Skip to main content

Main menu

  • HOME
  • CONTENT
    • Early Release
    • Featured
    • Current Issue
    • Issue Archive
    • Collections
    • Podcast
  • ALERTS
  • FOR AUTHORS
    • Information for Authors
    • Fees
    • Journal Clubs
    • eLetters
    • Submit
    • Special Collections
  • EDITORIAL BOARD
    • Editorial Board
    • ECR Advisory Board
    • Journal Staff
  • ABOUT
    • Overview
    • Advertise
    • For the Media
    • Rights and Permissions
    • Privacy Policy
    • Feedback
    • Accessibility
  • SUBSCRIBE

User menu

  • Log out
  • Log in
  • My Cart

Search

  • Advanced search
Journal of Neuroscience
  • Log out
  • Log in
  • My Cart
Journal of Neuroscience

Advanced Search

Submit a Manuscript
  • HOME
  • CONTENT
    • Early Release
    • Featured
    • Current Issue
    • Issue Archive
    • Collections
    • Podcast
  • ALERTS
  • FOR AUTHORS
    • Information for Authors
    • Fees
    • Journal Clubs
    • eLetters
    • Submit
    • Special Collections
  • EDITORIAL BOARD
    • Editorial Board
    • ECR Advisory Board
    • Journal Staff
  • ABOUT
    • Overview
    • Advertise
    • For the Media
    • Rights and Permissions
    • Privacy Policy
    • Feedback
    • Accessibility
  • SUBSCRIBE
PreviousNext
Research Articles, Development/Plasticity/Repair

Dysfunction of Unc119, a Transducin-Binding Protein, Leads to Cone–Rod Dystrophy through Activating JAK-Stat and NF-κB Inflammatory Pathways in the Mouse Retina

Koki Kobayashi, Taro Chaya, Hung-Ya Tu, Yamato Maeda, Yuki Nakashima, Ryotaro Tsutsumi, Haruka Yamamoto, Toshinori Tsujii, Daisuke Okuzaki and Takahisa Furukawa
Journal of Neuroscience 26 November 2025, 45 (48) e2245242025; https://doi.org/10.1523/JNEUROSCI.2245-24.2025
Koki Kobayashi
1Laboratory for Molecular and Developmental Biology, Institute for Protein Research, The University of Osaka, Osaka 565-0871, Japan
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
  • ORCID record for Koki Kobayashi
Taro Chaya
1Laboratory for Molecular and Developmental Biology, Institute for Protein Research, The University of Osaka, Osaka 565-0871, Japan
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
  • ORCID record for Taro Chaya
Hung-Ya Tu
1Laboratory for Molecular and Developmental Biology, Institute for Protein Research, The University of Osaka, Osaka 565-0871, Japan
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
Yamato Maeda
1Laboratory for Molecular and Developmental Biology, Institute for Protein Research, The University of Osaka, Osaka 565-0871, Japan
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
Yuki Nakashima
1Laboratory for Molecular and Developmental Biology, Institute for Protein Research, The University of Osaka, Osaka 565-0871, Japan
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
Ryotaro Tsutsumi
1Laboratory for Molecular and Developmental Biology, Institute for Protein Research, The University of Osaka, Osaka 565-0871, Japan
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
Haruka Yamamoto
1Laboratory for Molecular and Developmental Biology, Institute for Protein Research, The University of Osaka, Osaka 565-0871, Japan
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
Toshinori Tsujii
1Laboratory for Molecular and Developmental Biology, Institute for Protein Research, The University of Osaka, Osaka 565-0871, Japan
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
Daisuke Okuzaki
2Genome Information Research Center, Research Institute for Microbial Diseases, The University of Osaka, Osaka 565-0871, Japan
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
Takahisa Furukawa
1Laboratory for Molecular and Developmental Biology, Institute for Protein Research, The University of Osaka, Osaka 565-0871, Japan
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
  • ORCID record for Takahisa Furukawa
  • Article
  • Figures & Data
  • Info & Metrics
  • eLetters
  • Peer Review
  • PDF
Loading

Article Figures & Data

Figures

  • Tables
  • Additional Files
  • Figure 1.
    • Download figure
    • Open in new tab
    • Download powerpoint
    Figure 1.

