Table 1.

PCR primers and FRET probes

SizePCRFRET probes
GAD 65391Sense1-b, 713: TCTTTTCTCCTGGTGGTGCC3′ FITC, 848: TTTCTCTCAAGAAGGGAGCTGCA
#M72422Antisense1-b, 1085: CCCCAAGCAGCATCCACAT5′ R705, 872: CCTTGGGGATCGGAACAGACA
GAD 67600Sense1-a, 713: TACGGGGTTCGCACAGGTC3′ FITC, 930: CCTGGGGGAGCCATATCCAA
#M76177Antisense, 1294: same as GAD655′ R705, 951: ATGTACAGCATCATGGCGGCTC
CaB432Sense1-a, 134: AGGCACGAAAGAAGGCTGGAT3′ FITC, 263: TCCTGCTGCTCTTTCGATGCC
#M27839Antisense1-a, 544: TCCCACACATTTTGATTCCCTG5′ R705, 285: GCAACTGAAGTCCTGCGAGGAA
PV381Sense, 247: ACAAAGACGCTGATGGCTGC3′ FITC, 283: GACGGCAAGATTGGGGTTGA
#M12725Antisense, 607: CGTGGTCCTTCGCTCTCTCTC5′ R705, 304: GAATTCTCCACTCTGGTGGCCG
CR309Sense1-a, 142: CTGGAGAAGGCAAGGAAAGGT3′ FITC, 248: TTGAGATGGCAGAGCTGGCG
#X66974Antisense1-a, 429: AGGTTCATCATAGGGACGGTTG5′ R705, 269: AGATCCTGCCAACCGAAGAGAAT
NPY359Sense1-a, −45: GCCCAGAGCAGAGCACCC3′ FITC, 17: AACGAATGGGGCTGTGTGGA
#M15880Antisense1-a, 292: CAAGTTTCATTTCCCATCACCA5′ R705, 38: TGACCCTCGCTCTATCCCTGC
SOM209Sense1-a, 43: ATCGTCCTGGCTTTGGGC3′ FITC, 105: GCAGAAGTCTCTGGCGGCTG
#K02248Antisense1-a, 231: GCCTCATCTCGTCCTGCTCA5′ R705, 126: CACCGGGAAACAGGAACTGGC
VIP286Sense1-a, 167: TGCCTTAGCGGAGAATGACA3′ FITC, 199: TGTGTCCAGAAATGCCAGGCA
#X02341Antisense1-a, 434: CCTCACTGCTCCTCTTCCCA5′ R705, 221: GCTGATGGAGTTTTCACCAGCG
CCK216Sense1-a, 174: CGCACTGCTAGCCCGATACA3′ FITC, 198: CCAGCAGGTCCGCAAAGCT
#K01259Antisense1-a, 373: TTTCTCATTCCGCCTCCTCC5′ R705, 218: CCTCTGGCCGCATGTCCG
5-HT3A411Sense, 1105: TTCCAAGCCAACAAGACTGATG3′ FITC, 1127: ACTGCTCAGCCATGGGAAACC
#U59672Antisense, 1499: AGGGGACTGGGGTTGCTC5′ R705, 1149: CTGCAGCCATGTCGGAAGCC
5-HT3B275Sense, 51: CACAGCGACACCTCAGCCTPosition 1: first base of the start codon
#NM_022189Antisense, 304: TGGCACTGAGAGGGAGAGAGAT
  • F1-a Cauli et al. 1997.

  • F1-b Bochet et al. 1994.