSCI.2339-04.2005 pmid:15647475
    OpenUrlAbstract/FREE Full Text
  12. ↵
    1. Chua J,
    2. Fletcher EL,
    3. Kalloniatis M
    (2009) Functional remodeling of glutamate receptors by inner retinal neurons occurs from an early stage of retinal degeneration. J Comp Neurol 514:473–491. doi:10.1002/cne.22029 pmid:19350664
    OpenUrlCrossRefPubMed
  13. ↵
    1. Cideciyan AV,
    2. Jacobson SG,
    3. Beltran WA,
    4. Sumaroka A,
    5. Swider M,
    6. Iwabe S,
    7. Roman AJ,
    8. Olivares MB,
    9. Schwartz SB,
    10. Komáromy AM,
    11. Hauswirth WW,
    12. Aguirre GD
    (2013) Human retinal gene therapy for leber congenital amaurosis shows advancing retinal degeneration despite enduring visual improvement. Proc Natl Acad Sci U S A 110:E517–E525. doi:10.1073/pnas.1218933110 pmid:23341635
    OpenUrlAbstract/FREE Full Text
  14. ↵
    1. Concepcion F,
    2. Chen J
    (2010) Q344ter mutation causes mislocalization of rhodopsin molecules that are catalytically active: a mouse model of Q344ter-induced retinal degeneration. PLoS One 5:e10904. doi:10.1371/journal.pone.0010904 pmid:20532191
    OpenUrlCrossRefPubMed
  15. ↵
    1. Cook NJ,
    2. Molday LL,
    3. Reid D,
    4. Kaupp UB,
    5. Molday RS
    (1989) The cGMP-gated channel of bovine rod photoreceptors is localized exclusively in the plasma membrane. J Biol Chem 264:6996–6999. pmid:2468664
    OpenUrlAbstract/FREE Full Text
  16. ↵
    1. Dacheux RF,
    2. Raviola E
    (1986) The rod pathway in the rabbit retina: a depolarizing bipolar and amacrine cell. J Neurosci 6:331–345. doi:10.1523/JNEUROSCI.06-02-00331.1986 pmid:3950701
    OpenUrlAbstract/FREE Full Text
  17. ↵
    1. Dizhoor AM,
    2. Olshevskaya EV,
    3. Peshenko IV
    (2010) Mg2+/Ca2+ cation binding cycle of guanylyl cyclase activating proteins (GCAPs): role in regulation of photoreceptor guanylyl cyclase. Mol Cell Biochem 334:117–124. doi:10.1007/s11010-009-0328-6 pmid:19953307
    OpenUrlCrossRefPubMed
  18. ↵
    1. D'Orazi FD,
    2. Suzuki SC,
    3. Wong RO
    (2014) Neuronal remodeling in retinal circuit assembly, disassembly, and reassembly. Trends Neurosci 37:594–603. doi:10.1016/j.tins.2014.07.009 pmid:25156327
    OpenUrlCrossRefPubMed
  19. ↵
    1. Dunn FA,
    2. Doan T,
    3. Sampath AP,
    4. Rieke F
    (2006) Controlling the gain of rod-mediated signals in the Mammalian retina. J Neurosci 26:3959–3970. doi:10.1523/JNEUROSCI.5148-05.2006 pmid:16611812
    OpenUrlAbstract/FREE Full Text
  20. ↵
    1. Farber DB,
    2. Lolley RN
    (1974) Cyclic guanosine monophosphate: elevation in degenerating photoreceptor cells of the C3H mouse retina. Science 186:449–451. doi:10.1126/science.186.4162.449 pmid:4369896
    OpenUrlAbstract/FREE Full Text
  21. ↵
    1. Field GD,
    2. Rieke F
