Abstract
Amyloid precursor protein (APP) was originally identified as the source of β-amyloid peptides that accumulate in Alzheimer's disease (AD), but it also has been implicated in the control of multiple aspects of neuronal motility. APP belongs to an evolutionarily conserved family of transmembrane proteins that can interact with a variety of adapter and signaling molecules. Recently, we showed that both APP and its insect ortholog [APPL (APP-Like)] directly bind the heterotrimeric G-protein Goα, supporting the model that APP can function as an unconventional Goα-coupled receptor. We also adapted a well characterized assay of neuronal migration in the hawkmoth, Manduca sexta, to show that APPL–Goα signaling restricts ectopic growth within the developing nervous system, analogous to the role postulated for APP family proteins in controlling migration within the mammalian cortex. Using this assay, we have now identified Manduca Contactin (MsContactin) as an endogenous ligand for APPL, consistent with previous work showing that Contactins interact with APP family proteins in other systems. Using antisense-based knockdown protocols and fusion proteins targeting both proteins, we have shown that MsContactin is selectively expressed by glial cells that ensheath the migratory neurons (expressing APPL), and that MsContactin–APPL interactions normally prevent inappropriate migration and outgrowth. These results provide new evidence that Contactins can function as authentic ligands for APP family proteins that regulate APP-dependent responses in the developing nervous system. They also support the model that misregulated Contactin–APP interactions might provoke aberrant activation of Goα and its effectors, thereby contributing to the neurodegenerative sequelae that typify AD.
SIGNIFICANCE STATEMENT Members of the amyloid precursor protein (APP) family participate in many aspects of neuronal development, but the ligands that normally activate APP signaling have remained controversial. This research provides new evidence that members of the Contactin family function as authentic ligands for APP and its orthologs, and that this evolutionarily conserved class of membrane-attached proteins regulates key aspects of APP-dependent migration and outgrowth in the embryonic nervous system. By defining the normal role of Contactin–APP signaling during development, these studies also provide the framework for investigating how the misregulation of Contactin–APP interactions might contribute to neuronal dysfunction in the context of both normal aging and neurodegenerative conditions, including Alzheimer's disease.
- Alzheimer's disease
- embryo culture
- G-protein
- model system
- neuronal guidance
- neuronal–glial signaling
Introduction
A hallmark feature of Alzheimer's disease (AD) is the accumulation of β-amyloid (Aβ) peptides that are cleaved from the amyloid precursor protein (APP) and have neurotoxic effects in model systems, providing the basis for the “amyloid hypothesis” of AD. In addition, growing evidence suggests that aberrant APP-dependent signaling may also provoke neuronal dysfunction (Dawkins and Small, 2014; van der Kant and Goldstein, 2015). However, elucidating authentic roles for APP in the mammalian brain has been complicated by its overlapping expression with two related APP-like proteins (APLP1 and APLP2) that interact both in cis and trans (Heber et al., 2000; Herms et al., 2004; Soba et al., 2005), and by the discovery that different isoforms of APP are expressed by glial and endothelial cells as well as neurons (Forloni et al., 1992). In addition, the identities of authentic APP ligands are still controversial (Deyts et al., 2016).
As an alternative model for investigating neuronal-specific functions of APP family proteins, we have used the enteric nervous system (ENS) of the hawkmoth, Manduca sexta. During ENS development, ∼300 enteric plexus neurons (EP cells) become distributed across the gut musculature via a stereotyped sequence of migration and outgrowth along eight preformed pathways (Copenhaver, 2007). Notably, the migratory EP cells robustly express APPL (APP-Like, the sole insect ortholog of APP), whereby APPL colocalizes with the heterotrimeric G-protein Goα in their leading processes (Swanson et al., 2005; Ramaker et al., 2013). In previous work, we demonstrated that APPL and Goα directly interact both in vitro and in vivo, and we used embryo culture assays to show that APPL–Goα signaling prevents ectopic migration within the developing ENS (Ramaker et al., 2013). These studies support the model that APP family proteins function as unconventional Goα-coupled receptors that regulate neuronal motility in a context-dependent manner (Okamoto et al., 1995; Brouillet et al., 1999). However, the ligands that normally activate APPL–Goα signaling responses remained undefined.
Although numerous proteins may bind APP (Ho and Südhof, 2004; Hoe et al., 2009; Lourenço et al., 2009; Rice et al., 2012), members of the Contactin family have been shown to interact with APP and its orthologs in both cultured neurons and the developing brain (Ma et al., 2008; Osterfield et al., 2008; Osterhout et al., 2015). Contactins are members of the Ig superfamily of cell adhesion molecules, typified by six Ig domains, four fibronectin type-III (FN-III) repeats, and a C-terminal glycosylphosphatidylinositol (GPI) lipid anchor (Shimoda and Watanabe, 2009). Mammals express six Contactins that have been ascribed a variety of roles, based in part on their developmental expression patterns (Hosoya et al., 1995; Yoshihara et al., 1995; Mohebiany et al., 2014). Different combinations of Contactins and APP family proteins have also been implicated in multiple aspects of neurogenesis and neuronal guidance (Ma et al., 2008; Osterfield et al., 2008; Mohebiany et al., 2014; Osterhout et al., 2015). However, because these proteins can interact promiscuously both in cis and trans, determining how a particular Contactin regulates APP-dependent responses has proven unexpectedly challenging. In contrast to mammalian systems, invertebrates express a single Contactin ortholog (Faivre-Sarrailh et al., 2004; Katidou et al., 2013; Ganot et al., 2015). Notably, Contactin expression in insects is confined to glial cells and epithelial cells (Faivre-Sarrailh et al., 2004; Banerjee et al., 2006), whereas APPL is expressed only by neurons (Luo et al., 1992; Swanson et al., 2005). We have now shown that Manduca Contactin (MsContactin) is selectively expressed by glial cells that ensheath the migratory EP cells (expressing APPL), and that both MsContactin and APPL are required to prevent ectopic migration and outgrowth. In addition, we have shown that soluble MsContactin fusion proteins bind APPL on the EP cells and inhibit their migration in an APPL-dependent and Goα-dependent manner. These results provide new evidence that Contactins function as authentic ligands for APP family proteins in vivo, whereby Contactin–APP/L interactions regulate key aspects of neuronal guidance in the developing nervous system.
Materials and Methods
MsContactin and APPL fusion proteins.
To generate MsContactin–Fc (MsCont–Fc) fusion constructs, we isolated a PCR fragment encoding the four FN-III-like domains of MsContactin from embryonic cDNA, using primers 5′-CTTCTCACACACAACTGCGGATTG-3′ and 5′-ATTGTAATGCGATAAGTGACC-3′. This transcript was then subcloned into pcDNA3, in-frame with the signal sequence for MsContactin (at the 5′ end) and the sequence encoding human Fc (at the 3′ end). The resulting plasmid was transiently transfected into 293T cells using Trans-IT LT1 Transfection Reagent (Mirus Bio LLC, catalog #MIR 2300). Culture media from cells expressing secreted MsCont–Fc was collected after 1 week, purified with protein A Sepharose (GE Healthcare, #17-0780-01), and subsequently dialyzed into defined saline (140 mm NaCl, 5 mm KCl, 28 mm glucose, 4 mm CaCl2, plus 5 mm HEPES, pH 7.4). To generate alkaline phosphatase (AP)-tagged fusion constructs of Manduca APPL (sAPPL–AP), a PCR fragment that spanned the coding region containing the E1 and E2 domains (amino acids 1-508) of Manduca APPL was amplified from a pGEM-T construct encoding full-length APPL (Swanson et al., 2005), using primers 5′-GCCGCAAACATGACGCGCGCCGTG-3′ (which includes the signal sequence for APPL) and 5′-TCCATGCAATCCAAGGATGACATG-3′. This fragment was then subcloned into the pAPtag-2 expression vector (Genhunter, #QV2), in-frame with the sequence encoding a C-terminal AP tag (encoding human placental AP). The resulting plasmid was transfected into 293T cells, as described above. After 48 h, media containing the secreted sAPPL–AP protein was harvested from the cultures, aliquoted, and frozen for subsequent use. Concentrations were monitored in SDS-PAGE gels by comparing serial dilutions of the sAPPL–AP medium with known concentrations of commercial AP (Genhunter, #Q505).
