Article Figures & Data
Figures
- Figure 1.
The Orofacial Pain Test. A, Setup for the Orofacial Pain Test. Top row, Pictures of the testing chamber and the port providing access to the sucrose solution. Bottom row, rat accessing the sipper tube, with box highlighting mechanical stimulation of the face, and then the different inserts providing incrementally more mechanical stimulation as the number of wires increases from 12 to 24. The amount of mechanical stimulation can also be modified by changing the distance between the window and the sipper tube. Drinking behavior is quantified by the number of nose pokes through the window (via infrared beam breaks) and via the number and duration of contacts with the sipper tube. Five days of training was generally sufficient to generate a consistent pattern of drinking behavior across the 10 min test period and required no additional food or water restriction. B, The cumulative contact time was comparable in male and female rats. Total contact time proved to be the most sensitive variable with which to assess the impact of mechanical stimuli and nerve injury. Data are the mean ± SEM for naive female (n = 18) and male (n = 24) rats. C, The impact of CCI of the ION on sucrose consumption was assessed with no wires creating a barrier to the 5% sucrose. Data were analyzed with a two-way ANOVA (sex × injury) but revealed no significant main effects or a significant interaction between the two. D, The impact of carbamazepine (50 mg/kg, i.p.) on sucrose consumption was assessed and analyzed as in A. No significant differences between groups were detected. E and F, To determine the impact of mechanical stimulation (number of wires in the module between the rat and the sipper tube) on drinking behavior, we assessed the impact of the number of wires on total contact time in groups of rats defined by nerve injury (naive, sham, CCI) and sex. Data were analyzed with a three-way ANOVA. Significant main effects and/or interactions are indicated above the graphs, and the results of post hoc comparisons are indicated within the graphs. Data in all panels and subsequent figures are plotted as the mean ± SEM for five or more animals per group, and points over the bars represent data for individual animals. In this and subsequent figures: *p < 0.05; **p < 0.01.
- Figure 2.
Impact of systemic carbamazepine (CBZ) on mechanical sensitivity assessed with the Orofacial Pain Test. Mechanical nociception in the orofacial region was assessed in the Orofacial Pain Test as described in Materials and Methods and Figure 1. Groups were defined by injury [naive, sham, chronic constriction injury (CCI) of the infraorbital nerve (ION)], drug administration [none, vehicle (Veh), or CBZ, where the systemic dose of CBZ in milligrams per kilogram administered intraperitoneally is indicated by the numbers], and sex (female and male). In this and subsequent figures, significant main effects and/or interactions are indicated above the plots, and the results of post hoc comparisons are indicated in the plots.
- Figure 3.
Impact of systemic carbamazepine on mechanical sensitivity assessed with the hindpaw von Frey Hair test. A and B, Mechanical nociception in the ventral surface of the hindpaw was assessed with the von Frey Hair test. Groups tested are indicated, where CCI-SN indicates CCI of the sciatic nerve. CBZ (50 mg/kg, i.p.) was administered 15 min before the start of testing, and behavior was assessed over 3 h, as indicated. Statistical analysis of these data with a three-way ANOVA revealed a significant main effect of injury, and a significant interaction between drug and time, but no effect of sex. C, To more easily visualize the influence of injury and drug on mechanical threshold assessed with von Frey hairs, data were analyzed as an AUC defined by the paw withdrawal threshold over the 3 h of testing. Furthermore, because there was no influence of sex, data from male and female rats were pooled. Analysis of these data with a two-way ANOVA revealed the main effects of injury and drug, but no significant interaction between the two. D, The impact of CBZ on gross motor function was assessed with the rotarod test. The performance score for each animal on each test day was generated from the mean of three trials. Groups of male and female rats were tested on 2 separate days (3 d apart) 15 min after receiving an injection of CBZ (50 mg/kg, i.p.) or vehicle. Drugs were given in a random order after 3 d of training on the apparatus. Data were analyzed with a two-way ANOVA, which revealed a significant influence of CBZ on motor performance (but not influence of sex or a significant interaction between sex and treatment).
- Figure 4.
Impact of systemic carbamazepine (CBZ) on ongoing pain assessed with the conditioned place preference assay. A, There was no influence of CBZ vehicle on conditioned place preference, as assessed with the time spent on paired chambers. B, However, when chambers were paired with saline (S) and CBZ (C) in sham and chronic constriction injury (CCI) animals studied 28–35 d postsurgery, there was a significant interaction among nerve, injury, and paired chamber because of a place preference in the CCI-Infraorbital nerve (ION) group but not in the CCI-sciatic nerve (SN) group.