    Generation of Unc119−/− mice. A, RT-PCR analysis of Unc119 transcripts in mouse tissues at 4 weeks. B, In situ hybridization analysis of Unc119 transcripts in developing E17.5, P3, P9, and P14 retinas. GCL, ganglion cell layer; NBL, neuroblastic layer; ONL, outer nuclear layer; INL, inner nuclear layer. C, DNA sequences of exon 1 in wild-type and Unc119 mutant mice. Seven, one, and fifty-seven base pair (bp) deletions (total 65 bp deletion) resulted in a transcriptional frameshift and premature stop codon. D, Schematic representation of the Unc119 mutant allele. E, PCR products of 195 and 260 bp were amplified from the wild-type and Unc119 mutant alleles, respectively. F, RT-PCR analysis of Unc119 transcripts in Unc119+/+ and Unc119−/− retinas. β-Actin was used as a loading control. G, Western blot analysis of Unc119 protein in Unc119+/+ and Unc119−/− mouse retinas. α-Tubluin was used as a loading control. H, Immunofluorescence analysis of Unc119 protein in Unc119+/+ and Unc119−/− mouse retinas. I, J, Subcellular localization of Gnat1 in photoreceptor cells of Unc119+/+ and Unc119−/− retinas under dark- and light-adapted conditions at 1M. The measured Gnat1 signals in the ONL of the photoreceptors are shown. Data are presented as the mean ± SD. n = 3 mice. ***p < 0.001, n.s., not significant (unpaired t test). GCL, ganglion cell layer; ONL, outer nuclear layer; INL, inner nuclear layer; OS, outer segment.

  • Figure 2.
    • Download figure
    • Open in new tab
    • Download powerpoint
    Figure 2.

    Decreased cone light responses in Unc119−/− mice at 1M. A–F, ERGs analysis of Unc119−/− mice. ERGs were recorded from Unc119+/+ and Unc119−/− mice at 1M (n = 5 per each genotype). A, Representative scotopic ERGs elicited by four stimulus intensities (−4.0 to 1.0 log cd s/m2) from Unc119+/+ and Unc119−/− mice at 1M. B, C, Scotopic amplitudes of a- (B) and b-waves (C) are shown as a function of stimulus intensity. Data are presented as the mean ± SD. n = 5 per each genotype. n.s., not significant (two-way repeated-measures ANOVA, multiple comparisons). D, Representative photopic ERGs elicited by four stimulus intensities (−0.5 to 1.0 log cd s/m2) from Unc119+/+ and Unc119−/− mice at 1M. E, F, Photopic amplitudes of a- (E) and b-waves (F) are shown as a function of the stimulus intensity. Data are presented as the mean ± SD. n = 5 per each genotype. *p < 0.05, ***p < 0.001, n.s., not significant (two-way repeated-measures ANOVA, multiple comparison). G, H, Scotopic and photopic b-wave implicit times of ERGs were recorded from Unc119+/+ and Unc119−/− mice at 1M. The scotopic implicit times of the b-wave (G) reflect synaptic transmission from rod photoreceptors to rod bipolar rod cells. The photopic implicit times of the b-wave (H) reflect synaptic transmission from the cone photoreceptor to the cone ON bipolar cells. Data are presented as mean ± SD. n = 5 per each genotype. n.s., not significant (two-way repeated-measures ANOVA, multiple comparison). I, Toluidine blue staining of Unc119+/+ and Unc119−/− retinas at 1M. The thicknesses of the ONL, OPL, INL, IPL, and GCL were measured using ImageJ. Data are presented as the mean ± SD. n = 4 per each genotype. n.s., not significant (unpaired t test). GCL, ganglion cell layer; ONL, outer nuclear layer; INL, inner nuclear layer; IPL, inner plexiform layer. J–R, Immunofluorescence analysis of retinal sections from Unc119+/+ and Unc119−/− at 1M using marker antibodies as follows: Rhodopsin (rod outer segments, J), M-opsin (M-cone outer segments, K), S-opsin (S-cone outer segments, L), Chx10 (bipolar cells, M), Pax6 (amacrine and ganglion cells, N), Calbindin (horizontal cells and a subset of amacrine cells, O), Ctbp2 (photoreceptor synapses, P), Rbpms (ganglion cells, Q), and S100β (Müller glial cells, R). The nuclei were stained with DAPI (blue). Rhodopsin length was measured in four images from the retina of one mouse. In one image, Rhodopsin length was measured at three points and averaged (J). The signal intensity of M-opsin and S-opsin in OPL were measured. Arrowheads indicate mislocalization of M-opsin and S-opsin signals (K, L). Data are presented as the mean ± SD. n = 3 per each genotype. n.s., not significant (unpaired t test). GCL, ganglion cell layer; ONL, outer nuclear layer; INL, inner nuclear layer; OS, outer segment.