Animals and immunohistochemistry.
For immunofluorescence histochemistry, synchronous groups of embryos of either sex were collected from an in-house colony of M. sexta and staged according to published developmental markers (Copenhaver and Taghert, 1989b, 1990). When reared at 25°C, embryogenesis is complete in 100 h, whereby 1% of development is equivalent to 1 h postfertilization (hpf). Embryos were collected at stages spanning the periods of EP cell migration, axon outgrowth, and terminal differentiation (50–90 hpf); removed from their egg shells (chorions) and extraembryonic membranes in defined saline; and then dissected dorsally in Sylgard-coated chambers to expose the ENS, as previously described (Coate et al., 2007; Ramaker et al., 2013). The dissected embryos were then fixed with 4% paraformaldehyde (PFA) in PBS for 1 h at room temperature, then rinsed with PBS plus 0.1% Triton X-100 (PBST), unless otherwise noted. Embryos were incubated in blocking solution (PBST + 10% heat-inactivated normal horse serum and 0.01% sodium azide) for 1 h before application of the following primary antibodies: mouse anti-pan Manduca fasciclin II (Fas II: C3 monoclonal; which recognizes all Fas II isoforms; 1:20,000; Wright et al., 1999); guinea pig anti-Manduca Fas II (GPI-linked isoform; GPI-Fas II; 1:500–1:4000; Wright and Copenhaver, 2001); chicken anti-cAPPL (1:2500; Swanson et al., 2005); rabbit anti-nAPPL (1:5000; #21506; Ramaker et al., 2013); guinea pig anti-Drosophila REPO (Reversed polarity; 1:300; Banerjee et al., 2006); guinea pig anti-Drosophila Contactin (1:300 Faivre-Sarrailh et al., 2004), and rat anti-Drosophila ELAV (Embryonic lethal, abnormal vision; 1:500; Robinow and White, 1991). With the assistance of Yao-Hong Biotechnology, we also generated an affinity-purified polyclonal antibody against MsContactin (rabbit anti-MsContactin), using a peptide epitope corresponding to amino acids 1156–1171 (ESERFLERTFRKAPQK; conjugated to KLH). This antibody was used at 1:200 for Western blots and 1:50 for immunohistochemistry. Its specificity was confirmed by labeling Western blots of MsCont–Fc fusion proteins (vs control fusion proteins), by preabsorption of the antibody against its peptide epitope (vs control peptides), and by knocking down MsContactin expression in GV1 cells (described below).
Primary antibodies were detected with secondary antibodies conjugated to Alexa Fluor-488, Alexa Fluor-555, or Alexa Fluor-647 (Invitrogen/Life Technologies) that were diluted 1:1000 in blocking solution, or with secondary antibodies conjugated to Dylight 549 (Jackson ImmunoResearch), diluted 1:800. Immunostained embryos were mounted in Elvanol (Banker and Goslin, 1998) and imaged with an Olympus FluoView 300 laser scanning confocal head, mounted on an Olympus BX51 microscope (located in the Live Cell Imaging Facility, Oregon Institute of Occupational Health Sciences, Oregon Health & Science University). Z-stack projections of the confocal images were flattened in Fiji (Schindelin et al., 2012), using either maximum or average intensity projections. Images were adjusted for contrast and brightness and assembled into montages using Adobe Photoshop.
Immunoblotting and coimmunoprecipitation .
To prepare Manduca lysates for immunoblotting assays, staged groups of embryos were removed from their eggshells and extraembryonic membranes and collected on dry ice. To prepare Drosophila lysates, the heads of adult wild-type flies were removed on dry ice and then stored at −80°C. Tissue samples were then solubilized in chilled NP-40 lysis buffer (1% NP-40, 150 mm NaCl, 50 mm Tris, pH 8, plus phosphatase and protease inhibitors) or Triton-X lysis buffer (1% Triton X-100, 150 mm NaCl, 50 mm Tris, pH 8), clarified by centrifugation (10 min at 13,000 rpm), and used immediately or stored at −20°C until use. Manduca GV1 cells were cultured for 48 h in 24-well culture dishes in GV1 cell medium, consisting of 3.32 g of lactalbumin hydrolysate and 20 ml of 50× yeastolate per liter of Grace's insect medium (Thermo Fisher Scientific), plus 10% heat inactivated fetal bovine serum and 1% penicillin–streptomycin–neomycin, pH 6.5. Lysates of GV1 cells were prepared by adding NP-40 lysis buffer directly to the wells, after which the lysates were transferred to microfuge tubes, clarified by centrifugation, and used immediately or stored at −20°C until use.
For coimmunoprecipitation experiments targeting MsContactin, Manduca embryos (65–70 hpf, 20 per condition) were isolated on dry ice, homogenized in NP40 lysis buffer or Triton-X lysis buffer, and the clarified supernatants were precleared with protein A/G beads (Santa Cruz Biotechnology, #sc-2003). After a brief centrifugation to remove the beads (3000 rpm for 15 s), the supernatants were incubated with rabbit anti-MsContactin antibodies (25 μg/ml) for 3 h at room temperature or overnight at 4°C; a similar concentration of purified IgG (Jackson Laboratories, #1-000-003) was used as a negative control. For coimmunoprecipitation experiments targeting APPL, supernatants were incubated with chick anti-cAPPL antibodies (0.05 μg/ml); a similar concentration of purified IgY (Aves Labs, #N-1010) was used as a negative control. Immune complexes were immunoprecipitated with PrecipHen beads (agarose-coupled goat anti-chicken; Aves Labs, #P-1010). After antibody incubation, prewashed beads were applied to the supernatants for 1 h, followed by brief centrifugation. The beads were then resuspended and boiled for 1 min in SDS sample buffer (1% SDS, 10% glycerol, 50 mm Tris, pH 6.7, 2.5% β-mercaptoethanol) to elute bound proteins. Eluted proteins were then separated on either 10% or 4–12% BT-Criterion XT polyacrylamide gels (Bio-Rad), and the proteins transferred to PVDF or nitrocellulose membranes.
For immunoblotting (Western blotting), the following antibodies were diluted in TBST blocking buffer [Tris-buffered saline plus 0.1% polysorbate 20 (Tween) and 5% Carnation dry milk], chick anti-cAPPL (1:2500; Swanson et al., 2005), rabbit anti-MsContactin (1:1000–1:2000), guinea pig anti-Goα (1:100–1:250; Horgan et al., 1995), and mouse anti-pan Fas II (C3; 1:1000). After rinsing the blots in TBST, secondary antibodies coupled to horseradish peroxidase (HRP; Jackson ImmunoResearch; 1:10,000) were applied in TBST blocking buffer, and bound antibody complexes were detected using standard chemiluminescent protocols with either SuperSignal West Pico or West Femto substrates (Thermo Fisher Scientific).
Whole-mount in situ hybridization histochemistry.
