Gene Accession No. Sense Antisense
TH M69200 CACCTGGAGTACTTTGTGCG (387), CCTGTGGGTGGTACCCTATG (1525)
GAD67 Z49976 TGACATCGACTGCCAATACC (731), GGGTTAGAGATGACCATCCG (1835)
OX1AF394596 TGGGTATGGCCTATTTCCAG (306), ACAAGGACTTGTGTCTGGCA (788)
OX2 AF394597 CTTCCAGCTACCCTCGTTGT (37), CTAATCCGAGCCTTGCTCTG (575)