  • Figure 3.
    • Download figure
    • Open in new tab
    • Download powerpoint
    Figure 3.

    Decrease in cone and rod light responses of Unc119−/− mice at 12M. A–F, ERG analysis of Unc119−/− mice at 12M. ERGs were recorded from Unc119+/+ and Unc119−/− mice at 12M (n = 5 and 4 mice, Unc119+/+ and Unc119−/−, respectively). A, Representative scotopic ERGs elicited by four stimulus intensities (−4.0 to 1.0 log cd s/m2) from Unc119+/+ and Unc119−/− mice at 12M. B, C, The scotopic amplitudes of a- (B) and b-waves (C) are shown as a function of the stimulus intensity. Data are presented as the mean ± SD. n = 5 and 4 mice (Unc119+/+ and Unc119−/− mice, respectively). **p < 0.01, ***p < 0.001, n.s., not significant (two-way repeated-measures ANOVA, multiple comparison). D, Representative photopic ERGs elicited by four stimulus intensities (−0.5 to 1.0 log cd s/m2) from Unc119+/+ and Unc119−/− mice at 12M. E, F, The photopic amplitudes of a- (E) and b-waves (F) are shown as a function of the stimulus intensity. Data are presented as mean ± SD. n = 5 and 4 mice (Unc119+/+ and Unc119−/−, respectively). *p < 0.05, **p < 0.01, n.s., not significant (two-way repeated-measures ANOVA, multiple comparison). G, H, Scotopic (G) and photopic (H) b-wave implicit times of ERGs were recorded from Unc119+/+ and Unc119−/− mice at 12M. Data are presented as the mean ± SD. n = 5 and n = 4 mice, Unc119+/+ and Unc119−/−, respectively. n.s., not significant (two-way repeated-measures ANOVA, multiple comparisons). I, Toluidine blue staining of Unc119+/+ and Unc119−/− retinas at 12M. The thicknesses of the ONL, OPL, INL, IPL, and GCL were measured using ImageJ. Data are presented as the mean ± SD. n = 3 and 4 (Unc119+/+ and Unc119−/−, respectively). *p < 0.05, ***p < 0.01, ****p < 0.001, n.s., not significant [unpaired t test (top bar graph) and one-way ANOVA, multiple comparisons (bottom bar graph)]. GCL, ganglion cell layer; ONL, outer nuclear layer; INL, inner nuclear layer; IPL, inner plexiform layer; OS, outer segment. J–M, Immunofluorescence analysis of retinal sections from Unc119+/+ and Unc119−/− at 12M using marker antibodies as follows: Rhodopsin (rod outer segments, J), M-opsin (M-cone outer segments, K), S-opsin (S-cone outer segments, L), and Arr3 (cone photoreceptor cells, M). Nuclei were stained with DAPI (blue). Rhodopsin length was measured in four images from the retina of one mouse. In one image, Rhodopsin length was measured at three points and averaged (J). The number of M-opsin-, S-opsin-, and Arr3-positive cells was counted (K, L, M). Data are presented as mean ± SD. n = 3 and 4 (Unc119+/+ and Unc119−/−, respectively). *p < 0.05, **p < 0.01, ***p < 0.001 (unpaired t test). GCL, ganglion cell layer; ONL, outer nuclear layer; INL, inner nuclear layer; OS, outer segment.

