Article Figures & Data
Figures
- Figure 1.
RLN3 induces an RXFP3-dependent outward whole-cell current in a majority of PVN MNCs from male and female rats. A, RLN3-induced outward whole-cell current (voltage-clamp recording, command potential −50 mV) during pharmacological deafferentation (TTX, DL-AP5, CNQX, BIC) and its blockade by a potent RXFP3 antagonist, R3(B1-22)R. Marked areas represent voltage-clamp stimulations to −30 and −20 mV (example shown in D). Black represents baseline. Red represents response to RLN3. B, Amplitude of RLN3-induced outward whole-cell current in MNCs from male and female rats at the command potential of −50 mV. No significant sex difference was observed (unpaired t test with Welch's correction, p > 0.05). C, Proportion of RLN3-responsive versus nonresponsive MNCs in voltage-clamp recordings. No significant sex difference was observed (Fisher's exact test, p > 0.05). D, RLN3-induced whole-cell outward current during voltage stimulation to −30 and −20 mV. Inset, Stimulation protocol. Note the absence of the RLN3-induced effect in the presence of R3(B1-22)R (F). Graph represents the amplitude of RLN3-induced current and the proportion of RLN3-responsive male and female MNCs displaying a RLN3-induced change in current at given membrane potentials. Color represents effect. White represents no effect. No significant sex difference was observed in current amplitude (unpaired t test with Welch's correction, p > 0.05) or in the proportions of MNCs with an RLN3-induced change during voltage stimulations (Fisher's exact test, p > 0.05). E, RLN3-induced current amplitude at command potential of −50 mV under control conditions and in the presence of R3(B1-22)R. *p < 0.05, significant influence of treatment with R3(B1-22)R (repeated-measures two-way ANOVA). No significant sex difference or interaction of sex and treatment were observed (p > 0.05). F, Blockade of RLN3-induced current during stimulation to −30 and −20 mV in the presence of R3(B1-22)R. Inset, stimulation protocol. Note the absence of RLN3-induced effect. Graph represents the blockade of RLN3-induced current during stimulation expressed as the remaining percentage of the RLN3-induced current amplitude under paired control conditions. *p < 0.05 and **p < 0.01 indicate the significant reduction tested using an unpaired t-test with Welch's correction. All error bars represents SD.
- Figure 2.
RXFP3 activation with a selective agonist, RXFP3-A2, is inhibitory in the majority of PVN MNCs from male and female rats. A, RXFP3-A2-induced inhibition of spiking and hyperpolarization (current-clamp recording, zero-current mode). Hyperpolarization persists during blockade of spiking and pharmacological deafferentation (in ACSF with TTX, DL-AP5, CNQX, BIC). Inset, The proportion of RXFP3-A2-responsive versus nonresponsive MNCs in current-clamp recordings. No significant sex difference was observed (Fisher's exact test, p > 0.05). B, RXFP3-A2-induced reduction of spiking frequency (recorded in normal ACSF), and RXFP3-A2-induced membrane hyperpolarization (recorded in ACSF with TTX, DL-AP5, CNQX, BIC). No significant sex difference in either parameter was observed (unpaired t test with Welch's correction, p > 0.05). C, RXFP3-A2-induced reduction of voltage responses to hyperpolarizing current pulses indicating a decrease in input resistance. Inset, Stimulation protocol. Traces come from the recording in A (marked with asterisks). Graph represents the calculated change in input membrane resistance and the proportion of male and female RXFP3-A2-inhibited MCNs displaying an accompanying decrease in input membrane resistance. Color represents effect. White represents no effect. No significant sex difference was observed in the RXFP3-A2-induced change (unpaired t test with Welch's correction, p > 0.05) or the proportions of MNCs with an RXFP3-A2-induced decrease in input resistance accompanying the RXFP3-A2-induced inhibition (Fisher's exact test, p > 0.05). D, RXFP3-A2-induced outward whole-cell current (voltage-clamp recording, command potential −50 mV) during pharmacological deafferentation (TTX, DL-AP5, CNQX, BIC). Marked areas represent voltage-clamp stimulations to −30 and −20 mV (example shown in G). Black represents baseline. Red represents response to RXFP3-A2. E, Amplitude of RXFP3-A2-induced outward whole-cell current in MNCs from male and female rats at command potential of −50 mV. No