To generate antisense riboprobes for in situ hybridization histochemistry, double-stranded plasmid DNAs encoding Manduca GPI-Fas II and APPL were used as templates, as previously described (Wright et al., 1999; Swanson et al., 2005). In addition, the entire coding domain of MsContactin was subcloned into pGEM-T, using Gibson Assembly Cloning kits (New England Biolabs, #ES510S). Plasmids were linearized and purified by gel extraction, and antisense probes were generated using T7 or SP6 RNA polymerase (New England Biolabs, #M0207S and #M02515), plus dithiothreitol, digoxigenin-11-UTP (DIG) labeling mix (Roche, #11277073910), transcription buffer, and RNase inhibitors (Patel and Goodman, 1992; Wright et al., 1999). After precipitation (with 150 mm LiCl, 25 mm NaAc, 100 μg/ml tRNA, and 75% ETOH in double-distilled H2O), the probes were resuspended in hybridization buffer (50% formamide, 5× SSC, 0.1% Tween, 50 μg/ml heparin, and 100 μg/ml tRNA in double-distilled H2O) and stored at −80°C until use. Embryos at stages between 55 and 75 hpf were dissected to expose the ENS and fixed for 1 h in 4% PFA (electron microscopy grade; Electron Microscopy Sciences, #15710) plus 0.6% Triton X-100 in PBS, pH 8.0. After rinsing in PBS + 0.6% Triton X-100, the preparations were incubated in hybridization buffer plus preboiled herring sperm solution (200 μg/ml) at 60°C for 1–2 h. DIG-labeled antisense probes (diluted to a final concentration of 1:100 in hybridization buffer) were then added for overnight incubation at 60°C. The preparations were subsequently rinsed extensively in hybridization buffer (first at 60°C and then room temperature), and then incubated overnight at 4°C in AP-conjugated sheep anti-DIG (Roche, #11093274910; 1:2000) that had been preadsorbed against fixed skeletal muscle. Bound probes were detected by reacting the preparations with nitro blue tetrazolium plus 5-bromo-4-chloro-3-indolyl phosphate, diluted in AP developing buffer (Alkaline Phosphatase Conjugate Substrate Kit, Bio-Rad, #1706432).
After processing, embryos were then mounted in SlowFade Gold Antifade Reagent (Life Technologies, #S36936) and imaged using a Nikon Optiphot-2UD light microscope, equipped with Nomarski optics and a Nikon DXM1200F camera. Alternatively, for in situ hybridization histochemistry using fluorescent probes, preparations were incubated with antisense probes, then rinsed and incubated with HRP-conjugated Fab fragments of sheep anti-DIG (anti-DIG-POD; Roche, #11207733910), diluted 1:300 in PBST. Preparations were reacted for 0.5–3 min with Cy3-conjugated tyramide signal amplification substrates (TSA plus Cy3 Kit NEL744001KT, PerkinElmer). Subsequently, the preparations were rinsed and immunohistochemically labeled with antibodies specific for glial or neuronal markers (as described above), then mounted in SlowFade Gold and imaged by confocal microscopy.
Embryo culture.
Staged Manduca embryos (at 50 hpf) were removed from their eggshells and positioned dorsal-side up in Sylgard chambers containing warmed culture medium (defined saline plus 9.7% heat-inactivated normal horse serum, 0.2% 20-hydroxyecdysone, 0.1% insulin, and 0.04% penicillin–streptomycin, pH 7.4; Ramaker et al., 2013). A small incision was then made in the dorsal epithelium to expose the developing ENS, and experimental reagents were applied directly to the premigratory EP cells until a full exchange of medium had been accomplished. The embryos were allowed to develop for an additional 12–48 h at 28°C, then rinsed with normal culture medium and dissected along the midline to completely expose the ENS. The dissected preparations were fixed in 4% PFA for 1 h, rinsed in PBST, and immunostained with mouse anti-pan Fas II (C3; 1:20,000), which provides unambiguous labeling of the EP cells and their processes [expressing transmembrane Fas II (TM-Fas II)], as well as the ensheathing glial cells (expressing GPI-Fas II; Wright et al., 1999; Ramaker et al., 2013). Anti-Fas II immunoreactivity was detected with biotinylated horse anti-mouse secondary antibodies (Vector Laboratories, BA-2000) diluted 1:200 in blocking solution, followed by an avidin–biotin reaction to amplify the signal (1:100; ABC kit, Vector Laboratories). The preparations were reacted with 1.4 mm 3,3′-diaminobenzidine in 0.001% H2O2 and mounted in a glycerol-based medium on microscope slides. Conventional photomicrographic and camera lucida techniques were used to quantify the extent of neuronal migration and axon outgrowth along the midgut band pathways (Wright et al., 1999). Average values were calculated from replicate groups of embryos (N ≥ 10 per condition), and each experiment was repeated ≥3 times. To measure ectopic growth by the EP cells, both the number of neurons and the cumulative distance of neurites that had traveled onto the interband muscles (between band pathways) were determined from camera lucida images, as previously described (Coate et al., 2008; Ramaker et al., 2013). The extent of ectopic outgrowth was normalized to the diameter of the midgut in each preparation to compensate for any distortions caused by our fixation and immunohistochemical staining methods (typically this distortion was <10% of the average midgut diameters in each experiment). To ensure an unbiased analysis of the culture preparations, camera lucida images were generated and analyzed by two different investigators, both blinded to the treatment conditions. For analyses with >2 treatment groups, means were assessed using one-way ANOVA. Post hoc analysis used Student's two-tailed t tests, applying Bonferroni's correction to obtain p values adjusted for the number of pairwise comparisons.
Morpholino antisense oligonucleotides [morpholinos (MOs); Gene Tools] were designed against several regions of the mRNA sequences encoding MsContactin and APPL, respectively, and initially tested for their effectiveness and specificity in GV1 cells (at 1–50 μm). After 48 h incubation with MOs targeting each gene, the cells were lysed in chilled NP-40 lysis buffer, and residual MsContactin and APPL levels were analyzed by Western blotting methods; the expression levels of several control proteins (including Fas II and actin) were used to monitor for off-target effects of the MOs. The most effective MsContactin-specific MO (GTTTAAGATGACAAACACCGGAGGT; targeting a sequence within the 5′ UTR region upstream of the initiation codon) was subsequently used to inhibit MsContactin expression in cultured embryos (as described below). To inhibit APPL expression, we used an MO targeting a region in the Manduca Appl gene adjacent to the initiation codon (CCGcgttgcttcccaccagccc), which we previously showed was effective in inhibiting APPL expression in embryos (Ramaker et al., 2013).
To inhibit APPL or Contactin expression in cultured embryos, MOs were diluted to 100 μm in culture medium. A small incision was made in the dorsal body wall of embryos placed in culture (at 53 hpf), and MOs were delivered into the EP cells with 0.6–1% Endo-Porter (Gene Tools), as previously described (Coate et al., 2008). Based on our past studies, we estimate that this method results in a 10-fold dilution of the MOs, whereby the EP cells were exposed to a final concentration of ∼10 μm. Control embryos were treated with equivalent concentrations of standard control MOs plus Endo-Porter. For experiments combining MsCont–Fc stimulation with MO treatments, MsCont–Fc was added at a final concentration of 20 μg/ml. To test the role of Goα in MsContactin-dependent responses, embryos were treated with MsCont–Fc plus pertussis toxin (PTX; intact molecule; Invitrogen) at a final concentration of 100 ng/ml in serum-free culture medium (Horgan et al., 1995).
For binding assays using sAPPL–AP fusion constructs, dissected embryos were fixed with 4% PFA, rinsed with PBS + 0.5% acetylated BSA (Aurion BSA-c, Aurion) without Triton X-100, and then incubated for 90 min with 100 ng/ml sAPPL–AP (Flanagan et al., 2000). Purified AP (Genhunter, #Q302) and vehicle control medium served as negative controls. For binding assays using MsCont–Fc fusion constructs, dissected embryos were fixed with 4% PFA, permeabilized briefly with PBS plus 0.1% Triton X-100, and then incubated for 2 h with 400 μg/ml MsCont–Fc in defined saline. Matched sets of preparations were treated (1) with medium alone, (2) with ChromPur human IgG Fc fragments (Jackson ImmunoResearch, #009-000-008); or (3) with a variety of control Fc fusion proteins, including MsEph–Fc and MsEphrin–Fc (Coate et al., 2008). The embryos were subsequently postfixed with PFA for 30–60 min. Preparations treated with AP fusion proteins were incubated with mouse anti-human placental AP (1:200; Thermo Fisher Scientific, #MA1-19354), which was detected with Alexa 488-conjugated anti-mouse secondary antibodies. Preparations treated with Fc fusion proteins were incubated with 549-conjugated goat anti-human IgG Fc antibodies (Abcam, #ab98563) or with HRP-conjugated anti-Fc antibodies (1:1000; Jackson ImmunoResearch), followed by a reaction with tyramide signal amplification substrates for 2 min (Coate et al., 2007). The preparations were subsequently counterstained with antibodies specific for neuronal and glial markers (as described above) and imaged by confocal microscopy, using identical laser-intensity settings within the linear range of each channel for all preparations in an experiment. To quantify the relative levels of MsCont–Fc signals in MO-treated preparations, three separate images were obtained per preparation, each consisting of three optical sections spanning 0.6 μm total tissue thickness. Maximum intensity projections were generated using Fiji software and uniformly adjusted for brightness and contrast by an investigator blinded to the treatment conditions. Regions of interest (ROIs) in each preparation were manually selected that encompassed single EP cells (on the mid-dorsal muscle bands) or identical areas on the adjacent interband muscles. Total signal intensities within the ROIs were calculated separately for each fluorescent channel, and background levels (determined from the control ROIs) were subtracted from the ROI values encompassing the EP cells. After unblinding the treatment conditions, average values for the relative levels of MsCont–Fc binding activity were determined for each condition, and statistical differences between groups calculated using Student's t tests.