    (2002) Nonlinear signal transfer from mouse rods to bipolar cells and implications for visual sensitivity. Neuron 34:773–785. doi:10.1016/S0896-6273(02)00700-6 pmid:12062023
    OpenUrlCrossRefPubMed
  22. ↵
    1. Field GD,
    2. Sampath AP
    (2017) Behavioural and physiological limits to vision in mammals. Philos Trans R Soc Lond B Biol Sci 372:20160072. doi:10.1098/rstb.2016.0072 pmid:28193817
    OpenUrlCrossRefPubMed
  23. ↵
    1. Field GD,
    2. Gauthier JL,
    3. Sher A,
    4. Greschner M,
    5. Machado TA,
    6. Jepson LH,
    7. Shlens J,
    8. Gunning DE,
    9. Mathieson K,
    10. Dabrowski W,
    11. Paninski L,
    12. Litke AM,
    13. Chichilnisky EJ
    (2010) Functional connectivity in the retina at the resolution of photoreceptors. Nature 467:673–677. doi:10.1038/nature09424 pmid:20930838
    OpenUrlCrossRefPubMed
  24. ↵
    1. Garg A,
    2. Yang J,
    3. Lee W,
    4. Tsang SH
    (2017) Stem cell therapies in retinal disorders. Cells 6:E4. doi:10.3390/cells6010004 pmid:28157165
    OpenUrlCrossRefPubMed
  25. ↵
    1. Gilliam JC,
    2. Chang JT,
    3. Sandoval IM,
    4. Zhang Y,
    5. Li T,
    6. Pittler SJ,
    7. Chiu W,
    8. Wensel TG
    (2012) Three-dimensional architecture of the rod sensory cilium and its disruption in retinal neurodegeneration. Cell 151:1029–1041. doi:10.1016/j.cell.2012.10.038 pmid:23178122
    OpenUrlCrossRefPubMed
  26. ↵
    1. Granit R
    (1933) The components of the retinal action potential in mammals and their relation to the discharge in the optic nerve. J Physiol 77:207–239. doi:10.1113/jphysiol.1933.sp002964 pmid:16994385
    OpenUrlCrossRefPubMed
  27. ↵
    1. Grunwald ME,
    2. Yu WP,
    3. Yu HH,
    4. Yau KW
    (1998) Identification of a domain on the beta-subunit of the rod cGMP-gated cation channel that mediates inhibition by calcium-calmodulin. J Biol Chem 273:9148–9157. doi:10.1074/jbc.273.15.9148 pmid:9535905
    OpenUrlAbstract/FREE Full Text
  28. ↵
    1. Haeseleer F,
    2. Imanishi Y,
    3. Maeda T,
    4. Possin DE,
    5. Maeda A,
    6. Lee A,
    7. Rieke F,
    8. Palczewski K
    (2004) Essential role of Ca2+-binding protein 4, a Cav1.4 channel regulator, in photoreceptor synaptic function. Nat Neurosci 7:1079–1087. doi:10.1038/nn1320 pmid:15452577
    OpenUrlCrossRefPubMed
  29. ↵
    1. Hayashi S,
    2. McMahon AP
    (2002) Efficient recombination in diverse tissues by a tamoxifen-inducible form of cre: a tool for temporally regulated gene activation/inactivation in the mouse. Dev Biol 244:305–318. doi:10.1006/dbio.2002.0597 pmid:11944939
    OpenUrlCrossRefPubMed
  30. ↵
    1. Hoyo NL,
    2. López-Begines S,
    3. Rosa JL,
    4. Chen J,
    5. Méndez A
    (2014) Functional EF-hands in neuronal calcium sensor GCAP2 determine its phosphorylation state and subcellular distribution in vivo, and are essential for photoreceptor cell integrity. PLoS Genet 10:e1004480. doi:10.1371/journal.pgen.1004480 pmid:25058152