significant sex difference was observed (unpaired t test with Welch's correction, p > 0.05). F, Proportion of RXFP3-A2-responsive versus nonresponsive MNCs in voltage-clamp recordings. No significant sex difference was observed (Fisher's exact test, p > 0.05). G, RXFP3-A2-induced whole-cell outward current during voltage stimulation to −30 and −20 mV. Inset, Stimulation protocol. Graph represents the amplitude of RXFP3-A2-induced current and proportion of RXFP3-A2-responsive male and female MNCs displaying RXFP3-A2-induced change in whole-cell current at given membrane potentials. Color represents effect. White represents no effect. No significant sex difference was observed in current amplitude (unpaired t test with Welch's correction, p > 0.05), or in the proportions of MNCs with an RXFP3-A2-induced change during voltage stimulations (Fisher's exact test, p > 0.05). H, RXFP3-A2-induced whole-cell inward current during voltage stimulation to −100 mV in a minor subset of MNCs. Inset, stimulation protocol. Graph represents the amplitude of the RXFP3-A2-induced current and proportion of male and female RXFP3-A2-responsive MCNs displaying increased inward whole-cell current at the command potential of −100 mV. Color represents effect. White represents no effect. No significant sex differences were observed in the amplitude of RXFP3-A2-induced current (unpaired t test with Welch's correction, p > 0.05), or in the proportions of MNCs with RXFP3-A2-induced change during voltage stimulations (Fisher's exact test, p > 0.05). I, J, Series of fluorescent projection images of biocytin-filled OXT-ir (in I) or AVP-ir (in J) MNCs (white arrowhead). Scale bar, 10 µm. K, Amplitude of RXFP3-A2-induced outward whole-cell current (command potential −50 mV) in OXT and AVP MNCs from male and female rats. No significant effects of peptide content, sex, and interaction of peptide content and sex were observed in the amplitude of RXFP3-A2-induced outward whole-cell current (two-way ANOVA, p > 0.05). All error bars represents SD.
- Figure 3.
RXFP3 activation induces M-like potassium current. A, RXFP3-A2-induced outward current at a command potential of −50 mV under several different conditions expressed as a remaining percentage of the RXFP3-A2-induced current amplitude under paired control conditions. Triangle represents male. Circle represents female. **p < 0.01; ***p < 0.001; ****p < 0.0001; significant influence of treatment with the compound (repeated-measures two-way ANOVA). No significant sex differences or interaction of sex and treatment were observed (p > 0.05). Note the significant dose-dependent effect of XE991. ***p <0.001, significant influence of the XE991 concentrations (two-way ANOVA). No significant sex differences or interaction of sex and XE991 concentration were observed (p > 0.05). B-E, RXFP3-A2-induced outward whole-cell current (command potential −50 mV) during pharmacological deafferentation (TTX, DL-AP5, CNQX, BIC) and reexposure to RXFP3-A2 under several conditions: control (repeated RXFP3 application with no additional compound, in B) increased extracellular [K+] in the ACSF (in C), presence of Cd2+ (200 μm, in D), and presence of XE991 (50 μm, in E). E, Marked areas represent voltage-clamp stimulations to −30 and −20 mV (example shown in F). Black represents baseline. Red represents response to RXFP3-A2. F, RXFP3-A2-induced whole-cell outward current during voltage stimulation to −30 and −20 mV. Inset, Stimulation protocol. Note the absence of the RXFP3-A2-induced effect in the presence of XE991 (50 μm). G, The I--V relationship of RXFP3-A2-induced outward whole-cell current under control conditions and in the presence of XE991 (10 and 50 μm, respectively). Note the dose-dependent blockade of RXFP3-A2-induced current by XE991. *p < 0.05; **p < 0.01; ***p < 0.001; significant influence of treatment with XE991 (repeated-measures two-way ANOVA). No significant sex differences or interaction of sex and treatment were observed (p > 0.05). H, Proportions of male and female MNCs expressing and coexpressing RXFP3 and KCNQ subunit mRNA detected by sc-RT-PCR. Only MNCs with detectable GAPDH mRNA were analyzed. KCNQ4 and KCNQ5 mRNA was not detected in our PVN MNCs preparations. No significant sex difference in these proportions was observed (χ2 test, p > 0.05). Image represents exemplary sc-RT-PCR data from three female MNCs. All error bars represents SD.