  • Figure 4.
    • Download figure
    • Open in new tab
    • Download powerpoint
    Figure 4.

    Unc119 interacts with Gnat2 in cones. A, Generation of Nrl−/− mice and Western blotting analysis of Nrl+/+ and Nrl−/− mouse retinas using the following antibodies: Rhodopsin, S-opsin, and M-opsin. α-Tubulin was used as a loading control. B, Scheme of pull-down assay and LC-MS/MS analysis. A pull-down assay was performed using GST and GST-fused Unc119 proteins. GST- and GST-fused Unc119 proteins were reacted with Nrl−/− retinal lysates or lysis buffer. Venn diagram of the number of identified proteins in the indicated experimental conditions by pull-down assay and subsequent LC-MS/MS analysis (left). C, Fifty-eight proteins were identified using total LC-MS/MS analysis. Four proteins, Gnat2, Ytdc2, Tba1a, and Hmmr, were detected only in GST-fused mUnc119 that reacted with Nrl−/− retinal lysates. The normalized total spectra of Gnat2 are shown. D, Immunoprecipitation of Unc119 with Gnat1 or Gnat2. Plasmids expressing FLAG-tagged Gnat1 or Gnat2, and HA-tagged Unc119 were cotransfected into HEK293T cells. Cell lysates were subjected to immunoprecipitation using an anti-FLAG antibody. The immunoprecipitated proteins were detected by Western blot analysis using anti-FLAG and anti-HA antibodies. E, F, Immunofluorescence analysis of Unc119+/+ and Unc119−/− retinas at 1M (D) and P14 (E), using an anti-Gnat2 antibody. Nuclei were stained with DAPI (blue). Gnat2 intensity was measured in the retinal sections of all photoreceptor layers (OS, IS, ONL, and OPL) using ImageJ software. Data are presented as the mean ± SD. n = 5 per each genotype at 1M and n = 3 per each genotype at P14. ***p < 0.001 (unpaired t test). GCL, ganglion cell layer; ONL, outer nuclear layer; INL, inner nuclear layer; OS, outer segment. G, Western blotting analysis of Gnat2 protein in retinas from Unc119+/+ and Unc119−/− mice at P14 using an anti-Gnat2 antibody. α-Tubulin was used as a loading control. Relative Gnat2 protein levels in Unc119+/+ and Unc119−/− retinas were determined by quantification of Gnat2 band intensity (normalized to α-tubulin). Data are presented as the mean ± SD. n.s., not significant (unpaired t test); n = 5 mice per genotype. H, I, Immunoprecipitation analysis of Unc119 and Gnat1, Gnat1-G2A, Gnat2, or Gnat2-G2A. Plasmids expressing FLAG-tagged Gnat1, Gnat1-G2A, Gnat2, or Gnat2-G2A, and HA-tagged Unc119 were cotransfected into HEK293T cells. Cell lysates were subjected to immunoprecipitation with an anti-FLAG antibody. Immunoprecipitated proteins were detected by Western blot analysis with anti-FLAG (H) and anti-HA (I) antibodies.

  • Figure 5.
    • Download figure
    • Open in new tab
    • Download powerpoint
    Figure 5.