    OpenUrlCrossRefPubMed
  31. ↵
    1. Hüttl S,
    2. Michalakis S,
    3. Seeliger M,
    4. Luo DG,
    5. Acar N,
    6. Geiger H,
    7. Hudl K,
    8. Mader R,
    9. Haverkamp S,
    10. Moser M,
    11. Pfeifer A,
    12. Gerstner A,
    13. Yau KW,
    14. Biel M
    (2005) Impaired channel targeting and retinal degeneration in mice lacking the cyclic nucleotide-gated channel subunit CNGB1. J Neurosci 25:130–138. doi:10.1523/JNEUROSCI.3764-04.2005 pmid:15634774
    OpenUrlAbstract/FREE Full Text
  32. ↵
    1. Kaupp UB,
    2. Niidome T,
    3. Tanabe T,
    4. Terada S,
    5. Bönigk W,
    6. Stühmer W,
    7. Cook NJ,
    8. Kangawa K,
    9. Matsuo H,
    10. Hirose T,
    11. Miyata T,
    12. Numa S
    (1989) Primary structure and functional expression from complementary DNA of the rod photoreceptor cyclic GMP-gated channel. Nature 342:762–766. doi:10.1038/342762a0 pmid:2481236
    OpenUrlCrossRefPubMed
  33. ↵
    1. Koch S,
    2. Sothilingam V,
    3. Garcia Garrido M,
    4. Tanimoto N,
    5. Becirovic E,
    6. Koch F,
    7. Seide C,
    8. Beck SC,
    9. Seeliger MW,
    10. Biel M,
    11. Mühlfriedel R,
    12. Michalakis S
    (2012) Gene therapy restores vision and delays degeneration in the CNGB1(−/−) mouse model of retinitis pigmentosa. Hum Mol Genet 21:4486–4496. doi:10.1093/hmg/dds290 pmid:22802073
    OpenUrlCrossRefPubMed
  34. ↵
    1. Kwon HB,
    2. Sabatini BL
    (2011) Glutamate induces de novo growth of functional spines in developing cortex. Nature 474:100–104. doi:10.1038/nature09986 pmid:21552280
    OpenUrlCrossRefPubMed
  35. ↵
    1. LaVail MM
    (1973) Kinetics of rod outer segment renewal in the developing mouse retina. J Cell Biol 58:650–661. doi:10.1083/jcb.58.3.650 pmid:4747920
    OpenUrlAbstract/FREE Full Text
  36. ↵
    1. Ma H,
    2. Butler MR,
    3. Thapa A,
    4. Belcher J,
    5. Yang F,
    6. Baehr W,
    7. Biel M,
    8. Michalakis S,
    9. Ding XQ
    (2015) cGMP/protein kinase G signaling suppresses inositol 1,4,5-trisphosphate receptor phosphorylation and promotes endoplasmic reticulum stress in photoreceptors of cyclic nucleotide-gated channel-deficient mice. J Biol Chem 290:20880–20892. doi:10.1074/jbc.M115.641159 pmid:26124274
    OpenUrlAbstract/FREE Full Text
  37. ↵
    1. Mansergh F,
    2. Orton NC,
    3. Vessey JP,
    4. Lalonde MR,
    5. Stell WK,
    6. Tremblay F,
    7. Barnes S,
    8. Rancourt DE,
    9. Bech-Hansen NT
    (2005) Mutation of the calcium channel gene Cacna1f disrupts calcium signaling, synaptic transmission and cellular organization in mouse retina. Hum Mol Genet 14:3035–3046. doi:10.1093/hmg/ddi336 pmid:16155113
    OpenUrlCrossRefPubMed
  38. ↵
    1. Marc RE,
    2. Jones BW