Results
The Manduca ENS as a model system for investigating neuronal and glial migration
The differentiation of the Manduca ENS involves a precisely choreographed sequence of neuronal and glial migration (Fig. 1A), regulated by attractive and repulsive guidance cues encountered by the motile cells during different phases of their differentiation (Copenhaver and Taghert, 1989b; Copenhaver, 1993; Wright et al., 1999; Coate et al., 2008). Between 30 and 40 hpf, a packet of ∼300 neurons (EP cells) delaminates from a neurogenic placode in the dorsal foregut, coincident with their terminal mitoses (Copenhaver and Taghert, 1990). Over the next 15 h (from 40 to 55 hpf), this packet of neurons spreads bilaterally around the foregut (Fig. 1A1, magenta cells), gradually aligning with eight preformed muscle bands (b) on the midgut surface. Then between 55 and 65 hpf, small groups of EP cells rapidly migrate in a chain-like Manner along each of the midgut muscle bands, while a few neurons migrate radially onto the foregut musculature (Fig. 1A2). Throughout the migratory period, the EP cells extend and retract numerous filopodia onto the adjacent gut musculature, but they remain closely associated with their band pathways while generally avoiding the interband regions (ib). Concurrently, a population of proliferating glial cells (green cells) spreads from the foregut onto the pathways established by the neurons. Between 65 and 70 hpf, the EP cells transition from active locomotion to a prolonged phase of outgrowth (Fig. 1A3), during which they extend fasciculated bundles of axons posteriorly along the length of the midgut. In some preparations, a small number of neurons (typically 1–3) remain within the nerve arches between adjacent bands on the foregut (open arrowheads) and occasionally extend processes directly onto the midgut. Only subsequently do the neurons extend terminal branches laterally off the bands (from 75 to 100 hpf; Fig. 1A4), providing a diffuse innervation of the midgut musculature. The glial cells also continue to elaborate processes around the dispersed groups of EP cells, ultimately ensheathing the neuronal somata (Copenhaver, 1993).
In previous studies, we showed that APPL expression is initially upregulated in EP cells as they spread around the foregut, and it remains elevated throughout their subsequent phases of migration and axon elongation (Swanson et al., 2005; Ramaker et al., 2013). We also showed that full-length APPL traffics into the leading processes and growth cones of the motile EP cells, where it functions as a neuronal guidance receptor that helps restrict inappropriate outgrowth onto the interband regions of the midgut (Ramaker et al., 2013). Figure 1B1 shows the developing ENS of an embryo at 65 hpf (during the transition from migration to axon outgrowth), immunostained with antibodies targeting APPL (magenta) and GPI-Fas II (green). As previously reported, insect APPL is expressed exclusively by neurons (Luo et al., 1990; Swanson et al., 2005), while GPI-Fas II is expressed exclusively by the ensheathing glial cells at this stage (Wright and Copenhaver, 2000), providing specific markers for the different cellular components of the ENS.
Identification of MsContactin as a candidate ligand for APPL
To identify membrane-associated proteins that interact with APPL, we created a fusion construct containing the secreted ectodomain of Manduca APPL, fused to an AP tag (sAPPL–AP). We then used this construct to screen a plasmid expression library in COS7 cells (prepared from embryonic Manduca cDNA), following the “panning” protocols of Flanagan and colleagues (Flanagan and Cheng, 2000; Osterfield et al., 2008). One of our strongest positive clones encoded M. sexta Contactin (MsContactin). As noted above, several Contactin family members have been shown to interact with APP family proteins in vertebrate systems (Ma et al., 2008; Osterfield et al., 2008; Osterhout et al., 2015), suggesting that MsContactin might serve a similar function in the developing ENS. Accordingly, we obtained a full-length cDNA clone encoding MsContactin (1311 aa) by RT-PCR (GenBank accession #KU840799) and confirmed the sequence by comparison with the Manduca genome (https://i5k.nal.usda.gov/Manduca_sexta). As illustrated in Figure 1C, the predicted structure of MsContactin contains six Ig domains, four FN-III repeats, and a GPI attachment site at its C terminus, similar to other Contactin family members (Shimoda and Watanabe, 2009; Zuko et al., 2011). MsContactin also contains a C-type lectin domain at its N terminus that was originally identified in Drosophila Contactin (dContactin); the function of this domain is unknown (Faivre-Sarrailh et al., 2004). The primary amino acid sequence for MsContactin is 58% identical to dContactin and ∼31% identical to mouse and human Contactin-3 and Contactin-4 (the closest mammalian orthologs). Sequence similarities were considerably stronger within the four FN-III domains (Fig. 1D), including the conserved motifs flanking each FN-III domain.
As an initial means of exploring Contactin expression in the developing ENS, we coimmunostained Manduca embryos with anti-APPL to label the EP cells (Fig. 1B2, magenta) and an antiserum against dContactin (generously provided by Dr. Manzoor Bhat and colleagues, University of Texas Health Center, San Antonio, Texas). Unexpectedly, we found that anti-dContactin (Fig. 1B2, green) produced a pattern of immunoreactivity that closely matched the expression of GPI-Fas II (Fig. 1B1), labeling the glial processes surrounding the EP cells but not the neurons themselves. However, because both the anti-dContactin and anti-GPI-Fas II antibodies were produced in the same host species, we generated a new affinity-purified antibody against a conserved region shared by insect Contactins, spanning the third and fourth FN-III domains in MsContactin (amino acids 1156–1171; Fig. 1C,D, asterisks). In Western blots of lysates prepared from Manduca GV1 cells and embryos (collected at 65 hpf), anti-MsContactin labeled a single band at ∼175 kDa (Fig. 2A, arrow), compared with the predicted size of the core protein of ∼142 kDa. Likewise, anti-MsContactin labeled a single band at ∼180 kDa in Drosophila lysates, compared with the predicted core protein for dContactin of 155 kDa. As previously reported (Faivre-Sarrailh et al., 2004), the larger apparent size of endogenously expressed dContactin results from extensive N-glycosylation at residues conserved in MsContactin. Similar results were obtained using anti-dContactin, although this antibody also labeled several additional nonspecific bands in Manduca lysates (J. M. Ramaker, T. L. Swanson, P. F. Copenhaver, unpublished observations).
To demonstrate the specificity of our anti-MsContactin antibody, we also generated an Fc-coupled fusion protein containing the four FN-III domains of MsContactin (MsCont–Fc; Fig. 1C). As shown in Figure 2A (lane 1), anti-MsContactin detected both the monomeric (110 kDa) and dimeric (∼220 kDa) forms of this fusion protein (arrowheads), but did not label control Fc proteins (data not shown). In contrast, preadsorbing our anti-MsContactin antibody against its peptide epitope eliminated its ability to label proteins in Western blots of Manduca and Drosophila lysates (Fig. 2A, asterisk). Last, knocking down MsContactin mRNA expression in GV1 cells with MOs almost completely eliminated labeling of the 175 kDa band by anti-MsContactin (Fig. 2B1, lane 3), whereas control MOs and MOs targeting APPL mRNA had no consistent effect on MsContactin levels (Fig. 2B1, lanes 1, 2). These results indicate that our anti-MsContactin antibody specifically labels MsContactin but not other proteins expressed by developing embryos.
