Gene Sense Antisense
TH TGCACACAGTACATCCGTCA (936), TCTGACACGAAGTACACCGG (1312)
GAD67 CATATGAAATTGCACCCGTG (761), CGGTGTCATAGGAGACGTCA (1462)
OX1 ATTTCCAGATCTTCCGCAAG (318), GGCACTGTTGGCGTACACTA (670)
OX2 TTGGTTCTTTGGACAGTCCC (72), CTTTGGGTAAACTTCACCGC (378)