    (2003) Retinal remodeling in inherited photoreceptor degenerations. Mol Neurobiol 28:139–147. doi:10.1385/MN:28:2:139 pmid:14576452
    OpenUrlCrossRefPubMed
  39. ↵
    1. Marc RE,
    2. Jones BW,
    3. Watt CB,
    4. Strettoi E
    (2003) Neural remodeling in retinal degeneration. Prog Retin Eye Res 22:607–655. doi:10.1016/S1350-9462(03)00039-9 pmid:12892644
    OpenUrlCrossRefPubMed
  40. ↵
    1. Maxeiner S,
    2. Luo F,
    3. Tan A,
    4. Schmitz F,
    5. Südhof TC
    (2016) How to make a synaptic ribbon: RIBEYE deletion abolishes ribbons in retinal synapses and disrupts neurotransmitter release. EMBO J 35:1098–1114. doi:10.15252/embj.201592701 pmid:26929012
    OpenUrlCrossRefPubMed
  41. ↵
    1. Mendez A,
    2. Burns ME,
    3. Sokal I,
    4. Dizhoor AM,
    5. Baehr W,
    6. Palczewski K,
    7. Baylor DA,
    8. Chen J
    (2001) Role of guanylate cyclase-activating proteins (GCAPs) in setting the flash sensitivity of rod photoreceptors. Proc Natl Acad Sci U S A 98:9948–9953. doi:10.1073/pnas.171308998 pmid:11493703
    OpenUrlAbstract/FREE Full Text
  42. ↵
    1. Moaven H,
    2. Koike Y,
    3. Jao CC,
    4. Gurevich VV,
    5. Langen R,
    6. Chen J
    (2013) Visual arrestin interaction with clathrin adaptor AP-2 regulates photoreceptor survival in the vertebrate retina. Proc Natl Acad Sci U S A 110:9463–9468. doi:10.1073/pnas.1301126110 pmid:23690606
    OpenUrlAbstract/FREE Full Text
  43. ↵
    1. Molday RS,
    2. Moritz OL
    (2015) Photoreceptors at a glance. J Cell Sci 128:4039–4045. doi:10.1242/jcs.175687 pmid:26574505
    OpenUrlAbstract/FREE Full Text
  44. ↵
    1. Ou J,
    2. Vijayasarathy C,
    3. Ziccardi L,
    4. Chen S,
    5. Zeng Y,
    6. Marangoni D,
    7. Pope JG,
    8. Bush RA,
    9. Wu Z,
    10. Li W,
    11. Sieving PA
    (2015) Synaptic pathology and therapeutic repair in adult retinoschisis mouse by AAV-RS1 transfer. J Clin Invest 125:2891–2903. doi:10.1172/JCI81380 pmid:26098217
    OpenUrlCrossRefPubMed
  45. ↵
    1. Pahlberg J,
    2. Frederiksen R,
    3. Pollock GE,
    4. Miyagishima KJ,
    5. Sampath AP,
    6. Cornwall MC
    (2017) Voltage-sensitive conductances increase the sensitivity of rod photoresponses following pigment bleaching. J Physiol 595:3459–3469. doi:10.1113/JP273398 pmid:28168711
    OpenUrlCrossRefPubMed
  46. ↵
    1. Poetsch A,
    2. Molday LL,
    3. Molday RS
    (2001) The cGMP-gated channel and related glutamic acid-rich proteins interact with peripherin-2 at the rim region of rod photoreceptor disc membranes. J Biol Chem 276:48009–48016. doi:10.1074/jbc.M108941200 pmid:11641407
    OpenUrlAbstract/FREE Full Text
  47. ↵
    1. Puthussery T,
    2. Taylor WR
    (2010) Functional changes in inner retinal neurons in animal models of photoreceptor degeneration. Adv Exp Med Biol 664:525–532. doi:10.1007/978-1-4419-1399-9_60 pmid:20238055