Cell type-specific expression of APPL and MsContactin in the developing ENS
Given previous evidence that mammalian Contactins can interact with APP family proteins both in cis (as candidate coreceptors) and trans (as potential ligand-receptor partners), we investigated which cell types express MsContactin and APPL in more detail. Using identically staged sets of embryos (at 65 hpf), we initially performed whole-mount in situ hybridization histochemistry with DIG-labeled antisense riboprobes targeting APPL, MsContactin, and GPI-Fas II mRNA. As previously described (Swanson et al., 2005), riboprobes specific for APPL mRNA labeled the migratory EP cells that had dispersed along the midgut muscle bands (Fig. 3A, black arrows) and along radial muscles on the foregut (white arrows), but not the trailing glial populations occupying the branching nerves of the enteric plexus on the foregut (black arrowheads). In contrast, riboprobes specific for GPI-Fas II mRNA (Wright and Copenhaver, 2000) produced a complementary pattern of staining, labeling the glial cells within the enteric plexus nerves (Fig. 3B, black arrowheads) and along the pathways pioneered by the EP cells on the midgut (Fig. 3B, white arrowheads). Notably, riboprobes specific for MsContactin mRNA (Fig. 3C) produced a pattern of staining that closely matched the distribution of GPI-Fas II mRNA, labeling glial populations within the foregut plexus nerves (black arrowheads) and associated with the midgut pathways (white arrowheads), but not the leading EP cells (black arrows).
To demonstrate that MsContactin is specifically expressed by the enteric glial cells but not the EP cells, we subsequently used fluorescence in situ hybridization histochemistry to label embryos with riboprobes targeting mRNAs encoding either MsContactin or APPL, and then counterstained the preparations with antibodies against our neuronal and glial markers. Initially, we focused on the esophageal nerve of the foregut (EN; Fig. 1A), which contains fasciculated axons from some EP cells and neurons in more anterior ganglia enwrapped by glial cells, but no neuronal cell bodies (Copenhaver and Taghert, 1989a, 1991). As shown in Figure 3D, riboprobes specific for MsContactin mRNA strongly labeled the ensheathing glial cells (magenta/red), which were double-immunostained with anti-REPO (to label glial nuclei) and anti-GPI-Fas II (to label glial processes), but not the axons themselves (immunostained with anti-APPL; blue). The punctate nature of the in situ hybridization signal was due in part to the tyramide-based amplification method used to label these preparations, but it might also reflect local concentrations of MsContactin mRNA in the glial processes (white arrowheads), similar to the well documented transport of RNA granules in mammalian glia (Smith, 2004; Carson et al., 2008; Quraishe et al., 2016). As expected, we detected no APPL mRNA within the esophageal nerve (data not shown).
Using these methods to label the developing enteric plexus, we found that riboprobes specific for APPL mRNA strongly labeled the EP cells on the midgut (Fig. 3E,G, green), which were counterstained with ELAV (Fig. 3E2,G2, blue), but not the adjacent glial cells (magenta/red). By comparison, MsContactin mRNA was restricted to the ensheathing glial cells (Fig. 3F,H, green), including punctate labeling within glial processes surrounding the neurons (arrowheads). These results indicate that MsContactin is only expressed by glial cells within the developing ENS, and confirm that APPL is a neuronal-specific protein (as previously reported; Luo et al., 1990; Swanson et al., 2005).
As a complementary strategy, we also triple-immunostained the developing ENS with antibodies against APPL (to label the EP cells), GPI-Fas II (to label the enteric glial cells), and our new antibody against MsContactin (Fig. 4). At lower magnification, we could readily detect MsContactin within glial processes that extended around the neuronal somata expressing APPL (Fig. 4A,B, arrowheads). At higher magnification, anti-APPL clearly labeled the EP cells and their processes (Fig. 4C1,D1), whereas anti-GPI-Fas II (Fig. 4C2,D2) and anti-MsContactin (Fig. 4C3,D3) both labeled the surrounding glial processes. In the course of these studies, we also noted that the distribution of MsContactin on the glial membranes was more restricted than GPI-Fas II, whereby MsContactin immunoreactivity was concentrated within glial processes at the margins of the ensheathed columns of neurons (Fig. 4C4,D4, arrowheads). Although this pattern might be caused by partial masking of MsContactin at points of cell–cell contact, it could also result from the selective localization of MsContactin within specific subdomains of the glial processes. These results are also consistent with the model that neuronal APPL interacts only transiently with glial MsContactin, resulting in a repulsive response by the migratory EP cells (as described below).
Because APP and Contactin family members are often coexpressed by the same cell types in mammalian systems, they can be readily coimmunoprecipitated from mouse brain lysates (Ma et al., 2008; Osterfield et al., 2008; Shimoda et al., 2012; Osterhout et al., 2015). In contrast, we found that antibodies against APPL did not coimmunoprecipitate MsContactin from Manduca embryonic lysates (Fig. 2C1, arrow), nor did anti-MsContactin coimmunoprecipitate APPL (Fig. 2C2, arrowheads), complementing our evidence that the two proteins are expressed by different cell types (Figs. 3, 4). In contrast, anti-APPL reliably coimmunoprecipitated Goα (Fig. 2C3), whereas anti-MsContactin did not (Fig. 2C4), supporting our earlier work that APPL and Goα directly interact in developing neurons (Ramaker et al., 2013).
Glial expression of MsContactin is developmentally regulated, coincident with EP cell migration
In previous studies, we showed that APPL expression in the EP cells is dramatically upregulated during their migration and during axon outgrowth onto the midgut bands (55–65 hpf), but it is eventually downregulated as the neurons extend terminal branches onto the interband musculature (85–100 hpf; Swanson et al., 2005; Ramaker et al., 2013). To determine whether MsContactin expression by the enteric glial cells is also developmentally regulated, we immunostained embryos at progressive ages with a combination of anti-APPL, anti-GPI-Fas II, and our affinity-purified anti-MsContactin antibody (Fig. 5). During the initial spreading phase of EP cell migration, while the neurons were still on the foregut (∼40–55 hpf), we found that MsContactin expression in the ENS was negligible (data not shown). In contrast, shortly after the EP cells commenced their migration onto the midgut bands (58–62 hpf), we first detected MsContactin in glial processes extending around the migratory neurons (Fig. 5A1). Once again, we found that anti-MsContactin immunoreactivity overlapped with GPI-Fas II in the glial cells (Fig. 5A2, green) that ensheathed the migratory neurons (expressing APPL; magenta). During subsequent phases of development, MsContactin levels became progressively more robust in the glial processes ensheathing the EP cells (Fig. 5B1), while APPL levels remained high in the neuronal somata and their leading processes as the neurons transitioned from migration to axon outgrowth (Fig. 5B2; 65 hpf). MsContactin was also detectable in tracheolar cells extending in from the lateral body wall during this period (Fig. 5B1, t). However, since the tracheoles do not invest the ENS until later in development (∼75 hpf), they are unlikely to influence EP cell migration and outgrowth directly. Even after APPL expression was downregulated in the fully mature neurons (Fig. 5C2; 90 hpf), MsContactin levels remained high in the glial processes throughout the remainder of embryogenesis (Fig. 5C1). These results indicate that glial MsContactin is temporally and spatially positioned to interact with neuronal APPL during key periods of migration and axon outgrowth.
