Table 1.

Composition of oligonucleotides and competitive inhibitors used for EMSA

OligoSequenceRegion1-a
Oligo 1 TCTAACAACCATAGGGCGTGGTCGGGCTGGC1474–1505
Oligo 1A TCTAACAACCAT1474–1486
Oligo 1B           ATAGGGCGTGGTCG1484–1498
Oligo 1C                     GTCGGGCTGGC1495–1505
Oligo 2 TGCAGCATCCTAGCGGGCCCTCTGCCAGCACTTTGCTCCGAG1525–1565
Oligo 2A TGCAGCATCCTAGCG1525–1538
Oligo 2B                GGCCCTCTGCCAG1539–1551
Oligo 2C                             CACTTTGCTCCGAG1552–1565
Oligo 2D                         CCAGCACTTTGCTCCGAG1548–1565
Oligo 3 GCTGCAGAAGTAGATGGGGGCGGGGTGCTGGATGTAGCACGAGGTCTGG1665–1713
Non-Specific CAGTCATGACTTCGACTAGCACTTCATCAG
Sp1 CCCTTGGTGGGGGCGGGGCCTAAGCTGCG
Mutant Sp1 CCCTTGGTGGGTTGGGGGCCTAAGCTGCG1-b
NFI GGCACCTGTTTCAATTTGGCACGGAGCCAACAG
Mutant NFI GGCACCTGTTTCAATTTGTTACGGATTCAACAG1-b
  • F1-a Region of the rat peripherin gene, numbered according to National Center for Biotechnology Information accession M26232.

  • F1-b Bold nucleotides are changes to the consensus binding site.