    OpenUrlCrossRefPubMed
  48. ↵
    1. Quartilho A,
    2. Simkiss P,
    3. Zekite A,
    4. Xing W,
    5. Wormald R,
    6. Bunce C
    (2016) Leading causes of certifiable visual loss in england and wales during the year ending 31 march 2013. Eye 30:602–607. doi:10.1038/eye.2015.288 pmid:26821759
    OpenUrlCrossRefPubMed
  49. ↵
    1. Sampath AP,
    2. Rieke F
    (2004) Selective transmission of single photon responses by saturation at the rod-to-rod bipolar synapse. Neuron 41:431–443. doi:10.1016/S0896-6273(04)00005-4 pmid:14766181
    OpenUrlCrossRefPubMed
  50. ↵
    1. Saszik SM,
    2. Robson JG,
    3. Frishman LJ
    (2002) The scotopic threshold response of the dark-adapted electroretinogram of the mouse. J Physiol 543:899–916. doi:10.1113/jphysiol.2002.019703 pmid:12231647
    OpenUrlCrossRefPubMed
  51. ↵
    1. Scholl HP,
    2. Strauss RW,
    3. Singh MS,
    4. Dalkara D,
    5. Roska B,
    6. Picaud S,
    7. Sahel JA
    (2016) Emerging therapies for inherited retinal degeneration. Sci Transl Med 8:368rv6. doi:10.1126/scitranslmed.aaf2838 pmid:27928030
    OpenUrlFREE Full Text
  52. ↵
    1. Sher A,
    2. Jones BW,
    3. Huie P,
    4. Paulus YM,
    5. Lavinsky D,
    6. Leung LS,
    7. Nomoto H,
    8. Beier C,
    9. Marc RE,
    10. Palanker D
    (2013) Restoration of retinal structure and function after selective photocoagulation. J Neurosci 33:6800–6808. doi:10.1523/JNEUROSCI.1044-12.2013 pmid:23595739
    OpenUrlAbstract/FREE Full Text
  53. ↵
    1. Sikkink SK,
    2. Biswas S,
    3. Parry NR,
    4. Stanga PE,
    5. Trump D
    (2007) X-linked retinoschisis: an update. J Med Genet 44:225–232. doi:10.1136/jmg.2006.047340 pmid:17172462
    OpenUrlAbstract/FREE Full Text
  54. ↵
    1. Simmons AB,
    2. Bloomsburg SJ,
    3. Sukeena JM,
    4. Miller CJ,
    5. Ortega-Burgos Y,
    6. Borghuis BG,
    7. Fuerst PG
    (2017) DSCAM-mediated control of dendritic and axonal arbor outgrowth enforces tiling and inhibits synaptic plasticity. Proc Natl Acad Sci U S A 114:E10224–E10233. doi:10.1073/pnas.1713548114 pmid:29114051
    OpenUrlAbstract/FREE Full Text
  55. ↵
    1. Soto F,
    2. Kerschensteiner D
    (2015) Synaptic remodeling of neuronal circuits in early retinal degeneration. Front Cell Neurosci 9:395. doi:10.3389/fncel.2015.00395 pmid:26500497
    OpenUrlCrossRefPubMed
  56. ↵
    1. Vinberg F,
    2. Kolesnikov AV,
    3. Kefalov VJ
    (2014) Ex vivo ERG analysis of photoreceptors using an in vivo ERG system. Vision research 101:108–117. doi:10.1016/j.visres.2014.06.003 pmid:24959652
    OpenUrlCrossRefPubMed
  57. ↵
    1. Vinberg F,
    2. Wang T,
    3. Molday RS,
    4. Chen J,
    5. Kefalov VJ