Glial Contactin is required for preventing ectopic neuronal migration and outgrowth
In previous work, we demonstrated that APPL–Goα signaling plays an important role in regulating the guidance of the EP cells, whereby knocking down APPL expression or inhibiting Goα activity produced the same distinctive pattern of ectopic migration and outgrowth onto the interband regions of the midgut (Ramaker et al., 2013). To investigate how MsContactin might contribute to this response, we first tested whether knocking down MsContactin expression in the glial cells also affected EP cell behavior. Synchronized embryos were opened in culture shortly before the onset of migration (50 hpf), a stage when the premigratory neurons have begun to express APPL (Swanson et al., 2005), but the proliferating glial precursor cells have not yet begun to ensheath the neurons or express MsContactin. We then treated the developing ENS in these preparations with either MsContactin-specific MOs (validated in our GV1 cell assay; Fig. 2B) or a variety of control MOs for 24 h, spanning the periods of EP cell migration and outgrowth. The embryos were subsequently fixed and immunostained with anti-pan-Fas II antibodies to fully label the neurons, glial cells, and their processes, which we could readily distinguish by their morphologies and positions using our camera lucida-based methods (Wright et al., 1999; Coate et al., 2008).
Examples of embryos from each treatment condition are shown in Figure 6 (redrawn from camera lucida images). Figure 6A shows the positions of the premigratory neurons adjacent to the foregut–midgut boundary (FG/MG) at experimental onset. Figure 6B shows a preparation that was treated with control MOs for 24 h, in which the neurons and their processes remained predominantly confined to the muscle bands. In contrast, treating embryos with MsContactin-specific MOs resulted in a striking pattern of ectopic migration and neurite outgrowth onto the interband regions (Fig. 6C, arrows). Quantification of these effects (Fig. 6E) showed that knocking down MsContactin expression caused a significant increase in the number of neurons (hatched bars; p = 0.003) and their processes (stippled bars; p = 0.043) that traveled inappropriately onto the interband regions. On average, 20% of the EP cells exhibited these behaviors in each preparation, in contrast to the small number of “arch” neurons seen in controls (Fig. 6B, open arrowheads). We also noted that most ectopic growth was exhibited by trailing groups of migratory neurons, corresponding with our observation that the ensheathing glial cells expressing MsContactin lag slightly behind the leading EP cells during normal development (Fig. 5). In contrast, knocking down MsContactin expression had no significant effect on the extent of migration and axon elongation by the leading groups of EP cells that remained on the muscle bands (Fig. 6D), which is consistent with our previous evidence that other guidance cues support the preferential guidance of the EP cells along these pathways (Wright et al., 1999; Coate et al., 2008). These results are also remarkably similar to the effects of interfering with APPL expression or Goα signaling, as described below.
Complementary binding of APPL and Contactin fusion proteins in the developing ENS
A variety of studies have indicated that the E1/E2 extracellular domains of APP family proteins can interact with different Contactins (Ma et al., 2008; Osterfield et al., 2008; Osterhout et al., 2015). Accordingly, we generated a fusion protein consisting of the E1/E2 domains of APPL plus human placental AP (sAPPL–AP; Fig. 7A) and tested whether it could bind to MsContactin on the enteric glial cells. After treating embryos with sAPPL–AP for 90 min, we triple-immunostained the preparations with anti-APPL, anti-GPI-Fas II, and anti-AP (to detect bound fusion proteins). When we examined the midgut regions of the enteric plexus in these preparations, we found that sAPPL–AP strongly labeled both the EP cells and the ensheathing glial cells (data not shown), which is consistent with previous reports that APP can bind homophilically to itself and heterophilically to Contactin family members (Soba et al., 2005; Osterfield et al., 2008; Tachi et al., 2010; Kaden et al., 2012). However, the close proximity of the neuronal and glial membranes on the band pathways made it difficult to differentiate between sAPPL–AP labeling on the two cell types. Instead, we again focused on the esophageal nerve of the foregut, which (as noted earlier) contains fasciculated axons ensheathed by glial cells but no neuronal somata. As shown in Figure 7D,E, we could readily distinguish the axon bundles (expressing APPL; magenta) from the ensheathing glia (expressing GPI-Fas II and MsContactin; green), recapitulating the cell type-specific expression of these proteins in the midgut ENS. Accordingly, we focused on this region to test whether glial MsContactin specifically binds APPL.
For this assay, we pretreated cultured embryos with either control MOs or MOs targeting MsContactin mRNA for 24 h, and then labeled the preparations with sAPPL–AP before counterstaining with neuronal and glial markers. In preparations treated with control MOs (Fig. 7C), we found that sAPPL–AP (Fig. 7C3) robustly labeled both the axons within the esophageal nerve expressing APPL (Fig. 7C1, arrows) and the surrounding glial cell membranes expressing GPI-Fas II (Fig. 7C2, arrowheads). No detectable signal was seen in preparations labeled with control AP proteins or medium alone (Fig. 7B). In contrast, when we pretreated embryos with MsContactin-specific MOs (Fig. 7F), we found that sAPPL–AP labeling on the glial membranes was dramatically reduced (Fig. 7F3, arrowheads), whereas there was no detectable effect on APPL expression by the axons (Fig. 7F1) or GPI-Fas II expression by the glial cells (Fig. 7F2). In addition, treatment with MsContactin MOs had no consistent effect on axonal labeling by sAPPL–AP (Fig. 7F3, arrows). These experiments indicate that the enteric glial cells require MsContactin to bind APPL, supporting the model that glial MsContactin might function as a ligand for neuronal APPL within the developing ENS.
As a complementary strategy, we also tested whether fusion proteins derived from MsContactin could bind APPL on the migratory EP cells. Whereas Contactins can bind homophilically via their Ig domains (Freigang et al., 2000; Mörtl et al., 2007), both Contactin-3 and Contactin-4 have been shown to bind specifically to the extracellular domains of APP family proteins via their FN-III domains (Osterfield et al., 2008). Accordingly, we generated a soluble fusion protein consisting of the four FN-III domains of MsContactin plus human Fc (MsCont–Fc; Fig. 7G). We then treated cultured embryos for 24 h with control MOs or MOs targeting APPL mRNA (validated in our GV1 cell assays; Fig. 2). The preparations were subsequently labeled with MsCont–Fc for 90 min, and counterstained with anti-APPL (to label the EP cells) plus anti-Fc (to detect bound MsCont–Fc).
For this analysis, we focused on leading groups of EP cells that had not yet been fully ensheathed by the enteric glia, thereby avoiding potential interactions with glial MsContactin. As shown in Figure 7H,I, when embryos were pretreated with control MOs, the EP cells continued to express APPL at high levels (Fig. 7H1,I1). Subsequent incubation of these preparations with MsCont–Fc fusion proteins robustly labeled the neurons and their processes (detected with anti-Fc; Fig. 7I2), whereas incubation with defined saline alone produced no appreciable anti-Fc staining (Fig. 7H2). In contrast, when embryos were treated with APPL-specific MOs (Fig. 7J), we found that expression of APPL in the EP cells (Fig. 7J1) and labeling with MsCont–Fc (Fig. 7J2) were both substantially reduced. Quantification of these results (Table 1) showed that treatment with APPL-specific MOs caused a significant loss of APPL expression and MsCont–Fc binding to the neurons, compared with preparations treated with control MOs. Together, these experiments indicate that enteric glial cells require MsContactin to bind APPL while the migratory EP cells require APPL to bind MsContactin, supporting the model that MsContactin might function as a ligand for APPL within the developing ENS.
It has been postulated that an authentic APP ligand might stimulate the proteolytic cleavage of the holoprotein by one or more secretases (O'Brien and Wong, 2011; Zheng and Koo, 2011). Accordingly, we also tested whether treating embryos with MsCont–Fc altered the relative abundance of full-length or cleaved forms of APPL (quantified by our Western blotting methods). However, these experiments yielded ambiguous results: in some experiments, we found that MsCont–Fc treatment moderately increased the generation of APPL-derived fragments, while in other replicate assays, we observed either no change or a moderate reduction in APPL processing (data not shown). Curiously, several other investigations exploring this issue have also produced conflicting findings. Under some conditions, both Contactin-1 (F3) and Contactin-2 (TAG-1) enhanced APP processing (Ma et al., 2008; Puzzo et al., 2015), whereas in different assays, Contactin-2 had no effect (Rice et al., 2013), and Contactin-4 fusion proteins were found to have variable effects on APP cleavage, depending in part on holoprotein expression levels (Osterfield et al., 2008). Additional studies will therefore be needed to address whether MsContactin–APPL signaling regulates APPL processing in the developing ENS, which might provide an important mechanism for terminating APPL-dependent responses in the migratory neurons.