- Figure 4.
NI RLN3 neurons innervate the PVN and its adjacent areas, with a higher fiber density in female than in male rats. A, Schematic representation of areas analyzed for DAB-stained RLN3 fibers in the PVN and adjacent perinuclear zone (PZ). Scale bar, 200 µm. B, Area fraction of RLN3-ir fibers in the analyzed areas. Between-subjects statistical testing with repeated-measures two-way ANOVA revealed the significant effect of the area of interest (PVN vs PZ, *p < 0.05), sex (males vs females, ††p <0.01), as well as interaction (‡p < 0.05), pointing to a higher density of RLN3-ir fibers in the peri-PVN zone than in the PVN and in females than in males, with a more profound sex difference observed in the peri-PVN zone. C, Light microscopic projection images of DAB-stained RLN3-ir fibers in the PVN and PZ area of male (left) and female (right) rats. Images are magnifications of the areas marked with black squares in A. Note the difference between the PVN and the peri-PVN zone. Scale bar, 20 µm. D, Confocal projection image illustrating RLN3-ir neurons (cyan) and neurons filled with retrograde tracer (FluoroRed, magenta) in the NI. Magnification of the area indicated by a white rectangle represents RLN3-ir neurons, RLN3-ir/FluoroRed-positive neurons (white arrowheads), and RLN3-negative/FluoroRed-positive neuron (empty arrowhead). Distance from bregma indicated. Scale bars: top, 200 µm; bottom, 20 µm. E, F, Exemplary injection sites of fluorescent retrograde tracers (FluoroGreen in E and FluoroRed in F) and reconstructions of single NI sections showing the distribution of RLN3-ir neurons (cyan circles), RLN3-ir/retrograde tracer-positive (green circles in E and red circles in F), and RLN3-negative/retrograde tracer-positive (open green circles in E and open red circles in F). The injection in E is restricted to the PVN, whereas the injection in F extends beyond the PVN borders, resulting in different number of RLN3-ir/retrograde tracer-positive between these two injections. Distance from bregma indicated. Scale bars: PVN reconstructions, 400 µm; NI reconstructions, 200 µm. 4V, Fourth ventricle; D, dorsal perinuclear zone of the PVN; L, lateral perinuclear zone of the PVN; NIc, NI pars compacta; NId, NI pars dissipata; PDTg, posterodorsal tegmental nucleus; PZ, perinuclear zone of the PVN; V, ventral perinuclear zone of the PVN. All error bars represents SD.
- Figure 5.
Injection of an RXFP3 antagonist into the PVN reduced BE in female rats. A, Timeline of the BE induction protocol. Rats in the BE group were subjected to three cycles of food restriction (66% of regular chow intake) and refeeding (ad libitum chow), whereas the control group had ad libitum access to chow. Black arrowheads indicate access to the HPF for 2 h in both groups. Double arrows indicate bilateral intra-PVN injections of vehicle (0.5 µl) or R3(B1-22)R (0.1 µg/0.5 µl) made on the test day. In the BE group, injections were followed by frustration stress procedure for 15 min, and both groups had 2 h access to the HPF afterward. After an additional cycle of restriction and refeeding, the test was repeated with reversed injection conditions, so that at the end of the study, each rat received both vehicle and R3(B1-22)R in separate tests. B, Body weights of rats subjected (BE) or not (control) to cycles of intermittent food restriction followed by refeeding. Between-subjects statistical testing with a repeated-measures two-way ANOVA revealed the significant effect of time (****p < 0.0001) and interaction of time and group (‡‡‡‡p < 0.0001), with no differences observed between groups, pointing to time-dependent changes with no permanent differences in body weight between feeding conditions. C, HPF intake at 30 and 120 min during the BE tests and the effect of intra-PVN injection of the RXFP3 antagonist, R3(B1-22)R. Between-subjects statistical testing with a two-way ANOVA revealed a significant effect of the treatment (vehicle vs R3(B1-22)R, **p <0.01, ***p < 0.001), experimental group (control vs BE, †p < 0.05, ††††p < 0.0001), and interaction (‡‡p < 0.01), pointing to a higher HPF intake in BE than control rats and the effectiveness of RXFP3 antagonism to reduce the HPF intake only in the BE group. D, Reconstruction of the PVN area on coronal brain sections representing the intra-PVN injections sites in rats included in the experiment. Distance from bregma indicated. Scale bar, 400 µm. All error bars represents SD.