    (2015) A new mouse model for stationary night blindness with mutant Slc24a1 explains the pathophysiology of the associated human disease. Human molecular genetics 24:5915–5929. doi:10.1093/hmg/ddv319 pmid:26246500
    OpenUrlCrossRefPubMed
  58. ↵
    1. Waldner DM,
    2. Bech-Hansen NT,
    3. Stell WK
    (2018) Channeling vision: CaV1.4-A critical link in retinal signal transmission. Biomed Res Int 2018:7272630. doi:10.1155/2018/7272630 pmid:29854783
    OpenUrlCrossRefPubMed
  59. ↵
    1. Wang T,
    2. Chen J
    (2014) Induction of the unfolded protein response by constitutive G-protein signaling in rod photoreceptor cells. J Biol Chem 289:29310–29321. doi:10.1074/jbc.M114.595207 pmid:25183010
    OpenUrlAbstract/FREE Full Text
  60. ↵
    1. Wang T,
    2. Tsang SH,
    3. Chen J
    (2017) Two pathways of rod photoreceptor cell death induced by elevated cGMP. Hum Mol Genet 26:2299–2306. doi:10.1093/hmg/ddx121 pmid:28379353
    OpenUrlCrossRefPubMed
  61. ↵
    1. Wang X,
    2. Zhao L,
    3. Zhang Y,
    4. Ma W,
    5. Gonzalez SR,
    6. Fan J,
    7. Kretschmer F,
    8. Badea TC,
    9. Qian HH,
    10. Wong WT
    (2017) Tamoxifen provides structural and functional rescue in murine models of photoreceptor degeneration. J Neurosci 37:3294–3310. doi:10.1523/JNEUROSCI.2717-16.2017 pmid:28235894
    OpenUrlAbstract/FREE Full Text
  62. ↵
    1. Wang Y,
    2. Fehlhaber KE,
    3. Sarria I,
    4. Cao Y,
    5. Ingram NT,
    6. Guerrero-Given D,
    7. Throesch B,
    8. Baldwin K,
    9. Kamasawa N,
    10. Ohtsuka T,
    11. Sampath AP,
    12. Martemyanov KA
    (2017) The auxiliary calcium channel subunit α2δ4 is required for axonal elaboration, synaptic transmission, and wiring of rod photoreceptors. Neuron 93:1359–1374.e6. doi:10.1016/j.neuron.2017.02.021 pmid:28262416
    OpenUrlCrossRefPubMed
  63. ↵
    1. Yao K,
    2. Qiu S,
    3. Wang YV,
    4. Park SJH,
    5. Mohns EJ,
    6. Mehta B,
    7. Liu X,
    8. Chang B,
    9. Zenisek D,
    10. Crair MC,
    11. Demb JB,
    12. Chen B
    (2018) Restoration of vision after de novo genesis of rod photoreceptors in mammalian retinas. Nature 560:484–488. doi:10.1038/s41586-018-0425-3 pmid:30111842
    OpenUrlCrossRefPubMed
  64. ↵
    1. Yu WQ,
    2. Grzywacz NM,
    3. Lee EJ,
    4. Field GD
    (2017) Cell type-specific changes in retinal ganglion cell function induced by rod death and cone reorganization in rats. J Neurophysiol 118:434–454. doi:10.1152/jn.00826.2016 pmid:28424296
    OpenUrlCrossRefPubMed
  65. ↵
    1. Zhang Y,
    2. Molday LL,
    3. Molday RS,
    4. Sarfare SS,
    5. Woodruff ML,
    6. Fain GL,
    7. Kraft TW,
    8. Pittler SJ
    (2009) Knock-out of GARPs and the beta-subunit of the rod cGMP-gated channel disrupts disk morphogenesis and rod outer segment structural integrity. J Cell Sci 122:1192–1200. doi:10.1242/jcs.042531 pmid:19339551
    OpenUrlAbstract/FREE Full Text
Back to top