- Figure 5.
Impact of nerve injury the potency of carbamazepine (CBZ)-induced block of action potential propagation in isolated peripheral nerves. A, Diagram of the setup used to evoke and record compound action potentials (CAPs) in isolated peripheral nerves. B, Typical example of a CAP evoked in an isolated sciatic nerve, where the more rapidly conducting A-wave (Aβ) can easily be distinguished from the more slowly conducting C-wave (C) based on the latency to arrive at the recording electrode. Insets, Typical examples of the impact of increasing the concentration of CBZ on the A-wave recorded from an infraorbital nerve (ION) obtained from animals ∼28 d after sham (SH) surgery or injury (chronic constriction injury (CCI)). C, D, Pooled concentration response data for the C-wave recorded in ION (C) and sciatic nerve (SN) (D) isolated from sham and CCI female rats. E, F, CBZ was bath applied, and the CAP was recorded until the amplitude of the waveform had stabilized. EC50 data for the A-wave (E) and C-wave (F) are plotted.
- Figure 6.
Effect of carbamazepine (CBZ) on human peripheral nerves. A, L5 ganglion recovered from an organ donor, with the spinal nerve, ganglia (DRGs), and central roots indicated. B, Top, Photograph of a trigeminal ganglia in situ, just before recovery from a cadaver enrolled in a rapid recovery program. Bottom, Trigeminal ganglia after recovery, with the central root process for recording indicated. C, Examples of CAP recorded from human trigeminal nerve (TN) (top trace) and central process of the L4 ganglia (somatic nerve (SN); bottom trace). D, Impact of increasing concentrations of CBZ on the A-wave evoked from somatic (n = 7) and TNs (n = 1). Data were analyzed and pooled as in Figure 2. E, Pooled EC50 data for the nerves plotted in D, where data for each nerve illustrate the variability in the EC50 values obtained. Of note, the A-wave from four of the five TN donors was not stable enough to obtain a full concentration–response curve, so only a single data point is plotted. F, Impact of increasing concentrations of CBZ on the C-wave evoked from SNs (n = 7) and TNs (n = 5). Data were analyzed and pooled as in Figure 2. G, Pooled EC50 data for the nerves plotted in F, where data for each nerve illustrate the variability in EC50 values obtained.
- Figure 7.
Impact of nerve injury on the potency of voltage-gated sodium channel (VGSC) blockers on action potential propagation in isolated peripheral nerves. Compound action potential recording was performed as described in Figure 5 on infraorbital nerve (ION) and sciatic nerve (SN) isolated from rats with sham or chronic constriction injury (CCI) surgery. A, B, The A-wave (A) and C-wave (B) were analyzed separately. Concentration–response data were collected for each VGSC blocker on different nerves, and the fractional block produced by a saturating concentration for each was calculated. Examples of the concentration–response data obtained with ICA-121431 on the ION from sham and CCI rats. IC50 (potency) was determined from the concentration–response curve fitted with a modified Hill equation. The average potency for each blocker tested is plotted, where data from individual nerves from females (closed symbols) and males (open symbols) are overlaid on the bar graphs. C–L, The blockers assessed included the following: ICA-121431 (NaV1.1 and 1.3; C, D); 4,9-anhydro-TTX (NaV1.6; E, F); phrixotoxin-3 (NaV1.2, NaV1.3, and NaV1.5; G, H), PF-05089771 (NaV1.7; I, and J); and A-803467 (NaV1.8; K, L). Data were analyzed with a three-way ANOVA (nerve × injury × sex). The presence of a significant interaction is indicated, as are significant differences between groups as determined with post hoc testing.
- Figure 8.
Impact of nerve injury on the relative efficacy of voltage-gated sodium channel (VGSC) blockers on action potential propagation in isolated peripheral nerves. Efficacy (maximal fractional block) was determined from the concentration–response data as described in Figure 7. A, B, To illustrate differences between the ION and the SN with respect to the response to different VGSC blockers, pooled data for each blocker on the A-wave (A) and C-wave (B) from nerves from each group of rats are plotted. Of note, dotted lines connect data from each group of rats to more clearly illustrate differences between groups with respect to the pattern of block. As noted, however, blockers were applied to different nerves and not in sequence to the same nerve. C–L, The potency data for each blocker assessed on the A-wave (left panels) and C-wave (right panels) are plotted. As with the potency data plotted in Figure 7, data were analyzed with a three-way ANOVA (nerve × injury × sex), and the presence of significant main effects and/or interactions are indicated above the graphs, while significant post hoc comparisons are indicated in the graphs.