Tables
Gene Pairs of primers (from 5′ to 3′) GenBank no. First-round PCR Second-round PCR GAPDH AF106860.2 Sense CCTGCACCACCAACTGCTTAGC CCTGCACCACCAACTGCTTAGC Antisense CTCGGCCGCCTGCTTCAC ATGTCAGATCCACAACGGATACATTGG RXFP3 NM_001008310.1 Sense CAAGCTCCTGGGTTGGGACC CAAGCTCCTGGGTTGGGACC Antisense GCATTAAGTGGCGCCAGGGC GGCGCACTAAGCAGTAGAGGAT KCNQ2 NM_133322.1 Sense GTGCTGATTGCCTCCATTGCTG GTGCTGATTGCCTCCATTGCTG Antisense CCAATGGTTGTCAGGGTGATCAG GGCCAGGATGAGGCAGAGG KCNQ3 NM_031597.4 Sense CTATTCGGACCACATCTCACCC CTATTCGGACCACATCTCACCC Antisense ACTACAGTACCAGGAGTCAGCC CATAGGCATGGATCCACTGGG KCNQ4 XM_233477.8 Sense GACGATTACACTGACGACCATTGG GACGATTACACTGACGACCATTGG Antisense CCAGGGCAGAAGGAGGCAC CTCAAACAAGAGGGCCAGCTC KCNQ5 XM_001071249.3 Sense GCTGGGCTCCGTGGTTTACG GCTGGGCTCCGTGGTTTACG Antisense CTTCTGCACTTTGGTGGGGCTG GCTTGCTGCCTCCCCTTGTTC ↵aGenBank accession number and sequences of primers used for each of the examined genes in both rounds of PCR.
Inhibitory Excitatory Male (N = 11) Female (N = 9) Male (N = 11) Female (N = 9) Baseline RLN3 Baseline RLN3 Baseline RLN3 Baseline RLN3 RLN3 Spontaneous synaptic activity Frequency (Hz) 8.9 ± 5.4 9.2 ± 5.7 7.8 ± 5.9 7.9 ± 5.7 1.3 ± 1.0 1.2 ± 0.6 0.8 ± 0.3 0.9 ± 0.4 Mean amplitude (pA) 33.6 ± 9.6 32.7 ± 9.9 31.0 ± 5.4 30.2 ± 4.6 18.9 ± 2.7 18.9 ± 3.4 21.6 ± 3.5 21.3 ± 3.5 Mean rise time (ms) 2.8 ± 0.4 2.8 ± 0.3 2.7 ± 0.3 2.7 ± 0.2 2.4 ± 0.2 2.3 ± 0.1 2.4 ± 0.2 2.4 ± 0.2 Decay time constant (ms) 5.5 ± 1.3 5.6 ± 1.3 5.0 ± 1.2 4.9 ± 1.0 2.3 ± 0.8 2.3 ± 0.6 2.1 ± 0.5 2.0 ± 0.5 Male (N = 9) Female (N = 10) Male (N = 9) Female (N = 10) Baseline RLN3 Baseline RLN3 Baseline RLN3 Baseline RLN3 Miniature synaptic activity Frequency (Hz) 10.1 ± 6.0 9.5 ± 5.3 6.4 ± 4.4 6.4 ± 4.5 1.5 ± 1.6 1.1 ± 0.6 0.9 ± 0.4 0.9 ± 0.4 Mean amplitude (pA) 25.8 ± 3.8 26.1 ± 4.0 26.1 ± 5.6 25.7 ± 5.3 19.6 ± 5.3 18.9 ± 3.6 16.3 ± 3.4 16.3 ± 3.2 Mean rise time (ms) 2.6 ± 0.2 2.6 ± 0.2 2.6 ± 0.2 2.6 ± 0.2 2.3 ± 0.1 2.3 ± 0.1 2.3 ± 0.2 2.4 ± 0.1 Decay time constant (ms) 4.7 ± 0.8 4.7 + 0.7 4.9 ± 0.9 5.1 ± 0.8 2.1 ± 0.9 1.8 ± 0.7 2.0 ± 0.6 2.0 ± 0.5 Male (N = 10) Female (N = 9) Male (N = 10) Female (N = 9) Baseline A2 Baseline A2 Baseline A2 Baseline