In this issue

The Journal of Neuroscience: 39 (34)
Journal of Neuroscience
Vol. 39, Issue 34
21 Aug 2019
  • Table of Contents
  • Table of Contents (PDF)
  • About the Cover
  • Index by author
  • Advertising (PDF)
  • Ed Board (PDF)
Email

Thank you for sharing this Journal of Neuroscience article.

NOTE: We request your email address only to inform the recipient that it was you who recommended this article, and that it is not junk mail. We do not retain these email addresses.

Enter multiple addresses on separate lines or separate them with commas.
Activation of Rod Input in a Model of Retinal Degeneration Reverses Retinal Remodeling and Induces Formation of Functional Synapses and Recovery of Visual Signaling in the Adult Retina
(Your Name) has forwarded a page to you from Journal of Neuroscience
(Your Name) thought you would be interested in this article in Journal of Neuroscience.
CAPTCHA
This question is for testing whether or not you are a human visitor and to prevent automated spam submissions.
Print
View Full Page PDF
Citation Tools
Activation of Rod Input in a Model of Retinal Degeneration Reverses Retinal Remodeling and Induces Formation of Functional Synapses and Recovery of Visual Signaling in the Adult Retina
Tian Wang, Johan Pahlberg, Jon Cafaro, Rikard Frederiksen, A.J. Cooper, Alapakkam P. Sampath, Greg D. Field, Jeannie Chen
Journal of Neuroscience 21 August 2019, 39 (34) 6798-6810; DOI: 10.1523/JNEUROSCI.2902-18.2019

Citation Manager Formats

  • BibTeX
  • Bookends
  • EasyBib
  • EndNote (tagged)
  • EndNote 8 (xml)
  • Medlars
  • Mendeley
  • Papers
  • RefWorks Tagged
  • Ref Manager
  • RIS
  • Zotero
Respond to this article
Request Permissions
Share
Activation of Rod Input in a Model of Retinal Degeneration Reverses Retinal Remodeling and Induces Formation of Functional Synapses and Recovery of Visual Signaling in the Adult Retina
Tian Wang, Johan Pahlberg, Jon Cafaro, Rikard Frederiksen, A.J. Cooper, Alapakkam P. Sampath, Greg D. Field, Jeannie Chen
Journal of Neuroscience 21 August 2019, 39 (34) 6798-6810; DOI: 10.1523/JNEUROSCI.2902-18.2019
del.icio.us logo Digg logo Reddit logo Twitter logo Facebook logo Google logo Mendeley logo
  • Tweet Widget
  • Facebook Like
  • Google Plus One

Jump to section

  • Article
    • Abstract
    • Introduction
    • Materials and Methods
    • Results
    • Discussion
    • Footnotes
    • References
  • Figures & Data
  • Info & Metrics
  • eLetters
  • PDF

Keywords

  • gene therapy
  • neural plasticity
  • neural transmission
  • photoreceptor cell death
  • retinal circuitry
  • retinal degeneration

Responses to this article

Respond to this article

Jump to comment:

No eLetters have been published for this article.

Related Articles

Cited By...

More in this TOC Section

Research Articles

  • Adding Meaning to Memories: How Parietal Cortex Combines Semantic Content with Episodic Experience
  • KCNQ2/3 Gain-of-Function Variants and Cell Excitability: Differential Effects in CA1 versus L2/3 Pyramidal Neurons
  • Perturbed Information Processing Complexity in Experimental Epilepsy
Show more Research Articles

Neurobiology of Disease

  • Perturbed Information Processing Complexity in Experimental Epilepsy
  • Glial Cell Adhesion Molecule (GlialCAM) Determines Proliferative Versus Invasive Cell States in Glioblastoma
  • Dissociable effects of Alzheimer’s Disease-related cognitive dysfunction and aging on functional brain network segregation
Show more Neurobiology of Disease
  • Home
  • Alerts
  • Visit Society for Neuroscience on Facebook
  • Follow Society for Neuroscience on Twitter
  • Follow Society for Neuroscience on LinkedIn
  • Visit Society for Neuroscience on Youtube
  • Follow our RSS feeds

Content

  • Early Release
  • Current Issue
  • Issue Archive
  • Collections

Information

  • For Authors
  • For Advertisers
  • For the Media
  • For Subscribers

About

  • About the Journal
  • Editorial Board
  • Privacy Policy
  • Contact
(JNeurosci logo)
(SfN logo)

Copyright © 2023 by the Society for Neuroscience.
JNeurosci Online ISSN: 1529-2401

The ideas and opinions expressed in JNeurosci do not necessarily reflect those of SfN or the JNeurosci Editorial Board. Publication of an advertisement or other product mention in JNeurosci should not be construed as an endorsement of the manufacturer’s claims. SfN does not assume any responsibility for any injury and/or damage to persons or property arising from or related to any use of any material contained in JNeurosci.