    Transcriptional changes by Unc119 deficiency in the retina. A, Heatmaps of differentially expressed genes (fold change >1.4, less than −1.4; p < 0.05, unpaired t test) between Unc119+/+ and Unc119−/− retinas. Normalized FPKM from the RNA-seq dataset was used for heatmap visualization. B, C, Immunofluorescence analysis of Unc119+/+ and Unc119−/− retinas at 1M using antibodies against GFAP and C1q. Nuclei were stained with DAPI (blue). The intensities of GFAP (B) and C1q (C) signals in Unc119+/+ and Unc119−/− retinas at 1M were measured. Data are presented as the mean ± SD. ∗∗p < 0.01 (unpaired t test). n = 3 mice per group. GCL, ganglion cell layer; ONL, outer nuclear layer; INL, inner nuclear layer. D, qRT-PCR analysis of Nxnl2 and Nxnl1 mRNA expression levels in the Unc119+/+ and Unc119−/− mouse retinas. Data are presented as the mean ± SD. ∗p < 0.05, ∗∗p < 0.01 (unpaired t test). n = 3 mice per group. E, Gene set enrichment analysis of upregulated genes in the Unc119−/− mouse retina. F, Ingenuity Pathway Analysis (IPA) to predict the upstream factors affecting gene expression changes (fold change >1.4, less than −1.4; p < 0.05, unpaired t test) in the Unc119−/− retina. The predicted upstream factors with an activation Z score >3.0 are shown. G, H, IPA networks showing interferon regulatory factor 1 (IRF1; G) and RELA proto-Oncogene (H), NF-kB subunit (RELA) as upstream regulators. IRF1 and RELA were predicted to be activated in the Unc119−/− mouse retina.

  • Figure 6.
    • Download figure
    • Open in new tab
    • Download powerpoint
    Figure 6.

    Curcumin suppresses cone degeneration and inflammation in the Unc119−/− retina. A, Experimental design for curcumin administration to Unc119−/− mice. B–G, ERG analysis of curcumin-treated Unc119−/− mice at 1M. ERGs were recorded from control (DMSO) and curcumin-treated Unc119−/− mice at 1M (n = 4 per each genotype). B, Representative scotopic ERGs elicited by four stimulus intensities (−4.0 to 1.0 log cd s/m2) from control (DMSO) and curcumin-treated Unc119−/− mice at 1M. C, D, The scotopic amplitudes of a- (C) and b-waves (D) are shown as a function of the stimulus intensity. Data are presented as the mean ± SD. n = 4 per each genotype. n.s., not significant (two-way repeated-measures ANOVA, multiple comparisons). E, Representative photopic ERGs elicited by four stimulus intensities (−0.5 to 1.0 log cd s/m2) from control (DMSO) and curcumin-treated Unc119−/− mice at 1M. F, G, Photopic amplitudes of a- (F) and b-waves (G) are shown as functions of stimulus intensity. Data are presented as the mean ± SD. n = 4 mice per each genotype. *p < 0.05, n.s., not significant (two-way repeated-measures ANOVA, multiple comparison). H–M, Immunofluorescence analysis of retinal sections from control and curcumin-injected Unc119−/− mice was performed using antibodies against Socs3 (H), RelA (I), GFAP (J), C1q (K), M-opsin (L), and S-opsin (M). Nuclei were stained with DAPI (blue). The intensities of the Socs3, RelA, GFAP, and C1q signals in the retina were measured (H–K). The number of M-opsin- and S-opsin-positive cells was counted. The signal intensities of M-opsin and S-opsin in the OPL were measured. Arrowheads indicate mislocalization of M-opsin and S-opsin signals (L, M). Data are presented as mean ± SD. n = 4 per each genotype. *p < 0.05, **p < 0.01, ***p < 0.001, n.s., not significant (unpaired t test). GCL, ganglion cell layer; ONL, outer nuclear layer; INL, inner nuclear layer; OS, outer segment.

  • Figure 7.
    • Download figure
    • Open in new tab
    • Download powerpoint
    Figure 7.

    Inhibition of UNC119 interaction with GNAT1 or GNAT2 by UNC119-K57X. A, Immunoprecipitation analysis of human UNC119 (hUNC119) with hGNAT1 or hGNAT2. Plasmids expressing FLAG-tagged hGNAT1 or hGNAT2 and HA-tagged hUNC119 were cotransfected into HEK293T cells. The cell lysates were subjected to immunoprecipitation with the anti-FLAG antibody. Immunoprecipitated proteins were detected by Western blot analysis with anti-FLAG and anti-HA antibodies. B, C, Myc-tagged hUNC119-K57X, in addition to the expression constructs used in A, were cotransfected into HEK293T cells. The cell lysates were subjected to immunoprecipitation with the anti-FLAG antibody. Immunoprecipitated proteins were detected by Western blot analysis with anti-FLAG and anti-HA antibodies. Relative intensities were determined by quantification of IP: HA band intensities (normalized to Input: HA) using ImageJ software. D, A hypothetical model of CRD caused by compromised Unc119 function.