MsContactin regulates APPL-dependent migration and outgrowth in the nervous system
Since APPL–Goα signaling normally restricts the EP cells from traveling inappropriately off their muscle band pathways (Ramaker et al., 2013), we postulated that overstimulating this response with MsContactin fusion proteins should cause a more global inhibition of their migration and outgrowth, similar to the effects of hyperactivating Goα. Accordingly, we treated the premigratory EP cells of cultured embryos at 50 hpf (before the onset of MsContactin expression) with different combinations of MOs and fusion proteins (Fig. 8A), and then subsequently analyzed the extent of EP cell migration and outgrowth on both the bands and interband regions after 24 h of subsequent development. In untreated preparations and preparations treated with control reagents, we found that the neurons remained primarily confined to their band pathways (Fig. 8B), similar to our earlier experiments. In contrast, treating the EP cells with MsCont–Fc resulted in a dramatic reduction in the distance of their migration and axon outgrowth along the bands (Fig. 8C), matching the effects of hyperactivating APPL–Goα signaling by other methods (Ramaker et al., 2013). To test whether this effect was APPL-dependent, we first verified that treatment with APPL MOs caused a marked increase in ectopic migration and outgrowth (Fig. 8D, arrows), similar to the effects of knocking down MsContactin expression (Fig. 6C). Notably, when APPL expression was initially inhibited by this method, subsequent treatment with MsCont–Fc no longer stalled EP cell motility: the overall extent of migration and outgrowth was largely restored in these preparations (compared with controls), accompanied by a moderate increase in ectopic growth onto the interband regions (Fig. 8E, arrows).
These results are also summarized in Figure 8F–H. Consistent with our earlier studies, treatment with APPL-specific MOs (plus control medium) had no effect on the normal extent of neuronal migration and axon outgrowth along the muscle band pathways (Fig. 8F). However, knocking down APPL expression did cause a significant increase in ectopic migration (Fig. 8G) and outgrowth (Fig. 8H) onto the interband regions, compared with controls. This response is analogous to the effects of knocking out all three APP family proteins (APP, APLP1, and APLP2) in transgenic mice, which resulted in a striking pattern of ectopic neuronal migration and cortical heterotopias (Herms et al., 2004). In contrast, treatment with MsCont–Fc (plus control MOs) significantly reduced the overall extent of normal migration and outgrowth along the band pathways (Fig. 8F), while this effect was largely prevented by pretreatment with APPL MOs. Notably, preparations in this latter group also exhibited a significant increase in interband migration (Fig. 8G) and a more moderate increase in ectopic outgrowth (Fig. 8H) compared with controls, although this effect was not as dramatic as in preparations treated with APPL MOs alone.
Last, based on our previous evidence that APPL regulates neuronal migration in a Goα-dependent manner, we also tested whether the effects of MsCont–Fc treatment were blocked by PTX, which in insect systems specifically inhibits Goα but not Giα (Thambi et al., 1989). For this experiment, we treated the EP cells of cultured embryos just before the onset of migration (∼52 hpf; Fig. 9A), a stage when the neurons had begun to express APPL but shortly before the onset of MsContactin expression by the glial cells, and then, using our camera lucida-based methods, analyzed them after 24 h of subsequent development. Similar to the results shown in Figure 8, we found that treating cultured embryos with MsCont–Fc caused a significant inhibition of migration and outgrowth along the band pathways (Fig. 9C), and also prevented the sparse interband outgrowth seen in control preparations (Fig. 9B, open arrowheads). In contrast, treatment with PTX plus MsCont–Fc overcame the inhibitory effects of MsCont–Fc alone, resulting in a dramatic increase in the number of neurons and processes that traveled into the interband regions (Fig. 9D), as well as enhancing migration and outgrowth along the band pathways. These effects were similar to the responses seen in preparations treated with PTX alone (Fig. 9E), recapitulating our earlier studies showing that inhibiting Go activity increases the extent of outgrowth on both the bands and interband regions (Ramaker et al., 2013).
These results are also summarized graphically in Figure 9F,G: treatment with MsCont–Fc significantly reduced the extent of normal migration and outgrowth along the bands (Fig. 9F) and moderately reduced the low basal levels of interband growth seen in control preparations (Fig. 9G). In contrast, treatment with MsCont–Fc plus PTX (or PTX alone) had the opposite effect, significantly enhancing the extent of normal migration and axon elongation along the bands (Fig. 9F) while dramatically increasing ectopic growth and migration onto the interband regions (Fig. 9G). The higher baseline levels of ectopic growth shown in Figure 9 correspond with the fact that our assays using PTX were initiated at a slightly later developmental time than the experiments shown in Figures 6 and 8. Because embryos grown in our culture conditions do not survive as larvae, we could not directly assess the functional consequences of this aberrant neuronal migration and outgrowth on gut physiology. However, in previous work, we documented abnormal midgut morphologies and gut contractility in late-stage embryos with ectopic outgrowth caused by altering Goα activity (Horgan and Copenhaver, 1998), suggesting that perturbing normal APPL–MsContactin signaling should have similar deleterious consequences. In combination, these experiments augment our previous evidence that APPL functions as a neuronal guidance receptor in the EP cells, and indicate that MsContactin serves as an endogenous ligand capable of activating APPL-dependent responses within the developing ENS. Our results also support the model (Fig. 10) that glial MsContactin normally restricts ectopic migration and outgrowth via the local activation of APPL and its downstream effectors, including Goα (as discussed below).
Discussion
MsContactin as a candidate ligand for APPL in the developing ENS
In previous work, we demonstrated that APPL colocalizes with Goα in the growth cones and leading processes of the migratory EP cells, and that APPL directly interacts with Goα both in vitro and in vivo (Swanson et al., 2005; Ramaker et al., 2013). We also showed that inhibiting APPL–Goα signaling in the EP cells induced ectopic migration and outgrowth, whereas activating Goα inhibited their motile behavior (Horgan et al., 1995; Ramaker et al., 2013). Based on our earlier studies showing that Goα activation in the EP cells induces voltage-independent Ca2+ influx (Horgan and Copenhaver, 1998), these results suggested that APPL–Goα signaling promotes Ca2+-dependent retraction responses to local guidance cues encountered by the migratory neurons. Our current experiments indicate that MsContactin represents an authentic ligand for APPL that can activate this pathway (Fig. 10A). Specifically, we found that MsContactin is selectively expressed by the enteric glia while the neurons that they ensheath express APPL, and that the onset of MsContactin expression coincides with key phases of EP cell migration and outgrowth (Figs. 3–45). Using antisense constructs and fusion proteins targeting APPL and MsContactin, we also demonstrated that MsContactin binds to the EP cells in an APPL-dependent manner, whereas APPL binding to the glial cells (but not the neurons) is MsContactin-dependent (Fig. 7). Third, using our embryo culture assays, we showed that reducing the expression of either MsContactin (Fig. 6) or APPL (Fig. 8) resulted in the same distinctive pattern of ectopic migration caused by inhibiting Goα (Fig. 9), whereas treating the EP cells with MsCont–Fc inhibited their motile behavior in an APPL-dependent and Goα-dependent manner (Figs. 8, 9). In contrast, we did not detect any overt defects in glial morphology when we treated embryos with MsCont–Fc (data not shown), suggesting that the effects of MsCont–Fc on neuronal migration were not secondary to disrupted glial cell ensheathment.
In terms of normal development, APPL levels are substantially reduced by the time that the EP cells extend terminal branches onto the interband musculature (by 85–90 hpf; Fig. 5C), which is also consistent with our model. Because our cultured embryos do not survive as larvae, we were unable to assess how aberrant migration and outgrowth affects gut physiology. However, given recent evidence that the insect ENS regulates reproductive and molting behaviors as well as digestion (Ayali, 2009; Schoofs et al., 2009; Cognigni et al., 2011), we think it likely that the developmental defects caused by disrupting MsContactin–APPL signaling would have a significant impact on postnatal viability.