A2 RXFP3-A2 Spontaneous synaptic activity Frequency (Hz) 8.6 ± 7.3 8.4 ± 7.1 11.3 ± 6.7 11.0 ± 6.5 1.0 ± 0.8 1.0 ± 0.6 1.1 ± 0.6 1.1 ± 0.5 Mean amplitude (pA) 32.0 ± 5.5 31.8 ± 6.3 34.1 ± 7.4 33.0 ± 7.2 19.5 ± 4.8 20.9 ± 6.3 19.7 ± 2.3 20.0 ± 3.0 Mean rise time (ms) 2.8 ± 0.3 2.7 ± 0.2 2.8 ± 0.2 2.8 ± 0.2 2.4 ± 0.2 2.4 ± 0.2 2.3 ± 0.1 2.3 ± 0.1 Decay time constant (ms) 5.9 ± 1.1 5.7 ± 1.1 5.8 ± 1.3 5.9 ± 1.2 3.0 ± 1.6 2.7 ± 1.2 2.1 ± 0.5 2.1 ± 0.4 Male (N = 10) Female (N = 8) Male (N = 10) Female (N = 8) Baseline A2 Baseline A2 Baseline A2 Baseline A2 Miniature synaptic activity Frequency (Hz) 6.8 ± 3.2 6.7 ± 3.0 7.8 ± 3.7 7.3 ± 3.7 1.0 ± 0.5 1.1 ± 0.5 0.7 ± 0.4 0.7 ± 0.4 Mean amplitude (pA) 28.7 ± 5.7 29.2 ± 5.6 32.5 ± 3.2 32.8 ± 3.5 19.6 ± 4.1 19.8 ± 3.2 19.4 ± 1.1 19.3 ± 2.5 Mean rise time (ms) 3.1 ± 0.4 3.0 ± 0.3 3.1 ± 0.8 3.0 ± 0.3 2.8 ± 0.3 2.9 ± 0.2 2.8 ± 0.2 2.8 ± 0.2 Decay time constant (ms) 4.7 ± 1.1 4.7 ± 0.9 4.0 ± 0.5 4.2 ± 0.4 2.2 ± 1.1 2.1 ± 1.0 2.0 ± 0.7 1.9 ± 0.4 ↵aSpontaneous and miniature postsynaptic currents recorded from male and female MNCs under two experimental conditions: baseline and after application of RLN3 or RXFP3-A2. No significant effect of treatment, sex, or interaction of treatment and sex were observed in all of the cases analyzed (repeated-measures two-way ANOVA, p > 0.05).
Tracer injection site Retrogradely traced RLN3-ir neurons PAG dSN PnR NI Contralateral Ipsilateral Contralateral Ipsilateral Contralateral Ipsilateral Contralateral Ipsilateral PVN Males (N = 3) 3 ± 3 3 ± 3 2 ± 3 0 0 0 6 ± 8 14 ± 15 Females (N = 1) 3 9 3 0 0 0 6 12 PERI-PVN Males (N = 3) 3 ± 3 7 ± 5 2 ± 2 5 ± 5 2 ± 2 1 ± 2 40 ± 44 98 ± 76 Females (N = 7) 6 ± 4 9 ± 8 1 ± 2 4 ± 3 2 ± 2 5 ± 4 30 ± 16 76 ± 46 PERI-PVN posterior Females (N = 3) 1 ± 2 4 ± 3 1 ± 2 1 ± 2 1 ± 2 2 ± 3 9 ± 9 25 ± 18 ↵aThe numbers of rln3-ir/retrograde tracer-positive neurons in all known brain areas that synthesize RLN3 in male and female rats, with regard to the injection site. Note the substantially higher number of RLN3-ir/retrograde tracer-positive neurons ipsilaterally to the injection sites, as well as in cases where tracer injections extended beyond the PVN.