Tables

  • Figures
  • Additional Files
    • View popup
    Table 1.

    Primer sequence

    Primer nameSequence (5′→3′)
    mUnc119-RT-PCR-51TCCTTTTTGAAATCAAGAAGCCCCCTG
    mUnc119-RT-PCR-31TTTCGAAAGTAGTGCCTCTCGATCATG
    mUnc119-RT-PCR-52GAGGGCAAGCAGCCCATCGGGCCGGAG
    mUnc119-RT-PCR-32GGTCCAGGTCCCGCCGGTTGATGGGCA
    mGnat1-kozak-ORF-EcoRI-51GAATTCGCCACCATGGGGGCTGGGGCCAGCGCTGAGGAG
    mGnat1-ORF-NotI-31GCGGCCGCAGAAGAGCCCGCAGTCTTTGAGGTTCTC
    mGnat2-ORF-kozak-XhoI-51TCTCGAGCCACCATGGGGAGTGGCATCAGTGCTGAGGAC
    mGnat2-ORF-wostop-NotI-31TGCGGCCGCAAAAGAGCCCACAGTCCTTGAGGTTTTC
    mGnat1-kozak-ORF-G2A-EcoRI-51GAATTCGCCACCATGGCCGCTGGGGCCAGCGCTGAGGAG
    mGnat2-ORF-kozak-G2A-XhoI-51TCTCGAGCCACCATGGCCAGTGGCATCAGTGCTGAGGAC
    mNxnl2-qPCR-51GACTTCTACACGGAGCTGGTGAGCGAG
    mNxnl2-qPCR-31TTGGGGATGGCGGTGATTTCGTACCTC
    mNxnl1-qPCR-51ACTGACCAGTTCTACGTGCTGCGGGCA
    mNxnl1-qPCR-31ACAACCGCTGGCAGTTGACGGACAGAG
    hGNAT1-ORF-kozak-SalI-51GGGGTCGACGCCACCATGGGGGCTGGGGCCAGTGCTG
    hGNAT1-ORF-NotI-31GGGGCGGCCGCAGAAGAGGCCACAGTCTTTGAGGTTC
    hGNAT2-ORF-kozak-XhoI-51GGGCTCGAGCCACCATGGGAAGTGGAGCCAGTGCTGAGGACA
    hGNAT2-ORF-NotI-31GGGGCGGCCGCAGAAGAGGCCGCAGTCCTTGAGGTTTTC
    hUNC119-ORF-XhoI-53GGGCTCGAGATGAAGGTGAAGAAGGGCGGCGGT
    hUNC119-ORF-NotI-34GGGGCGGCCGCTCAGGGTGTCCCGCTGTAGGA
    hUNC119-K57X-NotI-31GGGGCGGCCGCCTACCTCTGCAGCGGCCCCGGCCTG
    gRNASequence (5′→3′)
    mUnc119-gRNA1AGGGGCCTCGAACCGGAGCGCGG
    mUnc119-gRNA2AGCACATCCTCCGGCCCGATGGG
    mNrl-gRNAGCTGAGTCCCGACGAAGCTGTGG

Additional Files

  • Figures
  • Tables
  • Supplemental Material

    • JN-RM-2245-24-suppl.pdf
Back to top

In this issue

The Journal of Neuroscience: 45 (48)
Journal of Neuroscience
Vol. 45, Issue 48
26 Nov 2025
  • Table of Contents
  • About the Cover
  • Index by author
  • Masthead (PDF)
Email

Thank you for sharing this Journal of Neuroscience article.

NOTE: We request your email address only to inform the recipient that it was you who recommended this article, and that it is not junk mail. We do not retain these email addresses.