Of note is that the inhibitory responses induced by MsCont–Fc were only partially overcome by pretreatment with APPL MOs (Fig. 8), which may reflect residual levels of APPL in these preparations (Fig. 7J). Likewise, even though knocking down glial MsContactin expression caused a significant increase in ectopic migration, only ∼20% of the neurons were affected in most preparations, suggesting that additional guidance cues help maintain their normal trajectories. In previous work, we showed that homophilic interactions between TM-Fas II on the neurons and the muscle bands promote EP cell guidance along these pathways, whereas GPI-Fas II regulates glial spreading (Wright and Copenhaver, 2000). For neurons that are closely aligned with a band (Fig. 10B, cell #1), we postulate that adhesive interactions mediated by TM-Fas II (and possibly other band-specific cues) are sufficient to maintain migration and outgrowth along these preferred pathways. By comparison, when neurons extend processes off their band pathways (Fig. 10B, cell #2), interactions between neuronal APPL and glial MsContactin induce Goα-dependent retraction responses, thereby preventing inappropriate growth onto the interband regions. In support of this model, we found that treatment with MsCont–Fc caused a global inhibition of migration (Figs. 8, 9), consistent with hyperstimulating this response, whereas knocking down MsContactin permitted ectopic migration and outgrowth (Fig. 10C, cell #2). Whether additional factors also regulate APPL-dependent responses in the developing ENS remains to be explored. Nevertheless, our data support the hypothesis that MsContactin functions as a physiological activator of APPL–Goα signaling (Fig. 10A), maintaining the neurons on their pathways by inducing APPL-dependent retraction responses away from inappropriate domains.
Contactins and the control of APP-dependent responses in the developing nervous system
Although APP may interact with a spectrum of membrane-associated and extracellular proteins (Ho and Südhof, 2004; Hoe et al., 2006, 2009; Rice et al., 2012, 2013), a growing number of studies have shown that APP and its orthologs can directly bind Contactin family proteins in different contexts (Bai et al., 2008; Ma et al., 2008; Osterfield et al., 2008; Osterhout et al., 2015; Puzzo et al., 2015). In particular, Contactins have been implicated in modulating APP-dependent aspects of retinotectal development, albeit via mechanisms that are unexpectedly complex. Based on an initial screen for proteins in the embryonic chick brain that interact with APP family proteins, Osterfield and colleagues showed that both Contactin-3 and Contactin-4 could directly bind APP, and that all three proteins are coexpressed in retinal ganglion cells (RGCs). They also showed that soluble sAPP fragments promoted RGC outgrowth on substrates coated with neural cell adhesion molecule by binding to neuronally expressed Contactin-4 (Osterfield et al., 2008). More recently, Osterhout and colleagues showed that both APP and Contactin-4 are required for specific subsets of RGCs to correctly innervate the accessory optic system (Osterhout et al., 2015). Since APP is expressed both by the RGCs and their targets, these studies suggest that Contactin-4 might function either as a ligand or coreceptor for APP.
However, APLP1 and APLP2 are also strongly expressed in the developing retina (Smit-McBride et al., 2011; Tkatchenko et al., 2015), both of which may interact with a variety of Contactins (Osterfield et al., 2008; Shimoda and Watanabe, 2009). More generally, given that multiple members of the APP and Contactin families are often coexpressed by neurons and glial cells and can interact both in cis and trans (Soba et al., 2005; Shimoda and Watanabe, 2009; Kaden et al., 2012; Mohebiany et al., 2014), deciphering the role of particular combinations of these proteins in the developing brain is likely to remain challenging. By comparison, the developing ENS of Manduca provides a much simpler example of this process, whereby glial MsContactin and neuronal APPL are expressed in a complementary manner. Our results are consistent with the expression pattern of dContactin in Drosophila, which has been detected in epithelial and glial cells (Faivre-Sarrailh et al., 2004; Banerjee et al., 2006), while APPL is only expressed in neurons (Luo et al., 1990; Torroja et al., 1996). Together, our results support the concept that Contactin–APP signaling represents an evolutionarily conserved mechanism for regulating neuronal guidance and remodeling in the nervous system.
Contactin–APP signaling in both development and disease
In addition to being widely coexpressed with APP family proteins (Hosoya et al., 1995; Virgintino et al., 1999; Zuko et al., 2011; Mohebiany et al., 2014), Contactins have been associated with many of the same developmental functions attributed to APP, including axonal guidance (Baeriswyl and Stoeckli, 2008; Osterhout et al., 2015), neurite branching (Mercati et al., 2013), synaptic formation (Sakurai et al., 2009), and neuronal–glial interactions (Bhat et al., 2001; Boyle et al., 2001; Bhat, 2003). Several Contactins have also been implicated in the control of neuronal migration, although this function may be partially due to their effects on neuronal proliferation and differentiation (Denaxa et al., 2005; Ma et al., 2008; Wang et al., 2011; Xenaki et al., 2011). Similarly, both APP and Contactins have been linked with a variety of neurodevelopmental and age-related disorders: genetic mutations affecting Contactin-3, Contactin-4, Contactin-5, and Contactin-6 are strongly associated with autism spectrum disorders (ASDs; Zuko et al., 2013; Mohebiany et al., 2014; Nava et al., 2014; Hu et al., 2015), while elevated sAPP levels have been identified as potential biomarkers for the most severe forms of ASD (Sokol et al., 2006; Ray et al., 2011).
Postnatally, the expression of Contactins and APP family proteins undergo complex changes over the course of aging (Shimazaki et al., 1998; Kögel et al., 2012; Puzzo et al., 2015) and in response to injury (Soares et al., 2005; Chen and Tang, 2006; Corrigan et al., 2011), suggesting that APP–Contactin interactions continue to play important roles in synaptic remodeling and neuronal maintenance. A potential link between Contactin–APP signaling and AD has also been raised by the identification of a polymorphism in the human genome that is associated with late-onset Alzheimer's disease (at 3p26.2-3), which maps closely to the genes encoding Contactin-4 and Contactin-6 (Blacker et al., 2003). Based on our evidence that hyperactivation of MsContactin–APPL signaling induces neuronal stalling and retraction events in the developing nervous system, we postulate that misregulation of this pathway in the adult brain could also provoke neuronal dysfunction and synaptic loss via hyperactivation of Goα and its effectors (Fig. 10A), thereby contributing to the progressive pathologies that typify AD. Determining the downstream mechanisms by which Contactin–APP signaling regulates neuronal behavior would therefore provide new insight into how the perturbation of this pathway might lead to neurodegenerative responses in the aging or injured brain.
Footnotes
- Received March 5, 2016.
- Revision received June 22, 2016.
- Accepted July 12, 2016.
This work was supported by National Institutes of Health Grants RO1 AG025525 and R21 NS078363 to P.F.C., who also received support from an Oregon Health & Science University Presidential Bridge Funding Award. J.M.R. received support from a grant from the Oregon Partners for Alzheimer's Research and from National Institute on Aging Training Grant #AG023477. We thank Drs. Doris Kretzschmar and David Morton for critical input on the manuscript. We also thank Drs. Manzoor A. Bhat, Dr. Swati Banerjee, and Dr. Kalpana White for generously providing antibodies used in this work. We acknowledge Dr. Michael Kanost, Dr. Gary Blissard, and the Manduca sexta Genome Consortium for providing prepublication access to data from the Manduca genome project. We are grateful to Dr. Stefanie Kaech and Aurelie Snyder for their assistance with confocal microscopy and image analysis that was performed in the Advanced Light Microscopy Core, Jungers Center at Oregon Health & Science University, which is supported in part by National Institutes of Health Grant P30 NS061800.
The authors declare no competing financial interests.
- Correspondence should be addressed to Dr. Philip F. Copenhaver, Cell, Developmental and Cancer Biology L-215, Oregon Health & Science University, 3181 Southwest Sam Jackson Park Road; Portland, OR 97239. copenhav{at}ohsu.edu
- Copyright © 2016 the authors 0270-6474/16/368757-19$15.00/0