- Figure 9.
Impact of nerve injury on NaV mRNA levels in the DRGs and TGs. mRNA levels from naive, sham, and CCI groups were first normalized levels of the housekeeping gene 18S. Relative expression, calculated as described in Materials and Methods, is plotted for each transcript. A, B, While data for TGs (A) and DRGs (B) are plotted, data were analyzed with a three-way ANOVA (sex × ganglia × nerve manipulation). There was a significant interaction between ganglia and nerve manipulation for NaV1.3, which was because of the selective injury-induced increase in NaV1.3 mRNA in DRGs.
- Figure 10.
Impact of nerve injury on levels of voltage-gated sodium channel (VGSC) subunit-like immunoreactivity in peripheral nerves. A, Raw blots of total protein extracted from the infraorbital nerve (ION) and the sciatic nerve (SN) recovered from naive rats, as well as rats subjected to sham or chronic constriction injury (CCI) probed with antibodies against VGSC subunits. Blots were stripped and reprobed with an antibody against β-tubulin (β-Tub), used as a loading control. All bands were eliminated when antibodies preabsorbed with the VGSC subunit-specific peptide (PEP; left column). B, Pooled data from male and female rats were normalized to the loading control and then to normalized values from naive animals. Data generated with each antibody was analyzed with a three-way ANOVA (nerve × injury × sex). The only significant differences between groups were for NaV1.1 and NaV1.3. For both, there was a significant nerve × injury interaction (p < 0.01). The results of post hoc comparisons are indicated.
- Figure 11.
Impact of the local administration of ICA-121431 on mechanical nociception. ICA-121431 (200 μl of 1 μm) was injected percutaneously around the infraorbital nerve (ION) or sciatic nerve (SN) the site exposed for chronic constriction injury (CCI). A, Mechanical sensitivity in the face was assessed with the Orofacial Pain Test. Pooled total contact time for male and female rats are plotted. To illustrate the impact of CCI on total contact time, baseline data for all animals was included in the first two bars of the graph. B, The impact of ICA-121431 (200 μl of 1 μm) applied to the sciatic nerve of CCI-SN rats (n = 6 male; n = 6 female rats) on von Frey hair withdrawal threshold. As with the data plotted in A, ICA-121431 and vehicle were tested on the same group of animals on separate data, with drugs administered in a random order. There was no detectable influence of ICA-121431 on the CCI-induced hypersensitivity of the hindpaw.
- Figure 12.
Impact of nerve injury on the potency of carbamazepine (CBZ)-induced block of action potential propagation in the presence of ICA-121431 in isolated nerves. Compound action potentials were recorded from isolated infraorbital nerves (IONs) recovered from sham or CCI rats as described in Figure 2. A, Data from the A-wave (left panels) and C-wave (right panels) were analyzed separately. B, ICA-121431 (ICA; 1 μm) was applied after stable recordings were obtained, and then increasing concentrations of CBZ were applied. Concentration–response curves were generated for each nerve, fitted, and pooled.
Tables
- Table 1.
PCR Primers used for semiquantitative analysis of voltage-gated Na+ channel α-subunits
Primer Access# Forward Reverse Amplicon length (bp) 18S NR_046237 AAACGGCTACCACATCCAAG TTGCCCTCCAATGGATCCT 159 NaV1.1 NM_030875 TCGGGAGATGTTGTTCCTTAC CTGTTTGCTCCATCTTGTCATC 112 NaV1.2 NM_012647 CAACTACGGCTACACAAG GCAAGGTCAGCTGATAAA 104 NaV1.3 NM_013119 CTCAAGGTCAGTGCCTATACCAGA AGCTGGTAATGGAAGCAGCAA 100 NaV1.6 NM_019266 TGGCCCATAAACTTCAACGAGA GCATTGCCCAGCATCAGAAC 150 NaV1.7 NM_133289 GCCTAATTGTGACGCTGAGTTTGA CAGTGTGGGCCAGGACTTTG 119 NaV1.8 NM_017247 GTGGTCACCATGGCGTATGAAG CTGGAGCGAGGTCGTGTCAA 147 NaV1.9 NM_019265 GTGGAGCACCACAACATGGA GTCGAGCGCGATGATCTTGA 111 18S is a housekeeping gene.