Enter multiple addresses on separate lines or separate them with commas.
Dysfunction of Unc119, a Transducin-Binding Protein, Leads to Cone–Rod Dystrophy through Activating JAK-Stat and NF-κB Inflammatory Pathways in the Mouse Retina
(Your Name) has forwarded a page to you from Journal of Neuroscience
(Your Name) thought you would be interested in this article in Journal of Neuroscience.
CAPTCHA
This question is for testing whether or not you are a human visitor and to prevent automated spam submissions.
Print
View Full Page PDF
Citation Tools
Dysfunction of Unc119, a Transducin-Binding Protein, Leads to Cone–Rod Dystrophy through Activating JAK-Stat and NF-κB Inflammatory Pathways in the Mouse Retina
Koki Kobayashi, Taro Chaya, Hung-Ya Tu, Yamato Maeda, Yuki Nakashima, Ryotaro Tsutsumi, Haruka Yamamoto, Toshinori Tsujii, Daisuke Okuzaki, Takahisa Furukawa
Journal of Neuroscience 26 November 2025, 45 (48) e2245242025; DOI: 10.1523/JNEUROSCI.2245-24.2025

Citation Manager Formats

  • BibTeX
  • Bookends
  • EasyBib
  • EndNote (tagged)
  • EndNote 8 (xml)
  • Medlars
  • Mendeley
  • Papers
  • RefWorks Tagged
  • Ref Manager
  • RIS
  • Zotero
Respond to this article
Request Permissions
Share
Dysfunction of Unc119, a Transducin-Binding Protein, Leads to Cone–Rod Dystrophy through Activating JAK-Stat and NF-κB Inflammatory Pathways in the Mouse Retina
Koki Kobayashi, Taro Chaya, Hung-Ya Tu, Yamato Maeda, Yuki Nakashima, Ryotaro Tsutsumi, Haruka Yamamoto, Toshinori Tsujii, Daisuke Okuzaki, Takahisa Furukawa
Journal of Neuroscience 26 November 2025, 45 (48) e2245242025; DOI: 10.1523/JNEUROSCI.2245-24.2025
Twitter logo Facebook logo Mendeley logo
  • Tweet Widget
  • Facebook Like
  • Google Plus One

Jump to section

  • Article
    • Abstract
    • Significance Statement
    • Introduction
    • Materials and Methods
    • Results
    • Discussion
    • Footnotes
    • References
  • Figures & Data
  • Info & Metrics
  • eLetters
  • Peer Review
  • PDF

Responses to this article

Respond to this article

Jump to comment:

No eLetters have been published for this article.

Related Articles

Cited By...

More in this TOC Section

Research Articles

  • Caudal Granular Insular Cortex to Somatosensory Cortex I: A critical pathway for the transition of acute to chronic pain
  • Recovery of retinal terminal fields after traumatic brain injury: evidence of collateral sprouting and sexual dimorphism
  • Local neuronal ensembles that co-reactivate across regions during sleep are preferentially stabilized
Show more Research Articles

Development/Plasticity/Repair

  • Recovery of retinal terminal fields after traumatic brain injury: evidence of collateral sprouting and sexual dimorphism
  • Reduced Post-Activation Depression in Humans with Spinal Cord Injury is not related to Stretch Reflex Hyperexcitability
Show more Development/Plasticity/Repair
  • Home
  • Alerts
  • Follow SFN on BlueSky
  • Visit Society for Neuroscience on Facebook
  • Follow Society for Neuroscience on Twitter
  • Follow Society for Neuroscience on LinkedIn
  • Visit Society for Neuroscience on Youtube
  • Follow our RSS feeds

Content

  • Early Release
  • Current Issue
  • Issue Archive
  • Collections

Information

  • For Authors
  • For Advertisers
  • For the Media
  • For Subscribers

About

  • About the Journal
  • Editorial Board
  • Privacy Notice
  • Contact
  • Accessibility
(JNeurosci logo)
(SfN logo)

Copyright © 2025 by the Society for Neuroscience.
JNeurosci Online ISSN: 1529-2401

The ideas and opinions expressed in JNeurosci do not necessarily reflect those of SfN or the JNeurosci Editorial Board. Publication of an advertisement or other product mention in JNeurosci should not be construed as an endorsement of the manufacturer’s claims. SfN does not assume any responsibility for any injury and/or damage to persons or property arising from or related to any use of any material contained in JNeurosci.